Use of a cacnb3 gene inhibitor and a cacnb3 protein

Abstract

The present application relates to the field of tumor treatment, and particularly relates to the use of CACNB3 protein and CACNB3 gene inhibitor in preparing a prognosis evaluation product of ovarian cancer and a drug for treating CACNB3 high-expression ovarian cancer, respectively. It is found for the first time that the expression level of CACNB3 protein in ovarian cancer tissue higher than a predetermined threshold indicates a poorer prognosis. The present application designs suitable RNAi target sequence and corresponding siRNA and shRNA sequence for CACNB3 gene, and effectively reduces the mRNA expression amount of the target gene in CACNB3 high-expression ovarian cancer cells by using a lentivirus expressing shRNA, and has a high inhibition efficiency on the cell proliferation and cell migration of CACNB3 high-expression ovarian cancer cells, and can be used in preparing a drug for treating ovarian cancer. The present application provides a new target for guiding the treatment of ovarian cancer.

Description

Technical Field

[0001] This invention relates to the field of tumor treatment, and more particularly to the use of CACNB3 protein and CACNB3 gene inhibitors in the preparation of prognostic assessment products for ovarian cancer and in the preparation of drugs for treating ovarian cancer with high CACNB3 expression. Background Technology

[0002] Ovarian cancer is one of the most common malignant tumors of the female reproductive system, characterized by insidious onset, lack of specific early symptoms, and often being diagnosed at an advanced stage, resulting in a generally poor clinical prognosis. Although comprehensive treatment regimens based on cytoreductive surgery combined with platinum-based chemotherapy are relatively mature, and targeted therapy and immunotherapy have shown some benefits in some patients, ovarian cancer still generally suffers from insufficient prognostic assessment methods, rapid metastasis and progression, and a lack of individualized treatment strategies, limiting the efficacy of existing treatments. Therefore, discovering new specific gene targets and establishing corresponding prognostic assessment and intervention strategies has become an urgent clinical need to improve the prognosis of ovarian cancer patients.

[0003] The CACNB3 (calcium voltage-gated channel auxiliary subunit beta 3) gene encodes the β3 auxiliary subunit of an L-type voltage-gated calcium channel. Previous research on the CACNB3 gene has primarily focused on neuroscience. To date, there are no systematic reports on the expression characteristics, biological function, and prognostic value of the CACNB3 gene in ovarian cancer, nor have any publicly disclosed technical solutions proposed using the CACNB3 gene as a therapeutic target for ovarian cancer. The role of the CACNB3 gene in ovarian cancer remains unclear. Summary of the Invention

[0004] In view of the current lack of prognostic biomarkers and therapeutic targets for ovarian cancer, the purpose of this invention is to provide the use of CACNB3 protein in the preparation of ovarian cancer prognostic assessment products and the use of CACNB3 gene inhibitors in the preparation of drugs for treating ovarian cancer with high CACNB3 expression.

[0005] To achieve the objectives of this invention, the following technical solution is adopted:

[0006] According to the present invention, the CACNB3 protein and CACNB3 gene transcript are derived from humans, and the NCBI reference sequence of the CACNB3 gene transcript is NM_001206917.

[0007] This invention, through the analysis of clinical samples, revealed a positive correlation between CACNB3 gene expression and pathological data such as tumor size, T-score, N-score, M-score, and clinical stage. Specifically, as the malignancy of the tumor increases, CACNB3 gene expression also increases, and high expression levels are significantly associated with poor prognosis. This finding supports the feasibility and research value of CACNB3 as a potential novel therapeutic target for ovarian cancer.

[0008] The terms "T," "N," and "M" are concepts defined by the International Union Against Cancer (UICC) for classifying tumors to determine their extent during cancer treatment. Each letter represents a different meaning. T indicates the size and extent of the primary tumor, with four grades: T1, T2, T3, and T4. A higher number indicates a larger tumor volume and greater extent of invasion. There are also two other grades: Tis and T0, indicating the tumor has only reached the epithelial layer (carcinoma in situ) or no tumor lesions were found at the examined site, respectively. N represents regional lymph nodes, reflecting the status of lymph node metastasis related to the tumor, with four grades: N0, N1, N2, and N3. N0 indicates no lymph node invasion, and a higher number indicates more local lymph node metastasis. If lymph node metastasis cannot be determined, Nx is used. M indicates distant metastasis, with M0 indicating no metastasis and M1 indicating metastasis. Based on this, different clinical stages are determined using combinations of the three TNM indicators.

[0009] This invention provides the use of CACNB3 protein in the preparation of products for assessing the prognosis of ovarian cancer. Specifically, compared to a CACNB3 protein expression level in ovarian cancer tissue not exceeding a predetermined threshold, a CACNB3 protein expression level exceeding a predetermined threshold indicates a worse prognosis, where the prognosis refers to overall survival or progression-free survival.

[0010] The ovarian cancer tissue refers to a tissue sample containing cancer cells obtained from an individual pathologically diagnosed with ovarian cancer. Its sources include, but are not limited to: primary tissue directly taken from the site of the primary ovarian tumor; metastatic tissue taken from ovarian cancer metastases (such as the peritoneum, greater omentum, lymph nodes, etc.); and recurrent or persistent tissue taken from ovarian cancer lesions that have recurred or persisted after initial treatment. The methods of acquisition include, but are not limited to, fresh tissue samples obtained through surgical resection, biopsy (such as needle biopsy), or laparoscopic examination; tissue samples that have been fixed (such as formalin fixation) and embedded in paraffin (e.g., clinical pathological samples, archived tissue samples, tissue microarrays composed of paraffin-embedded masses, etc.); organoids containing ovarian cancer cells; patient-derived xenograft model tissue; or in vitro cultured cell lines derived from ovarian cancer patients.

[0011] The CACNB3 protein expression level described in this invention refers to the amount or relative abundance of the CACNB3 protein in the ovarian cancer tissue. It can be quantitatively or semi-quantitatively determined using protein detection methods known in the art, including but not limited to immunohistochemistry (IHC), Western blot, ELISA, mass spectrometry, flow cytometry, or immunofluorescence detection. The CACNB3 protein expression level can be expressed in any of the following ways:

[0012] (1) Absolute concentration;

[0013] (2) The ratio relative to the internal reference protein;

[0014] (3) The fold increase in expression relative to the control sample;

[0015] (4) Scoring based on staining intensity and the proportion of positive cells.

[0016] This invention also provides the use of CACNB3 gene inhibitors in the preparation of CACNB3-overexpressing ovarian cancer treatment products.

[0017] The CACNB3-overexpressing ovarian cancer treatment product is an oncology treatment drug or an enhancer of oncology chemotherapy drugs; the CACNB3 gene inhibitor is any one or more of siRNA or shRNA that targets and reduces the expression level of CACNB3 gene mRNA, or a lentivirus, adenovirus, or adeno-associated virus packaged with a nucleic acid construct containing the coding sequence of the aforementioned siRNA or shRNA; the characteristic of the CACNB3-overexpressing ovarian cancer is that the mRNA expression level of the CACNB3 gene in ovarian cancer tissue is higher than a predetermined threshold.

[0018] Preferably, the predetermined threshold is defined as the relative expression level of the CACNB3 gene mRNA in the ovarian cancer tissue being greater than 200% of the relative expression level in the IOSE80 cell line derived from normal ovarian tissue.

