A soybean grain weight major qtl qsw20-1 and an indel molecular marker and application thereof

By constructing a recombinant inbred line population of Qihuang 34 × Dongsheng 16 and developing the Indel67 molecular marker, the major-effect QTL qSW20-1 for soybean grain weight was precisely mapped, solving the problem of fine mapping of soybean 100-grain weight and achieving high-efficiency breeding and high-yield breeding results.

CN116179755BActive Publication Date: 2026-07-10INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2023-03-29
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

The lack of precise localization of soybean 100-seed weight in existing technologies makes it difficult to develop molecular markers closely linked to major QTLs, thus hindering the soybean variety breeding process.

Method used

By constructing a recombinant inbred line population of Qihuang 34 × Dongsheng 16, the major QTL qSW20-1 for soybean grain weight was precisely mapped, and the Indel67 molecular marker closely linked to it was developed. The 100-grain weight trait of soybean materials was detected by PCR amplification using primer pairs.

Benefits of technology

It enables efficient selection and identification of the 100-seed weight trait in soybeans, improves breeding efficiency, increases the yield per soybean plant without sacrificing seed quality, and provides a breeding method to overcome the problem of 'high yield but low quality, and high quality but low yield'.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179755B_ABST
    Figure CN116179755B_ABST
Patent Text Reader

Abstract

The application provides a soybean grain weight major QTL qSW20-1, a developed Indel molecular marker and application thereof, and belongs to the technical field of soybean molecular breeding. The QTL qSW20-1 provided by the application is located on the 20th chromosome of a soybean Glyma.Wm82.a4.v1 genome version, and the interval is reduced to between two SSR markers BARCSOYSSR_20_0830 and BARCSOYSSR_20_0842 by using a residual heterozygote. The same allele of the QTL qSW20-1 and large grain has a significant positive influence on the number of grains per plant and the grain weight per plant, but has no adverse influence on the protein content and the fat content of quality traits. Meanwhile, a molecular marker Indel67 related to the hundred-grain weight is developed, and can be used for molecular marker assisted selection breeding and improving the individual selection efficiency in a breeding population, and accelerating the breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of soybean molecular breeding technology, specifically involving a soybean grain weight major effect QTLqSW20-1 and its developed Indel molecular markers and applications. Background Technology

[0002] It is projected that by 2050, grain production will need to increase by at least 70% to meet the demands of population growth; therefore, increasing yield is a top priority in breeding efforts. Soybean (Glycine max (L.) Merr.), originating in China, is a crucial food and oilseed crop, developed through long-term directional selection, improvement, and domestication of its wild ancestor, Glycine soja. It provides resources such as edible oil and plant protein for humans and animals. Therefore, increasing soybean yield is one of the important ways to ensure food security. Soybean yield is composed of three factors: the number of pods per plant, the number of seeds per pod, and the 100-seed weight. The 100-seed weight, as one of the important yield-contributing traits, has higher heritability and contributes the most to yield in breeding. Identifying its genetic loci is helpful in improving soybean yield and cultivating high-yielding varieties.

[0003] However, 100-seed weight is a complex quantitative trait with high heritability, controlled by multiple genes. Traditional breeding methods are lengthy, difficult, and require significant human and material resources. Marker-assisted selection (MAS) breeding offers a new approach to accelerate the breeding process. MAS breeding involves indirect selection of target traits through molecular markers linked to functional genes. Locating quantitative trait loci using molecular markers is a crucial method in MAS breeding. However, there are currently no reports on the fine mapping of QTLs for soybean 100-seed weight, which undoubtedly hinders the development of molecular markers closely linked to major QTLs and impedes their application in soybean variety breeding. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a major QTL for soybean grain weight, qSW20-1, by constructing a population of Qihuang 34 × Dongsheng 16 recombinant inbred lines and finely locating the major QTL for grain weight in its derived secondary population.

[0005] This invention provides a soybean grain weight major effect QTL qSW20-1, which is located between the BARCSOYSSR_20_0830 and BARCSOYSSR_20_0842SSR molecular markers on soybean chromosome 20, based on the soybean reference genome version Glyma.Wm82.a4.v1.

