EjFAD8 and the protein encoded by the same and application thereof

By cloning and overexpressing the loquat EjFAD8 gene, the synthesis of unsaturated fatty acids and the reduction of H2O2 content were increased, which solved the problem of loquat's susceptibility to low-temperature freezing disasters and improved its cold resistance.

CN116218800BActive Publication Date: 2026-06-02SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTHWEST UNIV
Filing Date
2023-02-13
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Loquats are susceptible to low-temperature freezing disasters, leading to reduced yields. Current technologies lack effective molecular mechanisms and gene regulation methods to improve their cold resistance.

Method used

Cloning and overexpressing the loquat fatty acid desaturase-related gene EjFAD8 can improve the plant's cold resistance by increasing the synthesis of unsaturated fatty acids and regulating the expression of low-temperature stress-related genes, thereby reducing H2O2 content.

Benefits of technology

It significantly enhanced the plant's cold resistance, improved its growth performance under low temperature stress, and increased the cold resistance of loquat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004075662040000011
    Figure HDA0004075662040000011
  • Figure HDA0004075662040000012
    Figure HDA0004075662040000012
  • Figure HDA0004075662040000013
    Figure HDA0004075662040000013
Patent Text Reader

Abstract

This invention relates to the field of plant molecular biology, specifically to a loquat fatty acid desaturase-related gene, EjFAD8, its encoded protein, and its applications. The full-length cDNA sequence of this gene is shown in SEQ ID No. 1, and the amino acid sequence of its encoded protein is shown in SEQ ID No. 2. The EjFAD8 gene of this invention increases plant cold resistance by increasing the synthesis of SQDG (16:0 / 18:1) and promoting the expression of related genes in the ICE-CBF-COR low-temperature stress pathway. Using Agrobacterium tumefaciens Gv3101-mediated flower-dip method, the plant expression vector pCambia2300-35S::EjFAD8-eGFP containing the target gene was transformed into wild-type Arabidopsis thaliana. Overexpression of 35S::EjFAD8 in the transgenic Arabidopsis enhanced its cold resistance. This invention utilizes transgenic Arabidopsis thaliana plant materials obtained from the loquat EjFAD8 gene. Under low temperature stress, these plants can increase the content of unsaturated fatty acids, enhance the expression of low temperature-related genes, and reduce the content of H2O2 in the plant, thereby increasing the plant's cold resistance and showing great application potential.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to a loquat cold-resistant gene EjFAD8, a protein encoded by the loquat cold-resistant gene EjFAD8 and application thereof. BACKGROUND

