A tobacco stomatal aperture regulating factor and its application

By overexpressing the NtMYB184 transcription factor in tobacco and regulating its pore opening, the lack of methods for regulating the pore opening in the prior art is solved, and the increase of pore opening and the regulation of ROS levels of guarding cells is achieved, and the regulation efficiency of pore movement is improved.

CN116217687BActive Publication Date: 2025-08-26YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310056352.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-16
Publication Date
2025-08-26
Estimated Expiration
2043-01-16

AI Technical Summary

Technical Problem

There is no study in the prior art to regulate the stomatal opening of tobacco through transcription factors, especially MYB transcription factors regulate flavonol synthesis in tobacco to affect the ROS level of guard cells and then regulate stomatal movement. Relevant products and methods are urgently needed.

Method used

Tobacco MYB184 transcription factor NtMYB184 and its expression vector, transformants and kits were used to amplify, ligate the transformation vector and overexpress NtMYB184 in plants to regulate the tobacco stomatal opening.

Benefits of technology

Positive regulation of tobacco stomatal opening was achieved, and the stomatal opening of overexpressed plants increased by about 17%. The regulatory factor NtMYB184 significantly affected the flavonol level and ROS level of guard cells, and regulated stomatal movement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116217687B_ABST
    Figure CN116217687B_ABST
Patent Text Reader

Abstract

The present invention relates to a tobacco stomatal aperture regulating factor and its application, belonging to the field of genetic engineering technology. The amino acid sequence of the stomatal aperture regulating factor NtMYB184 comprises: an R2 repeat sequence, an R3 repeat sequence, and an SG7 domain [K / R][R / x][R / K]xGRT[S / x][R / G]xx[M / x]K. The amino acid sequence of the stomatal aperture regulating factor NtMYB184 is shown in SEQ ID NO: 1. The stomatal aperture of wild-type tobacco is 0.3992, while the stomatal aperture of transgenic plants (OE) overexpressing the stomatal aperture regulating factor NtMYB184 gene is 0.4673. Compared with the wild-type, the stomatal aperture of the transgenic plants is increased by approximately 17%, indicating that overexpressing the stomatal aperture regulating factor NtMYB184 gene can increase stomatal aperture. Therefore, the tobacco stomatal aperture regulating factor NtMYB184 has great application prospects in regulating tobacco stomatal aperture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a stomatal aperture regulating factor NtMYB184 and an expression vector, a transformant, a kit and a method thereof. Background Art

[0002] Stomata are pores formed by a pair of guard cells in the plant epidermis. They are channels for plants to release water through transpiration and absorb CO2 through photosynthesis. They are also physical barriers that limit pathogen invasion in plant immunity. The level of reactive oxygen species (ROS) in guard cells is a key regulatory target for stomatal movement. Various exogenous stimuli and plant hormones regulate stomatal movement by regulating ROS levels. ROS, as a key secondary signaling molecule, increases intracellular Ca 2+ level, activating the guard cell plasma membrane anion channels to release anions and close the stomata.

[0003] Research has shown that flavonols possess antioxidant properties, regulating ROS levels in guard cells and thus affecting stomatal movement. Plant flavonol synthesis is regulated by MYB transcription factors, which have been cloned in Arabidopsis, grapes, citrus, Epimedium, and crabapple. However, no relevant research has been published in the model plant tobacco, nor has there been any report that MYB regulates ROS levels in guard cells and, consequently, stomatal aperture by regulating flavonol synthesis. There is an urgent need in this field to develop products and methods for regulating stomatal aperture in tobacco using transcription factors. Summary of the Invention

[0004] The present invention is intended to solve the above-mentioned problems and defects, and provides a stomatal aperture regulating factor NtMYB184 and its expression vector, transformant, kit and method.

[0005] The present invention is implemented by adopting the following technical solutions.