[0006] Preferably, the nucleotide sequence of BARCSOYSSR_20_0830 is as shown in SEQ ID NO:1;

[0007] The nucleotide sequence of the BARCSOYSSR_20_0842SSR is shown in SEQ ID NO:2.

[0008] This invention provides the application of the soybean grain weight major effect QTL qSW20-1 in soybean breeding.

[0009] Preferably, the soybean breeding method used in the application includes the following steps:

[0010] Detect at least one marker linked to QTL qSW20-1 in soybean varieties or germplasm, and select haplotypes of alleles associated with the dominant 100-seed weight trait for breeding.

[0011] Preferably, the soybean varieties or germplasm include Qihuang 34, Dongsheng 16, Dongnong 4, Dongnong 44, PI602896, PI548535, PI548607, PI548499, PI548504, Hehang 2010239, Nongda 85213, Henong 66, Hehang 10-239, Dongnong 36, Heihe 29, Dengke 7, Jiufeng 7, Longken 316, Mengdou 11, and Dongsheng. No. 1, Ken 09-1609, Sheng 168, Dongnong 4211, Manguidou, Suinong 30, Kendou 31, Kenjiandou 4, 09-1126, Mengdou No. 7, Mengdou 19, PI548325, Neidou 3, Kenjiandou 33, Suifu 09-5016, Heihe 54, Heihe 45, Jiufeng 3, Hefeng 42, Nenliang No. 7, Kendou 40, Fengshou 12, Kendou 30, Heihe 49, Heinong 62 and Jiyuan Yin 3.

[0012] This invention provides the application of the soybean grain weight major-effect QTL qSW20-1 in the development of molecular markers related to the soybean 100-grain weight trait.

[0013] This invention provides an Indel67 molecular marker developed based on the soybean grain weight major effect QTL qSW20-1, which has a deletion of GAA at positions 35897140-35897143 on chromosome 20 of the soybean reference genome Glyma.Wm82.a4.v1.

[0014] Preferably, it is obtained by amplification using primer pairs;

[0015] The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:4.

[0016] This invention provides the application of the Indel67 molecular marker in the selection of superior progeny by 100-seed weight in soybeans and / or the identification of varietal resources.

[0017] Preferably, the method for selecting superior progeny by 100-seed weight and / or identifying varietal resources in soybeans includes the following steps:

[0018] Genomic DNA was extracted from soybean materials to be identified;

[0019] Genomic DNA extracted from soybean materials for identification was amplified by PCR using primer pairs to obtain PCR products;

[0020] The length of the PCR product was analyzed. If a PCR product of 209 bp was obtained, the soybean material to be identified had an advantageous 100-seed weight trait; if a PCR product of 206 bp was obtained, the soybean material to be identified had an inferior 100-seed weight trait.

[0021] This invention provides a major QTL for soybean grain weight, qSW20-1, which is located between the SSR markers BARCSOYSSR_20_0830 and BARCSOYSSR_20_0842, based on the soybean reference genome version Glyma.Wm82.a4.v1. This invention constructs a recombinant inbred line population of Qihuang 34 × Dongsheng 16, performs initial mapping of the 100-grain weight QTL, detects the major QTL controlling 100-grain weight, validates and finely maps the major QTL in derived secondary populations, and develops a molecular marker closely linked to the major QTL, providing a foundation for effective soybean variety breeding. The results of this invention's embodiments show that the LOD value of the obtained QTL qSW20-1 is higher than 10, explaining up to 18.10% of phenotypic variation. Therefore, both from the perspective of QTL mapping and the contribution rate of the QTL to the phenotype, this interval is an ideal marker interval for improving soybean yield.

[0022] Furthermore, soybean yield and quality often exhibit a negative correlation, meaning high yield does not necessarily equate to high quality, and vice versa. However, the allele in this region, identical to that of large-grained soybeans, has a significant positive impact on the number of grains per plant and grain weight per plant, but no adverse effect on the quality traits of protein and fat content. This indicates that this region can increase soybean yield per plant without sacrificing seed quality. Therefore, the major-effect QTLqSW20-1 of this invention will play an important role in improving soybean yield and quality.