[0019] Relative expression level is a concept well known to those skilled in the art. It refers to the expression level of the target gene mRNA calculated using real-time quantitative PCR (qPCR) technology, with the expression level of the internal reference gene (such as GAPDH, β-actin, etc.) as a benchmark. It reflects the fold increase in the expression of the target gene (in this invention, the CACNB3 gene) relative to the internal reference gene.

[0020] Further preferably, the siRNA or shRNA is any one or more of the following groups (a), (b), and (c):

[0021] (a) siRNA whose target sequence is SEQ ID NO: 1 and whose nucleotide sequence is shown in SEQ ID NO: 4; or, shRNA encoding a target sequence of SEQ ID NO: 1 and whose nucleotide sequence is shown in SEQ ID NO: 7-8;

[0022] (b) siRNA with target sequence SEQ ID NO: 2, the nucleotide sequence of which is shown in SEQ ID NO: 5; or, shRNA encoding target SEQ ID NO: 2, the nucleotide sequence of which is shown in SEQ ID NO: 9-10;

[0023] (c) siRNA with target sequence SEQ ID NO: 3 and nucleotide sequence shown in SEQ ID NO: 6; or shRNA encoding SEQ ID NO: 3 and nucleotide sequence shown in SEQ ID NO: 11-12.

[0024] The present invention also provides a nucleic acid molecule for reducing the expression of the CACNB3 gene in ovarian cancer cells with high CACNB3 expression, wherein the nucleic acid molecule is siRNA with a nucleotide sequence as shown in any of SEQ ID NO:4-6; or shRNA with a nucleotide sequence as shown in any of SEQ ID NO:7-12.

[0025] The present invention also provides a CACNB3 gene interference nucleic acid construct, wherein the CACNB3 gene interference nucleic acid construct contains a sequence encoding siRNA or shRNA in a nucleic acid molecule that reduces CACNB3 gene expression in ovarian cancer cells with high CACNB3 expression as described above.

[0026] The present invention also provides a CACNB3 gene interference lentivirus, which is prepared by viral packaging of the CACNB3 gene interference nucleic acid construct with the assistance of lentivirus packaging plasmids and cell lines.

[0027] The present invention also provides a cell line, which is a cell line infected with the CACNB3 gene-interfering lentivirus.

[0028] Preferably, the cell line is selected from one or both of SK-OV-3 and HEY.

[0029] The present invention also provides a composition for treating CACNB3-overexpressing ovarian cancer, the active ingredient of which comprises: a nucleic acid molecule that reduces CACNB3 gene expression in CACNB3-overexpressing ovarian cancer cells; and / or, a CACNB3 gene-interfering nucleic acid construct; and / or, a CACNB3 gene-interfering lentivirus; and / or, the cell line; and / or, an ovarian cancer chemotherapy drug and a pharmaceutically acceptable carrier or excipient.

[0030] Compared with the prior art, the present invention has at least the following beneficial effects:

[0031] The expression level of CACNB3 protein in ovarian cancer tissue can serve as an independent biomarker for assessing the prognosis of ovarian cancer. This invention has guiding significance for establishing new standards for the prognostic evaluation of ovarian cancer.

[0032] This invention provides a systematic and feasible targeted inhibition technology for CACNB3 gene expression. The invention focuses on constructing and providing various technical forms of the CACNB3 gene, including interfering nucleic acid molecules (such as shRNA / siRNA), nucleic acid constructs, expression vectors, viral vectors / viral particles, and intervention cells. This forms a complete technical solution from sequence design and delivery expression to cell model construction, which can be used for effective and controllable targeted intervention of CACNB3 expression in research and product development related to CACNB3-overexpressing ovarian cancer.

[0033] This invention improves the stability and selectivity of the technical solution by setting up multiple target site interference sequences. This invention designs and constructs multiple interference sequences targeting different regions of the human CACNB3 transcript, reducing the risk of fluctuations or failures in interference efficiency due to insufficient sequence specificity, splice isoform differences, or cellular background differences at a single target site. This provides ample options for screening highly efficient and specific CACNB3 inhibitory sequences, which is beneficial for improving the stability and reliability of the technical solution in different CACNB3-overexpressing ovarian cancer cell models and different application scenarios.

[0034] This invention employs a vector and viral delivery method, which facilitates stable inhibition of the CACNB3 gene. By constructing CACNB3 interfering nucleic acid molecules into vectors, especially lentiviral vectors, the interfering sequence can be continuously expressed in target cells, thereby providing conditions for obtaining cells or cell lines with stable downregulated CACNB3 expression. This is suitable for long-term research or product development needs related to CACNB3-overexpressing ovarian cancer.

[0035] The CACNB3 inhibitory cells and related product forms provided by this invention expand the technical pathway for targeted intervention in CACNB3-overexpressing ovarian cancer. This invention not only provides the CACNB3 inhibitor itself, but also further provides various product forms such as viral particles, cells that inhibit CACNB3 expression, and their compositions, providing multi-level technical support for functional research of CACNB3 in CACNB3-overexpressing ovarian cancer and its application in the prevention and / or treatment of CACNB3-overexpressing ovarian cancer.

[0036] This invention provides a new technological foundation for research and product development related to CACNB3-overexpressing ovarian cancer targets. By establishing a standardized and reproducible inhibition system around the CACNB3 gene, this invention provides a technological basis for further clarifying the role of CACNB3 in CACNB3-overexpressing ovarian cancer and its feasibility as a potential intervention target, which is beneficial to enriching the methods for molecular targeting research and related product development in CACNB3-overexpressing ovarian cancer. Attached Figure Description

[0037] Figure 1 The figure shows the background expression level of the CACNB3 gene in normal human ovarian surface epithelial cells IOSE80 and different ovarian cancer cells (SK-OV-3, Caov-3, A2780, HEY, OVCAR-3 and HO-8910) detected by the RT-qPCR method in this invention.

[0038] Figure 2 The image shows the expression level of the CACNB3 gene in SK-OV-3 cells infected with the lentivirus of Example 1, detected by the RT-qPCR method of this invention.

[0039] Figure 3 The figure shows the fold change in cell growth of SK-OV-3 (left) and HEY (right) cells after infection with lentivirus in Example 1, measured by the CCK8 assay in this invention, from day 1 to day 5.

[0040] Figure 4 The figure shows the number of migrating cells in SK-OV-3 (left) and HEY (right) cells after 24 hours of culture, measured by the Transwell assay of cells in this invention after infection with lentivirus of Example 1.

[0041] Figure 5 The image shows the expression of CACNB3 measured by immunohistochemistry of clinical samples in this invention.

[0042] Figure 6 The results of Kaplan-Meier Overall survival analysis are shown in the immunohistochemical staining results based on tissue microarrays in this invention.

[0043] Figure 7 The results of Kaplan-Meier disease-free survival analysis are shown in the immunohistochemical staining results based on tissue microarrays in this invention. Detailed Implementation

[0044] The present invention will be further described below with reference to embodiments and accompanying drawings. Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention. Test methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or according to the conditions recommended by the respective manufacturers. Unless otherwise specified, the reagents and chemicals involved in the embodiments are all commercially available products.