[0006] A stomatal aperture regulating factor NtMYB184, whose amino acid sequence contains: R2 repeat sequence, R3 repeat sequence, SG7 domain [K / R][R / x][R / K]xGRT[S / x][R / G]xx[M / x]K.

[0007] The amino acid sequence of the stomatal aperture regulating factor NtMYB184 includes, from the amino terminus to the carboxyl terminus, an R2 repeat sequence, an R3 repeat sequence, and an SG7 domain [K / R][R / x][R / K]xGRT[S / x][R / G]xx[M / x]K;

[0008] Preferably, the amino acids 12-62 of the amino acid sequence of the stomatal aperture regulating factor NtMYB184 are R2 repeating sequences;

[0009] Preferably, the amino acids 64-115 of the amino acid sequence of the stomatal aperture regulating factor NtMYB184 are R3 repeating sequences;

[0010] Preferably, the amino acids 144-156 of the amino acid sequence of the stomatal aperture regulating factor NtMYB184 are SG7 domains [K / R][R / x][R / K]xGRT[S / x][R / G]xx[M / x]K;

[0011] The amino acid sequence of the stomatal aperture regulating factor NtMYB184 is shown in SEQ ID NO: 1.

[0012] The gene sequence of the stomatal aperture regulating factor NtMYB184 is shown in SEQ ID NO: 2;

[0013] Preferably, the stomatal aperture regulating factor NtMYB184 is the tobacco (Nicotiana tabacum L.) stomatal aperture regulating factor NtMYB184.

[0014] An expression vector capable of regulating stomatal aperture is connected with the gene sequence of the stomatal aperture regulating factor NtMYB184.

[0015] Preferably, the expression vector capable of regulating stomatal aperture refers to an expression vector to which the gene sequence of the stomatal aperture regulating factor NtMYB184 is connected;

[0016] Preferably, the expression vector is selected from: pK2GW7 vector;

[0017] Preferably, the regulation is positive regulation;

[0018] Preferably, the stomatal aperture of the wild-type tobacco is 0.3992, and the stomatal aperture of the overexpression plant (OE) is 0.4673. The stomatal aperture of the OE plant is increased by about 17% compared with the wild-type.

[0019] A transformant capable of regulating stomatal aperture is transformed with the expression vector capable of regulating stomatal aperture.

[0020] Preferably, the transformant capable of regulating stomatal aperture refers to a host cell transformed with the expression vector capable of regulating stomatal aperture;

[0021] Preferably, the host cell is selected from: a plant cell or a microbial cell;

[0022] Preferably, the plant is tobacco;

[0023] Preferably, the microorganism is selected from: Escherichia coli and Agrobacterium.

[0024] A kit capable of regulating stomatal aperture comprises: the stomatal aperture regulating factor NtMYB184, and / or an expression vector capable of regulating stomatal aperture, and / or a transformant capable of regulating stomatal aperture.

[0025] The kit capable of regulating stomatal aperture further comprises: primers for amplifying the gene sequence of the stomatal aperture regulating factor NtMYB184, common PCR reagents, common ligation and transformation reagents, and common transgenic reagents;

[0026] Preferably, the amplification primers for the gene sequence of the stomatal aperture regulating factor NtMYB184 include:

[0027] Forward primer NtMYB184-XmnI:5'- GAACCAATTC ATGGGAAGAGCACCTTGTTG-3',

[0028] Reverse primer NtMYB184-XhoI: 5'- CTCGAG CTAAGACAAAAGCCAAGCGAC-3';

[0029] Preferably, the commonly used PCR reagents include: DNA polymerase, dNTP, PCR buffer, and double-distilled water;

[0030] The DNA polymerase is preferably High-Fidelity DNA Polymerase, the PCR buffer is preferably 5×Phusion HF reaction buffer;

[0031] Preferably, the commonly used reagents for ligation and transformation include: restriction endonucleases, ligation buffer, expression vectors, proteases, competent cells, and culture medium;

[0032] Preferably, the restriction endonuclease is preferably XmnI, Xho I; the restriction endonuclease is preferably Clonease TM II enzyme Mix; the ligation buffer is preferably TE Buffer; the protease is preferably Proteinase K;

[0033] Preferably, the expression vector is selected from: pK2GW7 vector;

[0034] Preferably, the competent cells are selected from: Escherichia coli competent cells, Agrobacterium competent cells;

[0035] Preferably, the culture medium is selected from LB medium.