[0023] This invention provides the application of the Indel67 molecular marker in the selection of superior progeny by 100-seed weight in soybean and / or the identification of varietal resources. This invention develops a tightly linked molecular marker, Indel67, based on the QTL qSW20-1 interval. Experimental results show that Indel67 can be used for marker-assisted selection breeding and the discovery of related functional genes, providing an effective means to overcome the problem of "high yield but not high quality, and high quality but not high yield". Attached Figure Description

[0024] Figure 1 Electrophoresis results of genomic DNA extracted from soybean materials;

[0025] Figure 2 A high-density genetic map of the RIL population;

[0026] Figure 3 The location results of the recombinant inbred line Qihuang 34 × Dongsheng 16 on chromosome 20;

[0027] Figure 4 The effect of qSW20-1 on other traits of the Qihuang 34 × Dongsheng 16 population;

[0028] Figure 5 Gel prints of parents and some offspring of Indel67 were obtained. Note: A represents the small-grained genotype of Dongsheng 16, B represents the large-grained genotype of Qihuang 34, and H represents the heterozygous genotype.

[0029] Figure 6 The results of the Indel67 assay were used to detect significant differences in genotype and phenotype among individuals in the F2:5 population of the Qihuang 34 × Dongsheng 16 population.

[0030] Figure 7 The Indel67 assay was used to detect the variant sites of Qihuang 34 and Dongsheng 16. Detailed Implementation

[0031] This invention provides a soybean grain weight major effect QTL qSW20-1, which is located between the BARCSOYSSR_20_0830 and BARCSOYSSR_20_0842SSR molecular markers on soybean chromosome 20, based on the soybean reference genome version Glyma.Wm82.a4.v1.

[0032] In this invention, the nucleotide sequence of BARCSOYSSR_20_0830 is as shown in SEQ ID NO:1 (CTTTCTATCGATT TGTCATTTTCATTAGTATTTTTTTTAATAAAATAAATAAATTGTTGACATAATTATTGTATGTTTAC ACTAAAAATAAACTAATTATATTATTAATATGATATATCAATAatatatatatatatatatatatatatatatatatatatat atatatatCAAATTCTTATACTAAGACATAATTATATCAATATAATGCACGATTAGCATGACTGA); the nucleotide sequence of BARCSOYSSR_20_0842SSR is as shown in SEQ ID NO:2 (TTGCAAAACTATGCGCATTT ATACAATACGGAATTGCACTGAACTGTTACAAATGACCAGAAAATCCTAGACAAAAAATATCAA The QTL qSW20-1 interval includes 14 genes, as shown in Table 1. Preferably, the QTL qSW20-1 also includes chromosomal intervals flanking BARCSOYSSR_20_0830 and BARCSOYSSR_20_0842SSR.

[0033] BARCSOYSSR_20_0830 was amplified using primer pairs (SEQ ID NO: 40 and 41), and BARCSOYSSR_20_0842SSR was amplified using primer pairs (SEQ ID NO: 64 and 65). Experimental results showed that the QTL qSW20-1, with the same allele as the large-grain type, had a significant positive effect on the number of grains per plant and the weight of grains per plant, but had no adverse effect on the quality traits of protein and fat content.

[0034] Table 1. Region gene numbers and locations of QTL qSW20-1

[0035]

[0036]

[0037] This invention provides the application of the soybean grain weight major effect QTL qSW20-1 in soybean breeding.

[0038] In this invention, the soybean breeding method used in the application preferably includes the following steps:

[0039] Detect at least one marker linked to QTL qSW20-1 in soybean varieties or germplasm, and select haplotypes of alleles associated with the dominant 100-seed weight trait for breeding.