[0045] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0046] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, cell culture, recombinant DNA technology, and related fields.

[0047] In some specific embodiments, the tumor is ovarian cancer.

[0048] In this invention, gene inhibitors refer to molecules that have an inhibitory effect on genes. Inhibitory effects on genes include, but are not limited to, inhibiting gene expression or activity. Taking the CACNB3 gene as an example, a CACNB3 gene inhibitor refers to a molecule that has an inhibitory effect on CACNB3, meaning that the target gene of a CACNB3 gene inhibitor is CACNB3. Inhibitory effects on CACNB3 include, but are not limited to, inhibiting CACNB3 expression or activity.

[0049] Inhibiting gene activity refers to reducing gene activity and thus decreasing the gene's biological function. Preferably, the gene activity is reduced by at least 10% compared to before inhibition, for example, at least 30%, 50%, 70%, or 90%.

[0050] Suppressing gene expression can be done by suppressing gene transcription or translation. Specifically, it can mean preventing gene transcription, reducing gene transcriptional activity, preventing gene translation, or reducing gene translation level.

[0051] Those skilled in the art can use conventional methods to regulate gene expression, such as gene knockout, homologous recombination, and interfering RNA.

[0052] The inhibition of gene expression can be verified by detecting expression levels using PCR and Western blotting. Preferably, compared with the wild type, gene expression is reduced by at least 10%, more preferably by at least 30%, even better by at least 50%, more preferably by at least 70%, even better by at least 90%, and optimally, there is no gene expression at all.

[0053] The tumor treatment product must include gene inhibitors, and use gene inhibitors as the effective ingredient for the aforementioned effects.

[0054] In the product, the active ingredient that performs the aforementioned function may be only a gene inhibitor, or it may contain other molecules that can perform the aforementioned function. That is, the gene inhibitor is the only active ingredient or one of the active ingredients in the product.

[0055] The product can be a single-component substance or a multi-component substance.

[0056] The product is primarily targeted at mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans.

[0057] The tumor treatment product is a tumor treatment drug or an enhancer of a tumor chemotherapy drug. The product is a pharmaceutical product. The dosage form of the pharmaceutical product is not specifically limited; for example, it may be an oral preparation or an injection. The pharmaceutical product may be a sustained-release preparation.

[0058] The gene inhibitor can be a nucleic acid molecule, polypeptide, protein, small molecule, or virus.

[0059] In one embodiment, the gene inhibitor may be a nucleic acid molecule that reduces gene expression in CACNB3-overexpressing ovarian cancer cells.

[0060] The nucleic acid molecule is selected from one or more of the following: antisense oligonucleotides, RNA aptamers, ribozymes targeting genes or their receptor polypeptides, nucleic acid constructs, double-stranded RNA (dsRNA), or short hairpin RNA (shRNA).

[0061] The double-stranded RNA contains nucleotide sequences that can hybridize with genes.

[0062] The shRNA contains nucleotide sequences that can hybridize with genes.

[0063] Furthermore, the double-stranded RNA comprises a first strand and a second strand, which are complementary to form an RNA dimer, and the sequence of the first strand is substantially the same as the target sequence in the target gene (e.g., the CACNB3 gene).

[0064] The target sequence in the target gene is the segment in the target gene corresponding to the mRNA segment that is recognized and silenced by the nucleic acid molecule.

[0065] Furthermore, the double-stranded RNA is a small interfering RNA (siRNA).

[0066] Furthermore, the target sequences of double-stranded RNAs that serve as inhibitors of the CACNB3 gene include:

[0067] SEQ ID NO: 1: GGCAAAGCGATCTGTGCTCAA;

[0068] SEQ ID NO:2:GGGACCCTCTCTGAAAGGTTA;

[0069] SEQ ID NO: 3: GGGCAAGAGGACCCATATTGA.

[0070] Furthermore, the double-stranded RNA comprises RNA with nucleotide sequences as shown in any of SEQ ID NO:4-6, specifically: SEQ ID NO:4: GGCAAAGCGAUCUGUGCUCAA; SEQ ID NO:5: GGGACCCUCUCUGAAAGGUUA; SEQ ID NO:6: GGGCAAGAGGACCAUCAUUGA.

[0071] The shRNA includes a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand and the antisense strand. The sequences of the sense strand and the antisense strand are complementary, and the sequence of the sense strand is substantially the same as the target sequence in the target gene (e.g., the CACNB3 gene).

[0072] Furthermore, the target sequence of the shRNA that serves as a CACNB3 inhibitor is shown in SEQ ID NO:1-3.

[0073] The shRNA, after being processed by enzyme digestion, can become siRNA, which can then specifically silence the expression of endogenous target genes in ovarian cancer cells.

[0074] Furthermore, the stem-loop sequence of the shRNA can be selected from any of the following: UUCAAGAGA, UUCG, CCACC, CUCGAG, AAGCUU, or CCACACC.

[0075] Furthermore, the CACNB3 gene is derived from humans.

[0076] In some specific embodiments, the protein may be an anti-CACNB3 antibody.

[0077] In some specific embodiments, the virus is selected from lentiviruses, adenoviruses, or adeno-associated viruses.

[0078] The lentivirus is prepared by viral packaging of various gene-interfering nucleic acid constructs with the assistance of lentiviral packaging plasmids and cell lines. This lentivirus can infect ovarian cancer cells and produce small interfering RNAs targeting corresponding genes (e.g., CACNB3), thereby inhibiting the proliferation of ovarian cancer cells.

[0079] The tumor treatment product of the present invention treats tumors by inhibiting the proliferation rate of ovarian cancer cells and / or inhibiting the migration of ovarian cancer cells.

[0080] Cell experiments have confirmed that gene inhibitors can significantly slow down the proliferation rate of ovarian cancer cells within 24 hours, and this trend becomes more pronounced over time.

[0081] This invention also provides a nucleic acid molecule for reducing the expression of a target gene in tumor cells, wherein the nucleic acid molecule is a double-stranded RNA with a nucleotide sequence as shown in any of SEQ ID NO:4-6; or, the nucleic acid molecule is shRNA, and the nucleotide sequence encoding the shRNA is as shown in any of SEQ ID NO:7-12. The target gene is selected from the CACNB3 gene.

[0082] The present invention also provides a CACNB3 gene interference nucleic acid construct containing a gene fragment encoding a double-stranded RNA, shRNA, or DNA encoding shRNA in the aforementioned nucleic acid molecule, and capable of expressing the double-stranded RNA, shRNA, or DNA encoding shRNA.

[0083] The CACNB3 gene interference nucleic acid construct can be obtained by cloning a gene fragment encoding the aforementioned human target gene double-stranded RNA, shRNA, or DNA encoding shRNA into a known vector. Taking the CACNB3 gene interference nucleic acid construct as an example, the CACNB3 gene interference nucleic acid construct can be obtained by cloning a gene fragment encoding the aforementioned human CACNB3 gene double-stranded RNA, shRNA, or DNA encoding shRNA into a known vector.

[0084] Furthermore, the CACNB3 gene interference nucleic acid construct is a CACNB3 gene interference lentiviral vector.

[0085] Furthermore, the CACNB3 gene interference lentiviral vector also contains a promoter sequence and / or a nucleotide sequence encoding a detectable marker in ovarian cancer cells; preferably, the detectable marker is green fluorescent protein (GFP).