[0036] A method for regulating stomatal aperture, comprising overexpressing the stomatal aperture regulating factor NtMYB184 in a plant, and / or transforming an expression vector capable of regulating stomatal aperture in the plant, and / or infecting the plant with a transformant capable of regulating stomatal aperture.

[0037] The method for regulating stomatal aperture comprises: PCR amplifying the gene sequence of the stomatal aperture regulating factor NtMYB184 to obtain a PCR amplification product;

[0038] Preferably, the PCR amplification system includes: 4 ng / μL plant cDNA, 0.2 μL / μL 5× Phusion HF reaction buffer, 0.2 mM dNTP, 0.04 U / μL High-Fidelity DNA Polymerase, 0.2 μM forward and reverse primers, and the rest was water;

[0039] Preferably, the forward and reverse primers include:

[0040] Forward primer NtMYB184-XmnI:5'- GAACCAATTC ATGGGAAGAGCACCTTGTTG-3',

[0041] Reverse primer NtMYB184-XhoI: 5'- CTCGAG CTAAGACAAAAGCCAAGCGAC-3'.

[0042] Preferably, the PCR amplification program includes: 98°C, 30 seconds; 98°C, 7 seconds; 62°C, 30 seconds; 72°C, 45 seconds as one cycle, for a total of 35 cycles; extension at 72°C for 7 minutes;

[0043] Preferably, the method further comprises: connecting the PCR amplification product with an expression vector to obtain the expression vector capable of regulating stomatal aperture;

[0044] Preferably, the connection refers to connecting the expression vector pENTR TM NtMYB184 was further ligated by LR reaction to obtain the expression vector pK2GW7-NtMYB184 that can regulate stomatal opening;

[0045] Preferably, the LR reaction system includes: 6.25ng / μL-18.75ng / μL of pENTR TM NtMYB184, 0.0625 μL / μL ligation vector, the rest is TE Buffer;

[0046] Preferably, the LR reaction steps include: mixing the ligation reaction system, ice bathing for 2 minutes, mixing; adding 0.2 μL / μL LR Clonease TM II. Enzyme Mix, mix thoroughly, centrifuge, and incubate in a 25°C water bath for 1 hour; then add 0.9 μL / μL Proteinase K, mix thoroughly, and incubate in a 37°C water bath for 10 minutes; flicking is preferred for mixing;

[0047] Preferably, the method further comprises: transforming the expression vector pK2GW7-NtMYB184 capable of regulating stomatal aperture into competent cells to obtain a transformant capable of regulating stomatal aperture;

[0048] Preferably, the method further comprises: infecting plant cells with the transformant capable of regulating stomatal aperture;

[0049] Preferably, the competent cells are Agrobacterium competent cells; the transformant capable of regulating stomatal aperture refers to an Agrobacterium clone containing the expression vector pK2GW7-NtMYB184 capable of regulating stomatal aperture;

[0050] Preferably, the plant is preferably tobacco;

[0051] Preferably, the regulation is positive regulation;

[0052] Preferably, the stomatal aperture of the wild-type tobacco is 0.3992, and the stomatal aperture of the overexpression plant (OE) is 0.4673. The stomatal aperture of the OE plant is increased by about 17% compared with the wild-type.

[0053] The beneficial effects of the present invention are as follows: 1) The present invention has found a regulatory factor that can be used to regulate tobacco stomatal aperture; 2) Comparing the stomatal aperture of wild-type tobacco and OE plants, the stomatal aperture of OE plants increased by approximately 17% compared to the wild-type.