[0040] In this invention, the soybean variety or germplasm preferably includes at least one of the following materials: Qihuang 34, Dongsheng 16, Dongnong 4, Dongnong 44, PI602896, PI548535, PI548607, PI548499, PI548504, Hehang 2010239, Nongda 85213, Henong 66, Hehang 10-239, Dongnong 36, Heihe 29, Dengke 7, Jiufeng 7, Longken 316, Meng Bean 11, Dongsheng No. 1, Ken 09-1609, Sheng 168, Dongnong 4211, Mangui Bean, Suinong 30, Ken Bean 31, Kenjian Bean 4, 09-1126, Meng Bean 7, Meng Bean 19, PI548325, Nei Bean 3, Kenjian Bean 33, Suifu 09-5016, Heihe 54, Heihe 45, Jiufeng 3, Hefeng 42, Nenliang No. 7, Ken Bean 40, Fengshou 12, Ken Bean 30, Heihe 49, Heinong 62 and Jiyuan Yin 3.

[0041] This invention provides the application of the soybean grain weight major-effect QTL qSW20-1 in the development of molecular markers related to the soybean 100-grain weight trait.

[0042] In this invention, the molecular markers include SSR molecular markers or Indel molecular markers. The SSR molecular markers preferably include SSR_20_0830, SSR_20_0842, SSR_20_836, and SSR_20_839.

[0043] This invention provides an Indel molecular marker developed based on the soybean grain weight major effect QTL qSW20-1, which has GAA deleted at positions 35897140-35897143 on chromosome 20 of the soybean reference genome Glyma.Wm82.a4.v1.

[0044] In this invention, the Indel molecular marker is preferably obtained by primer amplification; the primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 (ATAGCCACACCGACGATGAC) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:4 (AACGACGCTTTTGGTGTTGG).

[0045] This invention provides the application of the Indel67 molecular marker in the selection of superior progeny by 100-seed weight in soybeans and / or the identification of varietal resources.

[0046] In this invention, the method for selecting dominant progeny of soybeans by 100-seed weight and / or identifying varietal resources preferably includes the following steps:

[0047] Genomic DNA was extracted from soybean materials to be identified;

[0048] Genomic DNA extracted from soybean materials for identification was amplified by PCR using primer pairs to obtain PCR products;

[0049] The length of the PCR product was analyzed. If a PCR product of 209 bp was obtained, the soybean material to be identified had an advantageous 100-seed weight trait; if a PCR product of 206 bp was obtained, the soybean material to be identified had an inferior 100-seed weight trait.

[0050] This invention does not impose any particular restrictions on the method for extracting genomic DNA from soybean materials to be identified; any plant genomic DNA extraction method well known in the art can be used, such as the kit method.

[0051] After extraction, the present invention uses primer pairs to perform PCR amplification on the extracted soybean genomic DNA for identification, and obtains PCR products.

[0052] In this invention, the preferred PCR amplification reaction program is 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, for 34 cycles; and a final extension at 72°C for 5 min. The PCR reaction system is 20 μL, comprising 10.0 μL of 2×EasyTaq PCR SuperMix for PAGE, 0.5 μL each of primers (10 μmol / L), 2.0 μL of DNA (50 ng / μL), and 7.0 μL of sterile water.

[0053] After obtaining the PCR product, the present invention analyzes the length of the PCR product. When a PCR product of 209 bp is obtained, the soybean material to be identified has an advantageous 100-seed weight trait; when a PCR product of 206 bp is obtained, the soybean material to be identified has an inferior 100-seed weight trait.

[0054] In this invention, the analytical method preferably employs polyacrylamide gel electrophoresis, capillary electrophoresis, or sequencing. When performing polyacrylamide gel electrophoresis, it is preferable to set up two control groups, including the electrophoretic band of Qihuang 34 as the dominant trait of 100-grain weight, and the electrophoretic band of Dongsheng 16 as the inferior trait of 100-grain weight.

[0055] The following detailed description, in conjunction with embodiments, illustrates a soybean grain weight major-effect QTLqSW20-1, its developed Indel molecular markers, and their applications, but these should not be construed as limiting the scope of protection of this invention.