[0002] Loquat is a subtropical evergreen plant belonging to the genus Eriobotrya in the subfamily Maloideae of the family Rosaceae. It is a highly nutritious economic fruit tree. Loquat undergoes flower bud differentiation from July to September each year and flowers and sets fruit from October to December. Therefore, it is highly susceptible to the effects of low temperatures and frost damage in autumn and winter, which can limit loquat production (Jiang Jimou, Chen Xiuping, Deng Chaojun, Xu Qizhi, Zheng Shaoquan. (2018). Analysis of the advantages and disadvantages and development strategies of my country's loquat industry. Chinese Horticulture Abstracts, 34(4), 4). In China's major loquat producing areas, there are reports of reduced loquat production or even death due to frost damage (Cai Lihong, (2012). Loquat Science. China Agriculture Press). Loquat has a long history of cultivation. In the process of loquat cultivation, developing high-yielding, high-quality loquat varieties with strong resistance to adverse conditions has gradually become one of the effective measures to solve the problem of low-temperature freezing damage to loquat. Compared with diploid loquat, triploid loquat has the characteristics of seedless fruit and vigorous vegetative growth (Peng Siwei, Wang Yongqing, Yan Juan, Tao Lian. (2011). Research progress in triploid loquat breeding. National Loquat Academic Symposium). Regarding cold resistance, studies have shown that the cold resistance of natural triploid loquat is generally higher than that of diploid loquat (Wang Xiaohui, Guo Qigao, He Qiao, Li Xiaolin, Xiang Suqiong, Wang Weixing, et al. (2013). Preliminary study on the cold resistance and heat tolerance of eight loquat germplasms. Paper from the National Loquat Academic Symposium). The triploid F1 generation obtained by crossing tetraploid loquat with a more cold-resistant diploid also showed higher photosynthetic efficiency, more stable photosystem, and greater cold resistance in winter than its parents (Liu Mingxiu, Wang Hongding, Zhang Yuna, Zhang Bangyan, Liu Song, Li Yunjia, et al. (2021). Differences in photosystem activity between triploid loquat and its tetraploid and diploid parents. Journal of Horticulture (048-001)). However, to date, the molecular mechanism of loquat cold resistance is still unclear, and little is known about the effective genes that regulate loquat's response to freezing stress. Under freezing stress, the fluidity and stability of plant cell membranes are among the key factors for plant survival. Increased lipid unsaturation on the cell membrane can reduce the hydrophobicity of the membrane surface and increase membrane fluidity (Takahashi D, Uemura M, Kawamura Y. (2018). Freezing tolerance of plant cells: From the aspect of plasma membrane and microdomain: Adaptation Mechanisms and Their Applications [J]. Advances in experimental medicine and biology).Studies in various herbaceous and woody plants have shown that the level of polyunsaturated fatty acids in plants under cold stress significantly affects their cold resistance and frost tolerance (Mikami K, Murata N. (2003). Membrane fluidity and the perception of environmental signals in cyanobacteria and plants[J]. Prog LipidRes, 42:527–543; Los DA. (2004). Murata N. Membrane fluidity and its roles in the perception of environmental signals[J]. Biochim Biophys Acta. 1666:142–157; Martz F, Kivinimi S, Palva TE, Sutinen ML. (2006). Contribution of omega-3fattyacid desaturase and 3-ketoacyl-ACP synthase II (KASII) genes in the modulation of glycerolipid fatty acid composition during cold acclimation in birchleaves. J Exp. Bot.57:897–909; Renaut J, Hoffmann L, Hausman JF. (2005). Biochemical and physiological related to cold acclimation and enhanced freezing tolerance in poplar plantlets. Physiol Planta. 125:82–94; Zhou Z, WangM, Zhao S, et al. (2010). Changes in freezing tolerance in hybrid poplar caused by up-and mechanisms down-regulation of PtFAD2 gene expression[J].Transgenic Research.19(4):647-654).Among them, fatty acid desaturase (FAD) is mainly responsible for membrane lipid desaturation. When plants are subjected to low temperature or even freezing stress, its expression level increases and lipid unsaturation increases in response to stress (Hernández ML, Padilla MN, Sicardo MD, Mancha, M., and Martínez-Rivas, JM (2010). Effect of different environmental stresses on the expression of oleate desaturase genes and fatty acid composition in olive fruit[J]. Phytochemistry, 2011, 72, 178–187).

[0003] The function of fatty acid desaturases (FADs) has been improved in other plants. Fatty acid desaturation is mainly accomplished by members of their family. FADs are mainly intact membrane-bound proteins, mostly located in the endoplasmic reticulum and chloroplasts (Bhunia RK, Kaur R, Mrinal K and Maiti M K. (2016). Metabolic engineering of fatty acid biosynthetic pathway in sesame (Sesamum indicum L.): assembling tools to develop nutritionally desirable sesame seed oil [J]. Phytochem. Rev. 15, 799–811). Based on the differences in the introduction of double bonds, FAD is divided into ω-3 and ω-6 type desaturases and catalyzes the synthesis of linoleic acid from oleic acid (Berberich T, Harada M, Sugawara K, Kodama H, Iba K, and Kusano, T. Two maize genes encoding ω-3 fatty-acid desaturase and their differential expression to temperature[J]. Plant Mol. Biol, 1998, 36, 297–306). Temperature can significantly affect the expression of FAD genes. Studies have shown that low temperature induces the upregulation of FAD expression in olive oil in response to low temperature stress (Hernández ML, Padilla MN, Mancha M, and Martínez-Rivas J M. (2009). Expression analysis identifies FAD2-2 as the olive oleate desaturase gene mainly responsible for the linoleic acid content in virgin olive oil[J]. J. Agric. Food Chem. 57, 6199–6206).Long-term low temperatures in Arabidopsis thaliana lead to a downregulation of membrane lipid unsaturation in FAD mutants, significantly affecting chloroplast development and causing wilting and death (Miquel M, James D Jr, Dooner H, Browse J. (1993). Arabidopsis requires polyunsaturated lipids for low-temperature survival[J]. Proc Natl Acad Sci US A. 90(13):6208-12). Transgenic plants with FAD exhibit better cold tolerance than wild-type plants, indicating that the FAD family plays an important role in the stability of membrane lipids in plants under freezing stress (Zhou Z, Wang M, Zhao S, et al. (2010). Changes in freezing tolerance in hybrid poplar caused by up-and down-regulation of PtFAD2 gene expression[J]. Transgenic Research, 19(4):647-654).