[0054] The present invention will be further explained below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 Agarose gel electrophoresis images of the PCR amplification products of the NtMYB184 gene and the TOPO cloning vector in Experimental Example 1 of the present invention. A: NtMYB184 amplification product, M: DL2,000 DNA Marker; B: PCR electrophoresis detection of the pTOPO-NtMYB184 plasmid, M: DL2,000 DNA Marker, 1-4: PCR product; C: XmnI + XhoI double enzyme digestion detection of the pTOPO-NtMYB184 plasmid, M: 1Kb DNA Ladder, 1-4: digestion products.

[0056] Figure 2 Figure 2 shows the XmnI+XhoI double enzyme digestion assay for the overexpression vector pK2GW7-NtMYB184 in Experimental Example 2 of the present invention. A: Plasmid PCR assay for pK2GW7-NtMYB184, M: DL2,000, 1-5: pK2GW7-NtMYB184 plasmid PCR products; B: XmnI+XhoI double enzyme digestion assay for pK2GW7-NtMYB184, M: DL2,000, 1-5: pK2GW7-NtMYB184 plasmid digestion products.

[0057] Figure 3 DPBA staining and fluorescence intensity of guard cells in Experimental Example 4 of the present invention. OE: NtMYB184 transgenic plant; WT: wild-type plant.

[0058] Figure 4 H2DCFDA staining and fluorescence intensity of guard cells in Experimental Example 4 of the present invention. OE: NtMYB184 transgenic plant; WT: wild-type plant.

[0059] Figure 5 This is the detection of stomatal aperture of guard cells in Experimental Example 5 of the present invention. OE: NtMYB184 transgenic plant; WT: wild-type plant. DETAILED DESCRIPTION

[0060] Experimental Example 1: Cloning of amplified products

[0061] 1. Use the following primers to perform PCR reaction to obtain the target product;

[0062] Forward primer NtMYB184-XmnI:5'- GAACCAATTC ATGGGAAGAGCACCTTGTTG-3',

[0063] Reverse primer NtMYB184-XhoI: 5'- CTCGAG CTAAGACAAAAGCCAAGCGAC-3'.

[0064] To construct the overexpression vector, the primers mentioned above contained restriction enzyme sites (underlined): XmnI and XhoI;

[0065] 2. RNA was extracted from tobacco leaves using the Trizol kit (Invitrogen) according to the instructions provided by the kit.

[0066] 3. Using the first-strand cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers NtMYB184-XmnI / NtMYB184-XhoI. The Phusion high-fidelity amplification enzyme reaction system was selected. The total volume of the system was 50 μL, including: 200 ng cDNA, 10 μL 5× Phusion HF reaction buffer, 1 μL 10 mM dNTP, 2 U High-Fidelity DNA Polymerase, 10μM forward and reverse primers 1μL each, add water to 50μL. PCR reaction The reaction was performed on a pro thermal amplification instrument with the following program: 98°C, 30 seconds; 98°C, 7 seconds; 62°C, 30 seconds; 72°C, 45 seconds; 35 cycles; and extension at 72°C for 7 minutes. The PCR products were recovered and purified. The electrophoresis of the PCR amplification products is shown in Figure 2. Figure 1 shown.

[0067] Experimental Example 2: Construction of overexpression vector

[0068] 1. Connect the cloned NtMYB184 to the TOPO vector

[0069] a. Perform TOPO cloning on the recovered amplified product fragments and connect them to -BluntⅡ-TOPO (3.5kb) vector was transformed into Escherichia coli DH5α competent cells, and the plasmid was extracted for PCR detection. The plasmid with an amplified product of about 1.2kb was selected to extract DNA. The constructed vector was named pTOPO-NtMYB184;

[0070] b. Since the forward and reverse primers of the gene carry recognition sites of XmnI and XhoI respectively, these two enzymes were selected to perform double enzyme digestion on the plasmid DNA sample. The enzyme digestion results produced two fragments, which were about 3.5kb and 1.2kb in size, indicating that the target fragment had been inserted into the TOPO vector ( Figure 1 ).