[0086] Furthermore, the lentiviral vector can be selected from: BR-V108, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pL KO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, Any of pLP / VSV-G, pENTR / U6, pLenti6 / BLOCK-iT-DEST, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, and pGCSIL-GFP.

[0087] The siRNA of this invention can be used alone or in combination with other drugs to inhibit the proliferation of ovarian cancer cells, and can further be used as a drug or preparation for treating ovarian cancer. When used as a drug or preparation for treating ovarian cancer, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of a skilled physician's expertise.

[0088] This invention also provides three CACNB3 gene interference lentiviruses, which are prepared by viral packaging of the aforementioned CACNB3 gene interference nucleic acid constructs with the assistance of lentiviral packaging plasmids and cell lines. These lentiviruses can infect ovarian cancer cells and produce small interfering RNA targeting the target gene, thereby inhibiting the proliferation of ovarian cancer cells.

[0089] The present invention also provides two cell lines, which are cell lines infected with the CACNB3 gene-interfering lentivirus.

[0090] In some specific embodiments, the cell lines are selected from one or more of the following: IOSE80 (purchased from Beina Biotechnology Co., Ltd.), SK-OV-3 (purchased from Wuhan Pronosai Life Science Co., Ltd.), Caov-3 (purchased from Wuhan Elite Biotechnology Co., Ltd.), A2780 (purchased from Wuhan Pronosai Life Science Co., Ltd.), HEY (purchased from Wuhan Pronosai Life Science Co., Ltd.), OVCAR-3 (purchased from Wuhan Pronosai Life Science Co., Ltd.), and HO-8910 (purchased from Saibaikang Biotechnology Co., Ltd.).

[0091] The present invention also provides a composition for treating tumors, wherein the active substance comprises: the aforementioned nucleic acid molecule; and / or, the aforementioned CACNB3 gene interference nucleic acid construct; and / or, the aforementioned CACNB3 gene interference lentivirus; and / or, the cell line; and / or, a tumor chemotherapy drug and a pharmaceutically acceptable carrier or excipient.

[0092] The composition for treating tumors is a composition for treating ovarian cancer.

[0093] The composition may be a pharmaceutical composition.

[0094] When the composition is used to prevent or treat ovarian cancer in a subject, an effective dose of the composition needs to be administered to the subject. Using this method, the growth, proliferation, recurrence, and / or metastasis of the ovarian cancer are inhibited. Furthermore, at least 10%–30%, 30%–50%, 50%–70%, 70%–90%, and 90%–100% of the growth, proliferation, recurrence, and / or metastasis of the ovarian cancer are inhibited.

[0095] The composition is not particularly limited in form and can be in various forms such as solid, liquid, gel, semi-fluid, or aerosol.

[0096] The composition is primarily intended for use with mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans.

[0097] The present invention also provides a method for treating ovarian cancer, comprising administering an effective dose of the tumor treatment product to a subject.

[0098] In one embodiment, the tumor is ovarian cancer. The tumor treatment product is an ovarian cancer treatment product. Further, when the drug is used to prevent or treat ovarian cancer in a subject, an effective dose of the drug needs to be administered to the subject. Using this method, the growth, proliferation, recurrence, and / or metastasis of the ovarian cancer are inhibited. Further, at least 10%–30%, 30%–50%, 50%–70%, 70%–90%, and 90%–100% of the growth, proliferation, recurrence, and / or metastasis of the ovarian cancer are inhibited.

[0099] The object of the method can be a person.

[0100] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0101] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0102] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0103] Example 1: Preparation of CACNB3 Interference Lentiviral Virus

[0104] This embodiment provides a lentivirus for ovarian cancer, wherein the RNAi target sequence of the lentivirus has the following fragment coding sequence:

[0105] SEQ ID NO:1: GGCAAAGCGATCTGTGCTCAA

[0106] SEQ ID NO:2:GGGACCCTCTCTGAAAGGTTA

[0107] SEQ ID NO:3: GGGCAAGAGGACCCATCATTG

[0108] Secondly, the above target sequences are constructed into the corresponding lentiviral vectors to construct lentiviral vector plasmids. The preparation steps include:

[0109] (1) Select the tool vector and obtain the target gene fragment.

[0110] BR-V108 was selected as the tool vector (purchased from Shanghai Yibeirui Biomedical Technology Co., Ltd.), and its nucleotide sequence is shown in SEQ ID NO:13. The sequence of the target gene fragment is shown in SEQ ID NO:1-3.

[0111] (2) Synthesize single-stranded primers and oligo DNA

[0112] In step (2), the single-stranded primer contains the following three sets of sequences:

[0113] I) Design and synthesize primer set KD-1 targeting the sequence shown in SEQ ID NO:1:

[0114] SEQ ID NO:7:

[0115] 5'-ccggGGCAAAGCGATCTGTGCTCAActcgagTTGAGCACAGATCGCTTTGCCtttttg-3'

[0116] SEQ ID NO:8:

[0117] 5'-gatccaaaaaGGCAAAGCGATCTGTGCTCAActcgagTTGAGCACAGATCGCTTTGCC-3'

[0118] II) Design and synthesize primer set KD-2 targeting the sequence shown in SEQ ID NO:2:

[0119] SEQ ID NO:9:

[0120] 5'-ccggGGGACCCTCTCTGAAAGGTTActcgagTAACCTTTCAGAGAGGGTCCCtttttg-3'

[0121] SEQ ID NO:10:

[0122] 5'-gatccaaaaaGGGACCCTCTCTGAAAGGTTActcgagTAACCTTTCAGAGAGGGTCCC-3'

[0123] III) Design and synthesize primer set KD-3 targeting the sequence shown in SEQ ID NO:3:

[0124] SEQ ID NO:11:

[0125] 5'-ccggGGGCAAGAGGACCATCATTGActcgagTCAATGATGGTCCTCTTGCCCtttttg-3'

[0126] SEQ ID NO:12:

[0127] 5'-gatccaaaaaGGGCAAGAGGACCATCATTGActcgagTCAATGATGGTCCTCTTGCCC-3'

[0128] The above primers were annealed to form oligo DNA.

[0129] The annealing system consisted of 2.5 μL upstream chain (10 μmol / L) + 2.5 μL downstream chain (10 μmol / L) + 5 μL annealing buffer + 10 μL ultrapure water. The annealing temperature was as follows: 95℃ for 5 min in a PCR instrument; 95℃ for 40 s; decreasing the temperature by 0.7℃ every 40 s for 99 cycles; 25℃ for 3 min; and stored at 8℃.

[0130] (3) After ligating oligo DNA and linearized tool vector, transform

[0131] The tool vector was first digested with enzymes at Age I and BamH I. The digestion system consisted of 16 μL ultrapure water + 30 μL 10×CutSmart Buffer (manufacturer: NEB, component number: B6004SVIA) + 12 μL purified plasmid DNA (1 μg / μL) + 1 μL Age I (10 U / μL) + 1 μL EcoR I (10 U / μL). The reaction was carried out at 37℃ for 3 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.