[0004] Loquat is susceptible to low-temperature freezing damage, which reduces its yield. However, by analyzing the regulation of the loquat FAD gene, we can further understand the function of unsaturated fatty acids, which is of great importance for loquat's resistance to low-temperature stress and lays a theoretical foundation for molecular markers. Summary of the Invention

[0005] To address the above problems, this invention provides a loquat fatty acid desaturase-related gene EjFAD8, its encoded protein, and its applications.

[0006] First, this invention provides loquat EjFAD8 protein, which is as follows:

[0007] 1) A protein composed of the amino acids shown in SEQ ID No. 2; or

[0008] 2) Proteins derived from 1) having equivalent activity by substitution, deletion or addition of one or more amino acids in the amino acid sequence shown in SEQ ID No. 2.

[0009] The present invention also provides a gene encoding the loquat EjFAD8 protein.

[0010] Preferably, the nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0011] The present invention also provides a gene encoding the EjFAD8 protein, preferably, the cDNA sequence of the gene is shown in SEQ ID No. 1.

[0012] The present invention provides primer pairs for amplifying the gene, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID No. 3; and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 4.

[0013] The present invention provides an overexpression vector containing the gene, a host cell, and an engineered bacterium.

[0014] The present invention also provides the use of the gene in regulating the cold resistance of loquat.

[0015] In one specific embodiment of the present invention, the gene increases plant cold resistance by increasing the synthesis of unsaturated fatty acids under low temperature stress.

[0016] In one specific embodiment of the present invention, the gene enhances plant cold resistance at low temperatures by increasing the expression of genes related to the low-temperature regulatory pathway and reducing H2O2 content.

[0017] The present invention provides a transformant obtained by transforming a host with the above-described expression vector.

[0018] This invention provides the application of the loquat cold-resistant gene EjFAD8 and its protein, expression vector or transformant in breeding to improve the cold resistance of loquat.

[0019] This invention cloned a gene, EjFAD8, closely related to cold resistance in loquat from a triploid variety with high cold resistance and high photosynthetic efficiency, and found that it is located in the chloroplast. Real-time quantitative PCR confirmed that the expression level of the EjFAD8 gene significantly increased after low-temperature treatment in loquat, with the highest expression in the cold-resistant, high-photosynthetic triploid, indicating that the EjFAD8 gene plays a role in improving the low-temperature stress resistance of loquat. Using genetic engineering techniques, a plant overexpression vector of the EjFAD8 gene was constructed, and its overexpression in wild-type Arabidopsis thaliana promoted the accumulation of downstream unsaturated fatty acid SQDG regulated by FAD8. Simultaneously, it significantly altered the changes in related genes in the key regulatory pathway ICE-CBF-CORs of the low-temperature stress pathway and reduced the accumulation of H2O2 induced by low-temperature stress, ultimately improving the cold resistance of Arabidopsis thaliana. This invention provides promising applications for the regulation of low-temperature stress in angiosperms. Attached Figure Description

[0020] Figure 1 The image shown is a clone electrophoresis photograph of the loquat EjFAD8 gene. M represents the DL2000 DNA marker, and 1 represents the PCR product of the EjFAD8 gene ORF.

[0021] Figure 2The image shows an amino acid sequence of the loquat EjFAD8 protein compared with those of apple, sycamore, pear, American black poplar, poplar, sand sphagnum moss, citrus, and Arabidopsis thaliana. All of them have a highly conserved FAD transmembrane domain.

[0022] Figure 3 The image shows the subcellular localization of the loquat EjFAD8 gene transiently expressed in tobacco leaves, indicating that the EjFAD8 protein is localized in chloroplasts. GFP: Green fluorescent protein; RFP: Red fluorescent protein; Bright Field: Bright field imaging; Merged: Merged image of GFP, RFP, and Bright Field.