[0071] 2. Construction of plant overexpression vector

[0072] a. Entry clone pENTR TM Construction of 2B-NtMYB184

[0073] (1) Xmn I / Xho I digestion of pTOPO-NtMYB184 and pENTR TM 2B, obtain the target gene fragment NtMYB184 and vector pENTR TM The 2B linearized fragment was recovered from the gel and then ligated and transformed into competent cells DH5α;

[0074] (2) After transformation into DH5α, the clones were selected and plasmid DNA was extracted. The enzyme digestion results showed that the vector fragment of 3.8 kb and the fragment of about 1.2 kb were the correct clones. The correct clones were named pENTR TM 2B-NtMYB184;

[0075] b. Obtain plant expression vector through LR reaction

[0076] (1) Entry clone pENTR TM 2B-NtMYB184 and expression vector pK2GW7 LR were reacted and transformed into E. coli DH5α competent cells to obtain the plant expression vector pK2GW7-NtMYB184. pK2GW7-NtMYB184 was identified by enzyme digestion with Xmn I / Xho I. Correct clones were able to produce two fragments, approximately 1.2 kb and 15 kb in size. Figure 2 ).

[0077] The above LR reaction system: construction of the successful entry vector pENTR TM NtMYB184 (50-150 ng) 1-7 μL, 0.5 μL Test Vector (i.e., pK2GW7 vector), TE Buffer to a total volume of 8 μL; mix well, incubate on ice for 2 minutes, and flick twice; add 2 μL LR CloneaseTMⅡ enzyme Mix, flick, mix well, centrifuge, and incubate in a 25°C water bath for 1 hour; then add 1 μL Proteinase K, flick, mix well, and incubate in a 37°C water bath for 10 minutes.

[0078] Experimental Example 3: Genetic Transformation of Tobacco

[0079] 1. Transformation of Agrobacterium with expression vector

[0080] Remove competent Agrobacterium cells from a -80°C freezer, place on ice to thaw, and then add 4 μL of the recombinant expression vector pK2GW7-NtMYB184. Quickly freeze the cells in liquid nitrogen for 1 minute, transfer to a 37°C water bath for 5 minutes, and then place on ice for 2 minutes. Add 1 mL of LB liquid medium to the mixture and incubate at 28°C and 220 rpm for 3-4 hours. Spread the culture onto LB solid medium containing 100 mg / L spectinomycin and 25 mg / L rifampicin, and incubate at 28°C for 2-3 days. Agrobacterium clones containing the target vector will be visible.

[0081] 2. Tobacco transformation

[0082] a. Pick an Agrobacterium clone containing the target vector and streak it onto an LB plate containing spectinomycin and rifampicin. Incubate at 28°C for 2-3 days. Scrape the streaked plaque and inoculate it into MS medium containing spectinomycin and rifampicin. Incubate at 28°C with shaking at 220 rpm. When the bacterial solution reaches an OD value of 0.5-0.8, centrifuge at 6,000 rpm for 5 minutes to enrich the cells. Discard the supernatant and resuspend the cells in 20 mL of liquid MS medium to obtain an Agrobacterium suspension containing the target vector.