[0056] Example 1

[0057] Construction and phenotypic identification of a recombinant inbred line

[0058] The hybrid F1 was obtained by crossing the Chinese Huanghuai variety Qihuang 34 (♀) and the Chinese Northeast variety Dongsheng 16 (♂). The offspring were obtained by self-pollination of the hybrid F1, and 325 F2:5 generation recombinant inbred lines were obtained by single seed transfer (SSD).

[0059] The parent lines and their derived RIL populations were grown at two sites from 2021 to 2022: the Changping Experimental Base in Beijing and the Hainan Experimental Station of the Institute of Crop Science in Yazhou District, Sanya. Each family of the parent lines and RIL populations was planted in one row with a plant spacing of 10 cm and a row spacing of 35 cm. After maturity, five plants were harvested from each family. After threshing and air-drying, five traits were measured: number of seeds per plant, seed weight per plant, 100-seed weight, protein content, and fat content. The soybean protein and fat content phenotypic analysis was performed using a Bruker Fourier transform near-infrared spectrometer (FTIR). Fully mature soybeans with smooth, intact, and plump seeds were selected for the protein and fat content phenotypic analysis. A previously developed soybean protein and fat content detection model was used, and spectral data analysis was performed using OPUS software. Each sample was tested three times, and the average value was taken as the protein and fat content. The results are shown in Table 2.

[0060] Table 2. Detection results of parental and recombinant inbred line populations.

[0061]

[0062] Example 2

[0063] DNA extraction

[0064] Fresh leaves were collected from both parents and all 325 RILs into centrifuge tubes, frozen in liquid nitrogen, homogenized in a tissue homogenizer, and then stored at -80°C. Total genomic DNA was extracted from each leaf sample using a modified CTAB method. The quality and concentration of the extracted DNA were determined by 1% agarose gel electrophoresis and spectrophotometer (UV-Vis Spectrophotometer Q5000) (see [link to article]). Figure 1 ).

[0065] Example 3

[0066] Genetic map construction methods

[0067] SLAF libraries of 325 RILs and their parents were constructed and sequenced. A combination of RsaI and HaeIII restriction endonucleases was selected to digest genomic DNA; the digestion method was performed according to the manufacturer's instructions. The 325 RILs were SLAF-tagged and genotyped using the method described in (Sun X, Liu D, Zhang X, Li W, Liu H, Hong W, Jiang C, Guan N, Ma C, Zeng H, Xu C, Song J, Huang L, Wang C, Shi J, Wang R, Zheng X, Lu C, Wang X, Zheng H. SLAF-seq: An efficient method of large-scale De Novo SNP discovery and genotyping using high-throughput sequencing. PLoS One, 2013, 8:e58700.). Genetic maps were constructed using high-density molecular tags developed for the RIL population using HighMap software. A high-density genetic map containing 6,297 SLAF markers was constructed, with a total map distance of 2,945.26 cM and an average genetic distance of 0.47 cM (see [link to HighMap software]). Figure 2 ).

[0068] Example 4

[0069] qSW20-1 Initial Positioning

[0070] QTL mapping for soybean 100-seed weight was performed using QTL Icimapping V4.1 software combined with phenotypic and molecular data from the Qihuang 34 × Dongsheng 16 population (as shown in Table 3). The LOD threshold was set to 3.0. Major-effect QTLs for soybean 100-seed weight were detected in three environments (Changping, 2021–2022; Sanya, 2022), all located near chromosome 20 (35579408bp–36014827bp). The LOD values ​​ranged from 10.85 to 18.06, explaining 9.73%–18.10% of the phenotypic variation.

[0071] Table 3 QTL range of 100 soybean grain weight

[0072]

[0073] Note, a: indicates that the allelic variation that increases grain weight originates from Qihuang 34. 2021_CP: Changping, 2021; 2022_SY: Sanya, 2022; 2022_CP: Changping, 2022; BLUP: integrated environment.

[0074] Example 5

[0075] Fine positioning of qSW20-1

[0076] To precisely locate qSW20-1, SSR markers were first selected within and near the localization interval. A total of 34 SSR markers between 20_0812 and SSR_20_0846 were selected (see Table 4). Using non-denaturing polyacrylamide gel electrophoresis, 20 polymorphic SSR markers between the parents were screened, and 8 of them with clear bands were selected for population analysis.