[0023] Figure 4 The image shows positive identification of the loquat EjFAD8 transgenic Arabidopsis thaliana. (A) PCR amplification identification; (B) RT-qPCR identification. M: DL2000 DNA marker; P: positive control; N: negative control; WT: wild-type Arabidopsis thaliana.

[0024] Figure 5 The figures show the phenotypic changes in EjFAD8 transgenic Arabidopsis thaliana. (A) Differences in plant growth phenotypes after treatment at 0℃; (B) Differences in root growth after vertical culture at room temperature; (C) Differences in root growth after vertical culture at 0℃; (D) Differences in leaf color after DAB staining; (E) Statistical analysis of root growth differences after vertical culture at room temperature; (F) Statistical analysis of root growth differences after vertical culture at 0℃.

[0025] Figure 6 The images show the changes in downstream unsaturated fatty acids and genes involved in the ICE-CBF-COR pathway in EjFAD8 transgenic Arabidopsis thaliana. (A) Changes in downstream unsaturated fatty acids in EjFAD8 transgenic Arabidopsis thaliana; (B) Changes in genes involved in the ICE-CBF-COR pathway in EjFAD8 transgenic Arabidopsis thaliana. Detailed Implementation

[0026] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions or conditions recommended in the manufacturer's instructions.

[0027] Example 1: Molecular cloning of the loquat EjFAD8 gene sequence

[0028] (1) Extraction of total RNA from triploid loquat leaves

[0029] Take 500 mg of cold-resistant and high photosynthetic triploid loquat leaves, store them in cryovials, and immediately freeze them in liquid nitrogen for 30 min. Then, transfer them to an ultra-low temperature freezer at -80℃ for storage. Total RNA was extracted from the leaves using a polysaccharide and polyphenol plant total RNA extraction kit. After extraction, the corresponding cDNA was obtained using a reverse transcription kit, and the corresponding RNA was stored in an ultra-low temperature freezer at -80℃.

[0030] Based on our team's previous loquat resequencing data, homologous recombination primers were designed at both ends of the full-length sequence encoded by the loquat EjFAD8 gene. The forward primer sequence is: EjFAD8-F: gacaggggtacccggggatccATGGCGACTTGGGTCCTCTC; and the reverse primer sequence is: EjFAD8-R: gtgtcgactctagaggatccGGTTGAAGTGGTACTCACTGC.

[0031] Using total cDNA from triploid loquat leaves as a template, the loquat EjFAD8 gene was amplified by PCR using primers EjFAD8-F and EjFAD8-R. The PCR amplification system and reaction conditions were as follows: total amplification volume 20 μL, high-fidelity enzyme PrimerSTAR 10 μL, ddH2O 7 μL, template (total cDNA from leaves) 1 μL, upstream primer EjFAD8-F 1 μL, and downstream primer EjFAD8-R 1 μL. The reaction conditions were as follows: 95℃-5 min; 95℃-30 s, 57℃-30 s, 72℃-30 s, 35 cycles; 72℃-30 s. After the reaction, the amplification product was removed, 10× loading buffer 2 μL was added and mixed well, and then detected by 1% agarose gel electrophoresis. The correct specific bands were shown below. Figure 1 The gel was recovered using a gel recovery kit, and the concentration of the obtained product was determined and stored in a -20°C freezer.

[0032] Using DNAMAN software, the CDS of the EjFAD8 gene was obtained as 1155 bp (SEQ ID No. 1). Protein translation was performed, and after removing the stop codon, a 384-amino acid sequence was obtained (SEQ ID No. 2). Amino acid sequence-specific alignment of the obtained sequence with FAD8 proteins from apple, sycamore, pear, American black poplar, poplar, sand sphagnum moss, citrus, and Arabidopsis thaliana revealed that all these sequences possess a conserved FAD8 transmembrane domain. Figure 2 ).