[0083] b. Place tobacco leaves of Yunyan 87 flue-cured tobacco in a 500 mL wide-mouth bottle, add an appropriate amount of 75% ethanol, and rinse for 1 minute; discard the ethanol, add 0.1% HgCl2 solution, and shake on a shaker at room temperature for 15 to 30 minutes; discard the HgCl2 solution and rinse with sterile water 6 times;

[0084] c. Remove the tobacco leaves, remove the surface liquid with sterile absorbent paper, use scissors to cut the sterile leaves into small pieces of about 1 cm × 1 cm, place the cut tobacco leaves into a sterile MS liquid culture medium suspension containing the target vector, and let it stand for 15-20 minutes; remove the tobacco leaves, use sterile filter paper to remove excess bacterial liquid, and culture them in the dark at 25°C in MS culture medium containing 6-BA (0.02 mg / L) and NAA (2 mg / L) for two days; then, transfer the tobacco leaves to differentiation medium, with the incision contacting the culture medium, and culture them under greenhouse conditions; the differentiation culture medium is MS culture medium containing 6-BA (0.5 mg / L), NAA (0.1 mg / L), kanamycin (100 mg / L), and cephalosporin (500 mg / L), and subculture once every 2-3 weeks. Callus tissue gradually grows at the incision and eventually differentiates and sprouts;

[0085] d. Cut off the buds that grow to 3-5 cm, transfer them to MS medium for rooting induction, take out the rooted transgenic plants, wash the medium with tap water, and transplant them into sterilized nutrient soil;

[0086] e. Transgenic plants were transfected with NPTII gene-specific primers:

[0087] NPTII-F:5'-TCGGCTATGACTGGGCACAACAGA-3'(SEQ ID NO.3)

[0088] NPTII-R:5'-AAGAAGGCGATAGAAGGCGATGCG-3'(SEQ ID NO.4)

[0089] PCR was used to verify the amplification and identify the transgenic positive plants.

[0090] Experimental Example 4: Detection of flavonol and ROS content in guard cells

[0091] The prepared tobacco lower epidermal strips were placed in a small plastic culture dish (20-40 mm in diameter), and after 2 hours of illumination, they were moved into a centrifuge tube containing DPBA or H2DCFDA fluorescent probes and incubated in the dark for 15-20 minutes. After incubation, the lower epidermal strips were transferred to a new centrifuge tube containing epidermal buffer, and the residual fluorescent probes were washed upside down, and the washing was repeated 3-5 times. The washed epidermal strips were placed under a laser scanning confocal microscope (Nikon A1) to observe the fluorescence intensity of the guard cells. All images were scanned using Nikon NIS Elements software, and the detector gain and laser intensity were kept the same during shooting. 3-5 independent epidermal strips were randomly selected for each sample, and each independent epidermal strip contained at least 30 guard cells. The fluorescence intensity of the pictures was quantitatively analyzed using ImageJ software. The results showed that the DPBA fluorescence intensity in the transgenic plants (OE) was higher than that in the control WT, indicating that overexpression of the stomatal opening regulatory factor NtMYB184 gene can significantly increase the level of flavonols in guard cells ( Figure 3 The H2DCFDA fluorescence intensity in the transgenic plants (OE) was lower than that in the control WT, indicating that overexpression of the stomatal aperture regulator NtMYB184 gene to increase the flavonol level in guard cells can significantly reduce the ROS level ( Figure 4 ).

[0092] Experimental Example 5: Stomatal aperture of transgenic plants

[0093] One-month-old tobacco leaves with good growth were carefully torn off the epidermis with tweezers, and the remaining mesophyll cells were removed with a brush. The leaves were spread out and placed in a small plastic culture dish (20-40 mm in diameter) containing 3-10 mL of epidermal buffer. -2 ·s -1 Incubate under light for 2-4 hours. Then observe the stomatal opening under a microscope (Nikon, Optiphot-2). The size of the stomatal opening is expressed by the ratio of stomatal width to length W / L. For each group of experiments, 3-5 pieces of epidermal strips were randomly measured, and no less than 10 fields of view were randomly selected from each piece. The photos were taken and the stomata were measured using software. The average value was taken after repeating 3 times. The experimental data n=30-60. The stomatal opening of wild-type tobacco is 0.3992, and the stomatal opening of transgenic plants (OE) is 0.4673. The stomatal opening of transgenic plants is increased by about 17% compared with the wild type ( Figure 5 ), indicating that overexpression of the stomatal aperture regulatory factor NtMYB184 gene can increase stomatal aperture.