[0077] Table 4 shows 34 pairs of SSR markers and their corresponding forward and reverse amplification primers within the interval.

[0078]

[0079]

[0080] The population was identified using SSR markers near the endpoints of the interval, namely SSR_20_0821 and SSR_20_0845. RIL314 exhibited QTL interval heterozygosity. The segregating population was screened using the remaining six SSR markers (SSR_20_0824, SSR_20_0828, SSR_20_0830, SSR_20_0836, SSR_20_0839, and SSR_20_0842), yielding three exchanger individuals, named H1-H3. Based on their phenotypic analysis, the QTL interval was located between SSR_20_0830 and SSR_20_0842, containing 14 genes (see [link to QTL analysis]). Figure 3 ).

[0081] Example 7

[0082] Effects of qSW20-1 on yield and quality traits

[0083] The effects of qSW20-1 on single-plant grain weight, single-plant grain number, protein content, and fat content were analyzed in three environments (Changping, 2021–2022, and Sanya, 2022).

[0084] qSW20-1 had a highly significant effect on yield traits such as number of grains per plant and grain weight per plant. The number of grains per plant and grain weight per plant of the line with the large-grain allele of Qihuang 34 were significantly higher than those of the line with the small-grain allele of Dongsheng 16 in all environments. However, it had no significant effect on quality traits such as protein content and fat content (see...). Figure 4 ).

[0085] Example 8

[0086] Indel marker development within QTL intervals

[0087] In this embodiment, an Indel molecular marker was developed for the Indel67 site, targeting the differential sites between the two parents within the QTL interval. The Indel marker is located at 35897143 bp on chromosome 20 of the soybean reference genome (Glyma.Wm82.a4.v1).

[0088] The soybean reference genome sequences, located 500 bp upstream and downstream of the indel, were obtained from the phytozome website. Primers were designed using Primer5 software, and the primer sequences designed for this indel are as follows:

[0089] Indel67F: 5'-ATAGCCACACCGACGATGAC-3' (SEQ ID NO: 3);

[0090] Indel67R: 5'-AACGACGCTTTTGGTGTTGG-3' (SEQ ID NO: 4).

[0091] Using the developed Indel markers, the genotypes of the two parents and 325 RILs in the Qihuang 34 × Dongsheng 16 population were detected. The detection method was as follows:

[0092] (1) Extract genomic DNA from the soybeans to be tested;

[0093] (2) Use the above primers to perform PCR amplification on soybean genomic DNA to obtain PCR amplification products;

[0094] (3) Sequencing the PCR amplification product to detect the genotype at the Indel67 site.

[0095] (4) The PCR amplification program is as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles, and finally 72℃ extension for 5 min, and stored at 4℃.

[0096] (5) The PCR reaction system is 20 μL, including 10.0 μL of 2×EasyTaqPCR SuperMix for PAGE, 0.5 μL of each primer (10 μmol / L), 2.0 μL of DNA (50 ng / μL), and 7.0 μL of sterile water.

[0097] (6) The PCR amplification products were subjected to 6% denaturing polyacrylamide gel electrophoresis and silver staining.

[0098] result Figure 5 The results showed that the bands between the parents were clear and the differences were obvious, indicating that the developed Indel marker can be used for genotyping of 325 RILs offspring.

[0099] Example 9

[0100] Application of Indel markers in offspring selection within a population

[0101] The segregating progeny populations of Qihuang 34 × Dongsheng 16 were identified using the Indel67 marker, and the analysis method was the same as in Example 8. Combined with phenotypic analysis of 100-grain weight in three environments (Changping, 2021–2022; Sanya, 2022), it was found that the 100-grain weight of the lines with the large-grain allele consistent with Qihuang 34 was significantly increased compared to the 100-grain weight of the lines with the small-grain allele consistent with Dongsheng 16 (see Example 8). Figure 6 Therefore, the developed molecular marker Indel67 is closely linked to and highly significantly correlated with soybean 100-seed weight, and can be used for marker-assisted selection breeding and progeny selection, significantly improving the selection efficiency of high 100-seed weight materials, and providing a new, most economical and effective molecular breeding approach for further improving soybean yield and quality.