[0132] The enzyme-digested tool vector was reacted with oligo DNA in a reaction system at 22°C for 1 hour. The reaction system was as follows:

[0133] 50 ng of enzyme-digested tool vector

[0134] 2μL oligo DNA

[0135] 0.5μL T4 DNA ligase (EL0011, ThermoFisher)

[0136] 2μL 10×T4 DNA ligase Buffer (EL0011, ThermoFisher)

[0137] Ultrapure water (to a total volume of 20 μL)

[0138] Thaw E. coli competent cells (Stable, DL1080) on ice, add 10 μL of ligation product to 100 μL of competent cells, and place on ice for 1 min; heat shock in a 42℃ water bath for 40 s, and place on ice for 2 min; add 200 µL of antibiotic-free LB liquid medium, and shake in a shaker at 37℃ at 200 rpm for 1 h; take 150 µL of bacterial culture and spread it evenly on LB solid medium containing ampicillin (Amp) resistance, and incubate in a 37℃ incubator for 14 h.

[0139] (4) Colony PCR identification, sequencing, and plasmid extraction

[0140] In the colony PCR identification, the identification primer-F sequence is SEQ ID NO:14: CCTATTTCCCATGATTCCTTCATA, and the identification primer-R sequence is SEQ ID NO:15: GTAATACGGTTATCCACGCG;

[0141] The PCR reaction system was as follows: 10 μL 2×Hieff UNICON® HotStart PCR Master Mix (WithDye) (manufacturer: Yisheng, product number: 10732ES03) + 0.4 μL identification primer-F + 0.4 μL identification primer-R + ultrapure water (to a total volume of 20 μL);

[0142] PCR amplification conditions were as follows: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min; after PCR, 5 μL of product was taken and the bands were detected by 1% agarose gel electrophoresis (for electrophoresis loading: the blank control used ultrapure water as a template; the negative control used an empty vector without the target gene inserted as a template).

[0143] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.

[0144] The correctly sequenced bacterial culture was transferred to 150 mL of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was then collected, and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit.

[0145] Bacterial cell enrichment: Take 10 mL of bacterial solution, centrifuge at 8000 rpm for 4 min, and collect the bacterial cells;

[0146] Bacterial lysis: Resuspend the bacterial cells in 1 mL of GP1 Buffer and transfer to a 2.0 mL centrifuge tube;

[0147] Cycle termination: Add 0.5 mL of GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; take 0.7 mL of the supernatant from the previous step and add it to the activated adsorption column GP, ​​centrifuge at 3000 rpm for 1 min; remove the waste liquid in the collection tube;

[0148] Washing: Add 0.5 mL of GPW Buffer and centrifuge at 12000 rpm for 1 min;

[0149] Recovery: Replace the collection tube, add 0.2 mL of GP3 Buffer to the adsorption column, let stand for 1 min, and centrifuge at 12000 rpm for 1 min;

[0150] Stability: Centrifuge tubes containing the recovered solution were placed in a 37°C incubator for 15 minutes.

[0151] (5) Lentiviral packaging

[0152] The lentivirus was prepared by co-transfecting 293T cells (purchased from Cybio Biotechnology Co., Ltd.) with the above-mentioned lentiviral vector plasmid, psPAX2 vector plasmid (nucleotide sequence as shown in SEQ ID NO:16) and pMD2.G vector (nucleotide sequence as shown in SEQ ID NO:17).

[0153] The preparation steps of the lentivirus are as follows:

[0154] (1) 12-18 hours before transfection, 293T cells (ATCC ACS-4500) in logarithmic growth phase were digested with trypsin and the cell density was adjusted to about 5×10⁶ cells / years using medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 70%–80%.

[0155] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;

[0156] (3) Add DNA solution (10 μg lentiviral vector plasmid, 7.5 μg pMD2.G vector plasmid, and 5 μg psPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of transfection reagent Polybrene (manufacturer: Santa Cruz Biotechnology, catalog number: sc-134220A) to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.

[0157] (4) Add the mixture to the 293T cell culture medium, mix gently, and place in a 37℃, 5% CO2 cell culture incubator for 6 hours. Replace with 10 mL of 10% FBS medium and continue culturing in a 37℃, 5% CO2 incubator for 60 hours.

[0158] (5) Collect cell supernatant 48h and 72h after transfection for virus titer determination and concentration.

[0159] Example 2: Lentiviral reduction of CACNB3 expression

[0160] Experimental group setup:

[0161] shCtrl: Normal target cells infected with negative control lentivirus (control group);

[0162] shCACNB3-1, shCACNB3-2, and shCACNB3-3 correspond to the normal target cell groups (experimental groups) infected with RNAi lentiviruses in groups I), II), and III) of Example 1, respectively.

[0163] 1. Detection of CACNB3 gene background expression in ovarian cancer cells

[0164] The background expression level of the CACNB3 gene was detected by selecting normal human ovarian surface epithelial cells IOSE80 and ovarian cancer cell lines SK-OV-3, Caov-3, A2780, HEY, OVCAR-3 and HO-8910.

[0165] 2. Real-time qPCR detection of the expression level of the target gene CACNB3

[0166] After total RNA extraction according to the Trizol procedure of Sigma, 4X gDNA wiper mix and 1.0 μg total RNA were added to a PCR tube, and RNase-free H2O was added to 8 μL. After mixing, the mixture was centrifuged and incubated at 42℃ for 2 min. 5X qPCR supermix was added, and reverse transcription was performed at 55℃ for 15 min and 85℃ for 2 min. The resulting cDNA was stored at -80℃ for later use.

[0167] The real-time qPCR reaction system was as follows: 5.0 μL SYBR Green mastermixes + 0.25 μL upstream primer (10 μmol / L, sequence SEQ ID NO:18: ACTCCAGCGTCTCATTCGC) + 0.25 μL downstream primer (10 μmol / L, sequence SEQ ID NO:19: TGGTTCTGAAGTCCGGGGAT) + 0.2 μL Dye2 (Qihengxing, FS-Q1001) + 2.3 μL LNase-Free H2O.

[0168] The primer sequence for the internal reference gene GAPDH is as follows:

[0169] Upstream primer SEQ ID NO:20: TGACTTCAACAGCGACACCCA

[0170] Downstream primer SEQ ID NO:21: CACCCTGTTGCTGTAGCCAAA

[0171] Through 2 -ΔΔCt The expression level of mRNA was analyzed using a method.

[0172] Experimental results:

[0173] The expression results of gene CACNB3 in different cells are shown in the figure. Figure 1 The CACNB3 gene mRNA showed high expression levels in both SK-OV-3 and HEY cells. Specifically, the relative expression level in SK-OV-3 cells was 2.577 times that in IOSE80 cells, the relative expression level in HEY cells was 2.257 times that in IOSE80 cells, and the relative expression level in Caov-3 cells was 1.836 times that in IOSE80 cells. SK-OV-3 and HEY cells were subsequently selected as the main cell models for functional validation. In this invention, a relative expression level of CACNB3 gene mRNA greater than 200% in IOSE80 cells is defined as high CACNB3 expression.

[0174] The effect of the lentivirus prepared in Example 1 on CACNB3 expression in SK-OV-3 and HEY cells is shown in the figure. Figure 2 .

[0175] like Figure 2 As shown, in SK-OV-3 and HEY cells, after infection with lentivirus, compared to the shCtrl group:

[0176] The CACNB3 gene knockdown efficiency of the shCACNB3-1 group (i.e., the virus prepared by the vector containing the KD-1 group nucleotide sequence in Example 1) reached 55.7% (p<0.05).