[0094] SEQ ID NO: 1

[0095] >NtMYB184 amino acids

[0096] Mgrapccekvglkrgrwtaeedeiltkyiqtngegswrslpknagllrcgkscrlrwinylrsdlrrgnitseeediiiklhatlgnrwsliaghlpgrtdneiknywnshlsrkveslripsdeklpqavvdlankgtlnpikcrvgktsrptvkknrtfkksssslpepkqpkesseplnstvpmpstpnmekealsstinamdsmqeevanvaaapnpwpgsreaqsslssdsgmewlddimpmvmddqnmdpnefiltcldngqgespekvsndaenncgttnrvnehnikdhdnkmvpsedtqlesspeseavsinilkdvqensnetrlliedgtvewdwqeiaedrrevwsweetgqenmsinhswplwdntdtellqnctneitvemdsvlhsenqnhsslvawlls

[0097] SEQ ID NO:2

[0098] >NtMYB184_cds

[0099] atgggaagagcaccttgttgtgagaaagtgggtctcaaaagaggcagatggactgcagaagaggatgaaattctcactaaatatattcaaactaacggcgaaggctcttggagatcattacccaaaaatgctgggttacttagatgtggaaagagttgccgactgagatggattaattacttgaggtctgatttgaggagaggtaacataacttctgaagaggaagacataatcatcaagttacatgcaactttgggtaacagatggtctctaatagcgggacattta

[0100] ccaggtagaacagacaatgagattaaaaactactggaactctcatctaagcagaaaagttgaaagcttaagaattccaagcgacgaaaagctgc

[0101] ctcaagctgtagttgatttggctaataaagggactttgaaccctatcaaatgtagagttggcaaaacaagccgacccacagtaaagaaaaacaga

[0102] acatttaaaaagtctagttcaagtttgccagagcctaagcaacctaaagaaagtagtgaacctttaaattcaacagttcctatgccctcaactccaaa

[0103] catggaaaaagaggccttatctagcaccattaatgccatggattccatgcaagaagaggtagcaaacgtagccgccgctccaaatccttggcca

[0104] gggtctagagaggcccagagcagccttagctcagatagtggtatggaatggcttgacgatattatgccaatggtcatggacgatcaaaatatgga

[0105] tccaaatgaattcattttgacttgtttagacaacgggcaaggagaaagtccagaaaaagtcagcaacgacgcagaaaataactgcgggaccacg

[0106] aacagagtcaatgaacataacatcaaagatcacgataataaaatggtaccaagtgaagatacacaactggagagtagtccagagagtgaggct

[0107] gtatcaataaatattctgaaagatgtacaagagaatagcaacgaaacaagattattaatagaggatggtacagttgaatgggattggcaagagata

[0108] gctgaagacagaagagaagtatggtcatgggaagaaacagggcaagagaacatgtcaattaatcacagctggccgctatgggataatactgac

[0109] accgagttatacttcaaaattgcacgaatgaaatcacggtggaaatggattccgtgctgcacagtgaaaaccaaaaccatagttcccttgtcgcttgg

[0110] cttttgtcttag

[0111] The above are only some specific embodiments of the present invention, and the specific contents or common knowledge in the scheme are not described in detail here. It should be pointed out that the above embodiments do not limit the present invention in any way. For those skilled in the art, any technical solution obtained by equivalent replacement or equivalent transformation falls within the scope of protection of the present invention. The scope of protection claimed in this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. An application of a stomatal aperture regulating factor NtMYB184, characterized in that: The application is to regulate the stomatal aperture of tobacco, and the amino acid sequence of the stomatal aperture regulating factor NtMYB184 is SEQ ID NO: 1.