[0102] Example 10

[0103] Application of major QTLs of soybean grain weight in soybean variety identification

[0104] Molecular markers were used to detect different varieties of soybean resources and identify the soybean genotypes of 43 cultivated soybean accessions. The primer sequences were those used in the development of the molecular markers (SEQ ID NO:3 / SEQ ID NO:4). The amplification procedure and amplification system were the same as in Example 8.

[0105] Upon identification, 26 of the 36 cultivated soybean samples were identical to the Dongsheng 16 genotype, with the amplification product shown in SEQ ID NO:73 (ATAGCCACACCGACGATGACGACGAAATCTACTCCACATCGGAGTTTGAAGATGACGATG ACgaagaagaagaagaagaggaagaagaagaagaagaagaaagaagGGATGAGTATTTCAGAGTCAGAGGTTCTACC AACGACGAACGATGTCGAAGCATTGGCGATTTCTTATCTCTTTCAGAAATCGCCAACACCAAA AGCGTCGTT, where lowercase bases represent repetitive sequences and bolded lowercase bases represent deleted sequences); 17 samples were identical to the Qihuang 34 genotype, with the amplification product shown in SEQ ID NO:74.

[0106] (ATAGCCACACCGACGATGACGACGAAATCTACTCCACATCGGAGTTTGAAGATGACGATG ACgaagaagaagaagaagacgaagaagaagaagaagaaagaagGGATGAGTATTTCAGAGTCAGAGGTTCTACCAA CGACGAACGATGTCGAAGCATTGGCGATTTCTTATCTCTTTCAGAAATCGCCAACACCAAAAG CGTCGTT, where lowercase bases are repeating sequences). The 100-grain weight phenotypes of the two groups were compared using a T-test, with P = 8.08E-06 indicating a highly significant difference (see Table 4 and...). Figure 7 ).

[0107] Table 4. Soybean Variety Genotyping Results

[0108]

[0109]

[0110] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An Indel67 molecular marker associated with the 100-seed weight trait of soybean, characterized in that, The nucleotide sequence of the Indel67 molecular marker is shown in SEQ ID NO:73 or SEQ ID NO:

74.

2. An application of a primer pair for amplifying the Indel67 molecular marker of claim 1 in the selection of dominant progeny and / or identification of soybean 100-seed weight, wherein the primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

4.

3. The application according to claim 2, characterized in that, The method for selecting dominant progeny of soybeans by 100-seed weight and / or identifying varietal resources includes the following steps: Genomic DNA was extracted from soybean materials to be identified; Genomic DNA extracted from soybean materials for identification was amplified by PCR using primer pairs to obtain PCR products; The length of the PCR product was analyzed. If a PCR product of 209 bp was obtained, the soybean material to be identified had an advantageous 100-seed weight trait; if a PCR product of 206 bp was obtained, the soybean material to be identified had an inferior 100-seed weight trait.

4. The application according to claim 2 or 3, characterized in that, The soybean varieties or germplasm mentioned include Qihuang 34, Dongsheng 16, Dongnong 4, Dongnong 44, PI602896, PI548535, PI548607, PI548499, PI548504, Hehang 2010239, Nongda 85213, Henong 66, Hehang 10-239, Dongnong 36, Heihe 29, Dengke 7, Jiufeng 7, Longken 316, Mengdou 11, and Dongsheng 1. The following are listed: Ken 09-1609, Sheng 168, Dongnong 4211, Manguidou, Suinong 30, Kendou 31, Kenjiandou 4, 09-1126, Mengdou 7, Mengdou 19, PI548325, Neidou 3, Kenjiandou 33, Suifu 09-5016, Heihe 54, Heihe 45, Jiufeng 3, Hefeng 42, Nenliang 7, Kendou 40, Fengshou 12, Kendou 30, Heihe 49, Heinong 62 and Jiyuan Yin 3.