[0177] The CACNB3 gene knockdown efficiency of the shCACNB3-2 group (i.e., the virus prepared by the vector containing the KD-2 group nucleotide sequence in Example 1) reached 57.9% (p<0.05).

[0178] The CACNB3 gene knockdown efficiency of the shCACNB3-3 group (i.e. the virus prepared from the vector containing the KD-3 group nucleotide sequence in Example 1) reached 45.2% (p<0.05).

[0179] The above results show that the three interference sequences targeting CACNB3 designed in this invention can effectively downregulate the expression of the CACNB3 gene. Among them, shCACNB3-1 and 2 have the highest knockdown efficiency and can be used as the preferred interference sequences for subsequent functional experiments.

[0180] Example 3: Lentiviral cells reduce the growth rate of ovarian cancer cells

[0181] CCK8 assay for growth:

[0182] After passage of SK-OV-3 and HEY cells, cells in the logarithmic growth phase were digested with trypsin to prepare a cell suspension. The cell suspension (approximately 1500-2500 cells) was seeded into 96-well culture media and cultured at 37°C in a 5% CO2 incubator until the cell confluence reached approximately 20-30%. An appropriate amount of virus was added based on the cell MOI value. After 12 hours, the cell status was observed, and the culture medium was replaced. Two to three days after infection, the expression of the reporter gene GFP on the lentivirus was observed. When the fluorescence rate reached approximately 80%, the cells were cultured further until the confluence reached 70%-90%, and the cells were collected.

[0183] Cells in the logarithmic growth phase of each experimental group were trypsinized and resuspended in complete culture medium to form a cell suspension. Cell counts were performed. The cell density for plating was determined based on cell size (set to 2000 cells / well). Cells were incubated at 37°C in a 5% CO2 incubator, with three replicates per group and a culture volume of 100 μL / well. The number of cells added to each well was ensured to be consistent. CCK8 assays were performed daily for 5 consecutive days, starting the second day. OD450 absorbance was read using a microplate reader to accurately calculate the number of cells in each well. The data were statistically analyzed and plotted to create a 5-day cell proliferation curve and calculate the cell proliferation inhibition rate using the formula: Cell proliferation inhibition rate (%) = (1 - Experimental OD450 value / Control group OD450 value) × 100%

[0184] Experimental results:

[0185] Five days after lentivirus infection of the target cells, the growth curves showing the change in cell number over time for Example 1 and the control group are shown below. Figure 3 .

[0186] Depend on Figure 3 It was found that after lentiviral infection, compared with the shCtrl group, the proliferation of SK-OV-3 cells in the shCACNB3-1 and 2 groups in Example 1 was significantly inhibited, with cell proliferation inhibition rates of 27% and 37%, respectively (p<0.05); the proliferation of HEY cells in the shCACNB3-1 and 2 groups was also significantly inhibited, with cell proliferation inhibition rates of 22% and 36%, respectively (p<0.05). These results indicate that inhibiting CACNB3 expression can significantly reduce the proliferation ability of ovarian cancer cells SK-OV-3 and HEY.

[0187] Example 4 Ovarian cancer cell migration experiment

[0188] Transwell cell migration in vitro assay:

[0189] (1) After passage culture of SK-OV-3 and HEY cells, trypsin digestion was performed on SK-OV-3 and HEY cells in the logarithmic growth phase to prepare cell suspension; the cell suspension was seeded in 96-well and cultured in a 37°C, 5% CO2 incubator until the cell confluence reached about 20-30%; according to the cell MOI value, an appropriate amount of virus corresponding to shCACNB3-1 and shCACNB3-2 in Example 1 was added; the cell status was observed after 12 hours and the culture medium was changed; the expression of the reporter gene GFP on the lentivirus was observed 2-3 days after infection. When the fluorescence rate reached about 80%, the cells were cultured until the confluence was 70%-90% and the cells were collected.

[0190] (2) Take the required number of chambers into an empty 24-well plate, add 100µL of serum-free culture medium into the chamber, and incubate for 1~2 hours;

[0191] (3) Preparation of cell suspension: SK-OV-3 and HEY cells in the logarithmic growth phase were digested with trypsin and resuspended in low serum medium to prepare cell suspension; cell counting was performed on the cell suspension using a hemocytometer.

[0192] (4) After step (1) is completed, carefully remove the culture medium from the small chamber, add 600µL of culture medium containing 30% FBS to the lower chamber, dilute the cells with serum-free culture medium at a certain ratio, and add 100µL of the cell suspension (containing 100,000~200,000 cells) to each small chamber;

[0193] (5) Use tweezers to transfer the chamber into the lower chamber containing 30% FBS medium and incubate in a tissue culture incubator for 24 hours;

[0194] (6) Invert the chamber onto absorbent paper to remove the culture medium, and gently remove the non-transferred cells with a cotton swab;

[0195] (7) Add 400µL of staining solution to the empty wells of the 24-well plate, immerse the chamber in the staining solution for 5 min, and stain and transfer cells on the lower surface of the membrane;

[0196] (8) Soak the membrane in a large glass of water, rinse it several times, air dry it, and take pictures of the membrane under a microscope.

[0197] Experimental results:

[0198] The comparison of the number of transferred cells between the experimental group and the control group after 24 hours of incubation in the Transwell chamber in Example 1 is shown in the figure below. Figure 4 .

[0199] from Figure 4 The results showed that after lentiviral infection, compared with the shCtrl group, the Transwell migration rates of SK-OV-3 cells in the shCACNB3-1 and 2 groups in Example 1 decreased by 48% and 61%, respectively (p<0.05); the Transwell migration rates of HEY cells in the shCACNB3-1 and 2 groups decreased by 49% and 76%, respectively (p<0.05). These results indicate that inhibiting CACNB3 expression can significantly suppress the migration ability of ovarian cancer cells SK-OV-3 and HEY.

[0200] Example 5: Expression of CACNB3 in clinical samples of ovarian cancer and its relationship with clinicopathological parameters and prognosis

[0201] Case and specimen sources

[0202] Ovarian cancer tissue microarrays were purchased from Shanghai Zocheng Biotechnology Co., Ltd., model number HOvaC143Su01-M-018, comprising 143 ovarian cancer samples. All samples had complete clinicopathological data (patient age, sex, tumor TNM stage, histological grade) and long-term follow-up information. All patients signed written informed consent forms prior to tissue collection.

[0203] Due to some samples having detached slides or incomplete pathological data (11 cases of detached slides and 29 cases of incomplete pathological data), to ensure the accuracy of statistical analysis, invalid samples were ultimately removed, and 103 valid ovarian cancer samples were included for subsequent experimental analysis. The tissue microarray specifically refers to a tissue microarray composed of paraffin-embedded blocks fixed in formalin.

[0204] CACNB3 expression detection method

[0205] Immunohistochemistry (IHC):

[0206] (1) Dewaxing treatment: ① Baking tissue slides at 65℃ for 30 min; ② Dewaxing in 3 cylinders with xylene for 10 min each; ③ Dehydration in 4 cylinders with alcohol gradient: 100% alcohol 3 times (5 min each time), 75% alcohol 5 min; ④ Rinsing with running water for 5 min.

[0207] (2) Antigen retrieval: Choose one of the two retrieval methods, and handle different tissue samples in separate containers to avoid cross-contamination:

[0208] ① Citric acid repair: Place the slide in the repair solution tank, put it in a pressure cooker with water added to 2 / 3 of the tank, boil at 270℃ and then reduce to 180℃ and boil for 5 minutes, keep warm for 10 minutes, and cool to room temperature.

[0209] ②EDTA restoration (1× concentration): Boil water in a pressure cooker, place the slide in the restoration solution tank, boil at 100℃ for 30 minutes, and cool to room temperature.

[0210] (3) Blocking treatment: ① Soak the slide in 1×PBS for several minutes; ② Draw a water barrier with an immunohistochemical pen; ③ Wash 3 times with 1×PBST (5 minutes each time); ④ Block with 3% hydrogen peroxide for 5 minutes; ⑤ Wash 3 more times with 1×PBST (5 minutes each time); ⑥ Block with 5% goat serum (select according to the species of the secondary antibody) for 15 minutes.

[0211] (4) Staining treatment: ① Incubate primary antibody (abclonal, A14710, 1:100) at 37℃ for 1 hour or at 4℃ overnight; ② Wash 3 times with 1×PBST (5 min each time); ③ Incubate secondary antibody at 37℃ for 1 hour; ④ Wash 3 times with 1×PBST (5 min each time); ⑤ Stain with DAB in the dark for 5 min, then stop with running water; ⑥ Counterstain with hematoxylin for 10-15 seconds, then rinse with running water for 2-3 min; ⑦ Separate with 0.25% hydrochloric acid alcohol for 1-2 seconds, then rinse with running water for 2-3 min; ⑧ Dehydrate with 2 tanks of anhydrous ethanol (2 min each), then clear with 2 tanks of xylene (2 min each); ⑨ Mount with neutral resin.

[0212] IHC 13-Point Scoring Criteria

[0213] The IHC comprehensive score consists of two parts: "positive cell percentage score" and "staining intensity score". The final score is the product of the two (positive cell percentage score × staining intensity score). The higher the score, the higher the CACNB3 protein expression level.

[0214] (1) Positive cell score (based on the percentage of positive cells):

[0215] 0 points - Negative: No positive signal in the cytoplasm, cell membrane, or nucleus.

[0216] 1 point - Positive: 0% < Positive cell percentage < 25%

[0217] 2 points - Positive: 25% ≤ Positive cell percentage < 50%

[0218] 3 points - Positive: 50% ≤ Positive cell percentage < 75%

[0219] 4 points - Positive: Positive cells account for ≥75%

[0220] (2) Staining color intensity score (divided according to staining depth):

[0221] The intensity of staining of the cytoplasm, cell membrane, or nucleus is scored from 0 to 3 points.

[0222] 0 points - Negative: No signal color in the cytoplasm, cell membrane, or nucleus and stroma.

[0223] 1 point - Positive: Pale yellow cytoplasm, cell membrane or nucleus and stroma.

[0224] 2 points - Positive: Cytoplasm, cell membrane or nucleus and stroma are brownish-yellow.

[0225] 3 points - Positive: Dark brown cytoplasm, cell membrane or nucleus and stroma.

[0226] Results: The IHC result was determined by the positive cell score × staining color intensity score. The higher the score, the higher the antibody expression.

[0227] 0 points - Negative, 1-4 points - Positive, 5-8 points - Positive++, 9-12 points - Positive+++

[0228] High and low expression grouping method

[0229] To compare the differences in clinicopathological features and prognosis between patients with high and low CACNB3 expression, all patients need to be divided into a high-expression group and a low-expression group. The grouping method is as follows:

[0230] First, the IHC scores of all ovarian cancer patients included in the analysis (103 patients with complete clinicopathological and follow-up data) were arranged from smallest to largest, and the median of all scores (i.e., the value in the exact middle of the ranking) was calculated. Then, using this median as a cut-off value, patients were divided into two groups: patients with IHC scores greater than the median were assigned to the CACNB3 high expression group; patients with IHC scores less than or equal to the median were assigned to the CACNB3 low expression group. In this invention, the cut-off value is 9. This grouping method is a standard grouping strategy widely used in clinical research, which can divide patients into two groups approximately equally, thereby ensuring the reliability of subsequent statistical comparisons.

[0231] Statistical analysis

[0232] This embodiment employs the following three statistical analysis methods to examine the relationship between CACNB3 expression levels and clinicopathological features and patient prognosis of ovarian cancer from different perspectives:

[0233] (1) Mann-Whitney U test—comparing the differences in CACNB3 expression levels among different clinicopathological groups

[0234] The Mann-Whitney U test is a nonparametric statistical method suitable for comparing two independent samples, and does not require the data to follow a normal distribution. In this study, the method was applied as follows: patients were divided into two groups according to each clinicopathological parameter (such as tumor size, T stage, N stage, M stage, clinical stage, etc.), and then the IHC composite score of CACNB3 was compared between the two groups to see if there was a significant difference. For example, for "tumor size," patients with smaller tumors (e.g., ≤12.2cm) were grouped together, and patients with larger tumors (e.g., >12.2cm) were grouped together. Then, the CACNB3 scores of these two groups were compared to see if there was a statistically significant difference. If the p-value <0.05, it indicates a significant difference in CACNB3 expression levels between the two groups, meaning that CACNB3 expression is correlated with this clinicopathological parameter.

[0235] (2) Spearman rank correlation analysis—assessing the direction and strength of the correlation between CACNB3 expression and clinicopathological parameters

[0236] The Mann-Whitney U test can only tell us whether there is a difference between two groups, but it cannot indicate whether CACNB3 expression is positively or negatively correlated with clinicopathological parameters, nor can it quantify the strength of the correlation. Therefore, Spearman rank correlation analysis was further used to address this issue. This method calculates the Spearman correlation coefficient ρ(rho), which ranges from -1 to +1: a positive ρ value indicates a positive correlation, meaning that when one variable increases, the other variable tends to increase as well; a negative ρ value indicates a negative correlation; the closer the absolute value of ρ is to 1, the stronger the correlation, and the closer it is to 0, the weaker the correlation. In this study, each patient's CACNB3 IHC comprehensive score was paired with its corresponding clinicopathological parameter values, and the Spearman correlation coefficient ρ and the corresponding P value were calculated. If P < 0.05 and ρ is positive, it indicates that CACNB3 expression is significantly positively correlated with the pathological parameter, meaning that as the malignancy represented by the pathological parameter increases, the expression level of CACNB3 also increases.

[0237] (3) Kaplan-Meier survival analysis and Log-rank test—assessing the impact of CACNB3 expression level on patient prognosis

[0238] Kaplan-Meier survival analysis is a method that graphically visualizes patient survival. Patients were divided into a high-CACNB3 expression group and a low-CACNB3 expression group according to the median grouping method described above, and survival curves were plotted for both groups. The horizontal axis of the survival curve represents the follow-up time (in months), and the vertical axis represents the survival probability (values ​​from 0-1 or 0%-100%). The value corresponding to each time point on the curve represents the probability that the patient survived to that time point. The faster the curve declines, the earlier the patient dies (or the disease relapses), and the worse the prognosis. By plotting the survival curves of the two groups on the same graph, the survival difference between the high-expression and low-expression groups can be visually compared. Based on the survival curves, the Log-rank test was used to determine whether the difference between the two survival curves was statistically significant. The Log-rank test compares the two survival curves as a whole and calculates a P-value: if P < 0.05, it indicates that there is indeed a significant difference in survival time between the two groups, meaning that the expression level of CACNB3 is significantly associated with patient prognosis.

[0239] In this embodiment, two prognostic indicators were analyzed: overall survival (OS, which is the time from diagnosis to death from any cause) and disease-free survival (DFS, which is the time from the end of treatment to disease recurrence or death).

[0240] All statistical analyses used P<0.05 as the criterion for statistical significance.

[0241] Experimental results:

[0242] (1) Differential expression of CACNB3 in ovarian cancer tissues at different clinical stages

[0243] from Figure 5 The results showed that CACNB3 protein expression was significantly increased in ovarian cancer tissues at Stage II compared to those at Stage III. This indicates that CACNB3 protein expression increases with the progression of ovarian cancer clinical stage, suggesting that CACNB3 may be closely related to the malignant progression of ovarian cancer.

[0244] (2) Relationship between CACNB3 expression and prognosis of ovarian cancer patients

[0245] Regarding total lifespan (OS): For example... Figure 6As shown, after dividing patients into high-expression and low-expression groups based on the median IHC composite score of CACNB3 expression, the survival curve of the high-expression group was significantly lower than that of the low-expression group, indicating that the overall survival time of the high-expression group was significantly shorter than that of the low-expression group. The Log-rank test showed P < 0.001, far below the significance threshold of 0.05, indicating a highly statistically significant difference in survival between the two groups. In other words, ovarian cancer patients with higher CACNB3 expression levels have shorter overall survival times and worse prognoses.

[0246] Regarding disease-free survival (DFS): For example... Figure 7 As shown, the disease-free survival curves of patients in the CACNB3 high-expression group were significantly lower than those of the low-expression group, indicating that patients in the high-expression group experienced disease recurrence or death earlier after treatment. The Log-rank test showed P=0.007, which is less than 0.05, indicating that the difference in disease-free survival between the two groups was statistically significant. This means that ovarian cancer patients with high CACNB3 expression not only have shorter overall survival times but also experience earlier disease recurrence.

[0247] (3) Difference analysis of CACNB3 expression and clinicopathological parameters of ovarian cancer

[0248] The Mann-Whitney U analysis in Table 1 shows that among 103 ovarian cancer patients with complete clinicopathological data, the expression levels of CACNB3 were compared among the groups after grouping patients according to various clinicopathological parameters. The results are as follows: The expression levels of the CACNB3 gene showed statistically significant differences among patient groups with different tumor sizes (P = 0.001), T values ​​(P = 0.030), N values ​​(P < 0.001), M values ​​(P = 0.001), and clinical stages (P = 0.001). Overall, ovarian cancer patients with larger tumors, more extensive local invasion, more lymph node metastases, distant metastases, and later clinical stages had higher CACNB3 expression levels in their tumor tissues.

[0249] Table 1. Mann-Whitney U analysis of the relationship between CACNB3 expression and tumor characteristics in ovarian cancer patients.

[0250]

[0251] (4) Correlation analysis of CACNB3 expression with clinicopathological parameters of ovarian cancer

[0252] The Spearman rank correlation analysis in Table 2 shows that, among the 103 ovarian cancer patients, the expression of the CACNB3 gene was positively correlated with pathological data such as tumor size (ρ=0.321, P=0.001), T value (ρ=0.215, P=0.030), N value (ρ=0.355, P<0.001), M value (ρ=0.329, P=0.001), and clinical stage (ρ=0.339, P<0.001). That is, as the malignancy of the tumor increases, the expression of the CACNB3 gene increases.

[0253] Table 2. Spearman rank correlation analysis of the relationship between CACNB3 expression and tumor characteristics in ovarian cancer patients.

[0254]

[0255] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. The use of CACNB3 gene inhibitors in the preparation of CACNB3-overexpressing ovarian cancer treatment products, characterized in that: The CACNB3-overexpressing ovarian cancer treatment product is a tumor treatment drug or an enhancer of tumor chemotherapy drugs; The CACNB3 gene inhibitor is any one or more of siRNA or shRNA that targets and reduces the expression level of CACNB3 gene mRNA, or a lentivirus, adenovirus, or adeno-associated virus packaged with a nucleic acid construct containing the coding sequence of the aforementioned siRNA or shRNA. The characteristic of CACNB3-overexpressing ovarian cancer is that the mRNA expression level of the CACNB3 gene in ovarian cancer tissue is higher than a predetermined threshold.

2. The use as described in claim 1, characterized in that: The predetermined threshold is defined as the relative expression level of the CACNB3 gene mRNA in the ovarian cancer tissue being greater than 200% of the relative expression level in the IOSE80 cell line derived from normal ovarian tissue.

3. The use as described in claim 1 or 2, characterized in that: The siRNA or shRNA is any one or more of the following groups (a), (b), and (c): (a) siRNA with target sequence SEQ ID NO: 1 and nucleotide sequence shown in SEQ ID NO: 4; or, shRNA encoding target SEQ ID NO: 1 and nucleotide sequence shown in SEQ ID NO: 7-8; (b) siRNA with target sequence SEQ ID NO: 2, the nucleotide sequence of which is shown in SEQ ID NO: 5; or, shRNA encoding target SEQ ID NO: 2, the nucleotide sequence of which is shown in SEQ ID NO: 9-10; (c) siRNA with target sequence SEQ ID NO: 3 and nucleotide sequence shown in SEQ ID NO: 6; or shRNA encoding SEQ ID NO: 3 and nucleotide sequence shown in SEQ ID NO: 11-12.

4. A nucleic acid molecule that reduces CACNB3 gene expression in CACNB3-overexpressing ovarian cancer cells, characterized in that: The nucleic acid molecule is siRNA with a nucleotide sequence as shown in any of SEQ ID NO:4-6; or shRNA with a nucleotide sequence as shown in any of SEQ ID NO:7-12.

5. A CACNB3 gene interference nucleic acid construct, characterized in that: The CACNB3 gene interference nucleic acid construct contains a sequence encoding the siRNA or shRNA in the nucleic acid molecule as described in claim 4.

6. A CACNB3 gene-interfering lentivirus, characterized in that: The CACNB3 gene interference nucleic acid construct as described in claim 5 is prepared by viral packaging with the assistance of lentiviral packaging plasmids and cell lines.

7. A cell line, characterized in that: The cell line is a cell line infected with the CACNB3 gene-interfering lentivirus as described in claim 6.

8. The cell line according to claim 7, characterized in that: The cell lines are selected from one or both of SK-OV-3 and HEY.

9. A composition for treating ovarian cancer with high CACNB3 expression, characterized in that: Its active ingredient contains: the nucleic acid molecule of claim 4; and / or the CACNB3 gene interference nucleic acid construct of claim 5; and / or the CACNB3 gene interference lentivirus of claim 6; and / or the cell line of claim 7 or 8; and / or an ovarian cancer chemotherapy drug and a pharmaceutically acceptable carrier or excipient.

Images