[0033] Example 2: Construction of the plant expression vector pCambia2300-35S::EjFAD8-eGFP for the loquat EjFAD8 gene

[0034] Based on the designed upstream and downstream primers for the EjFAD8 gene, the plant expression vector pCambia2300-35S::eGFP was digested with the restriction endonuclease SmaI. The digestion system was as follows: total digestion volume was 20 μL, including 1 μL of SmaI, 10 μL of 10× buffer, and 9 μL of the plant expression vector pCambia2300-35S::eGFP plasmid. The digestion was carried out at 37℃ for 30 min. After the reaction, the product was collected, and the correct specific band was obtained by 1% agarose gel electrophoresis. The gel was then recovered using a gel recovery kit, and the concentration of the obtained product was identified and stored at -20℃. The recovered EjFAD8 target gene fragment and the SmaI-digested plant expression vector were ligated using a homologous recombinase, and E. coli were transformed. The resulting bacterial culture was sequenced and compared to obtain the plant expression vector pCambia2300-35S::EjFAD8-eGFP containing the EjFAD8 gene. The concentration of the obtained carrier was determined and stored in a -20°C freezer, while the activated E. coli culture was stored in an ultra-low temperature freezer at -80°C.

[0035] Example 3: The transgenic expression vector pCambia2300-35S::EjFAD8-eGFP was transformed into Arabidopsis thaliana.

[0036] 1 μg of the obtained vector plasmid was chilled on ice and mixed with 100 μL of freeze-thawed Agrobacterium competent cells GV3101. The mixture was then placed on ice for 5 min, transferred to liquid nitrogen for 5 min, and then incubated at 37°C for 5 min. 700 μL of YEB medium was added, and the mixture was placed in a shaker at 28°C (220 rpm) for 2 hours. The bacterial culture was then spread onto YRK medium containing rifampicin and kanamycin resistance, and incubated upside down at 28°C for 48 hours. PCR verification was performed using primers for the EjFAD8 gene. The PCR amplification system and reaction conditions were as follows: total amplification volume 20 μL, low-fidelity enzyme Taq 10 μL, ddH2O 7 μL, template (Agrobacterium) 1 μL, upstream primer EjFAD8-F 1 μL, and downstream primer EjFAD8-R 1 μL. The reaction conditions were as follows: 95℃-5min; 95℃-30s, 57℃-30s, 72℃-30s, 30 cycles; 72℃-30s, finally yielding Agrobacterium with the target fragment.

[0037] Positive Agrobacterium species containing the pCambia2300-35S::EjFAD8-eGFP plasmid were activated in 10 mL of YRK medium and incubated at 28°C with a shaker until the OD value was between 0.8 and 1.2. The precipitate was then transferred to 100 mL of YRK medium until the OD value was between 0.8 and 1.2. The precipitate was centrifuged at 6000 rpm for 20 min, the supernatant was discarded, and the precipitate was resuspended in a resuspension buffer (100 mL system containing 5 g sucrose and 50 μL Silwet L-77 surfactant) for later use.

[0038] Arabidopsis thaliana was sown in a nutrient soil mixture of humus, vermiculite, and perlite in a 3:1:1 ratio. After two days of dark incubation at 4°C, the seeds were transferred to a 23°C incubator (80% humidity, 16 hours of light). When ready for infection, pods and flowers were removed, leaving only flower buds. These buds were then infected with a prepared suspension for 10-30 seconds, followed by 24 hours of moist dark incubation. The mixture was then transferred to a 23°C incubator. This method was repeated twice, with a 7-day interval, until seed harvest.

[0039] Example 4: Subcellular localization analysis of the loquat EjFAD8 gene

[0040] 10 mL of Agrobacterium tumefaciens containing the pCambia2300-35S::EjFAD8-eGFP plasmid was incubated at 28℃ with shaking until the OD value was between 0.8 and 1.2. The mixture was centrifuged at 6000 rpm for 20 min, the supernatant was discarded, and the precipitate was resuspended in 10 mL of resuspension buffer (10 mM MgCl2, 10 mM MES, 150 μM acetylsyleugenone). The resuspension was then used to transform tobacco leaves. After dark incubation for 48 h, GFP fluorescence was observed. The results are as follows: Figure 3 As shown in the figure. The results indicate that the EjFAD8 protein is located in the chloroplast.

[0041] Example 5: Screening of transgenic Arabidopsis thaliana containing the loquat EjFAD8 gene

[0042] The collected Arabidopsis seeds were blanched and then cleaned. The following steps were performed sequentially on a laminar flow hood: sterilization with 75% alcohol for 1 min, sterilization with 1‰ Tween 80 for 10 min, rinsing with sterile water 5-8 times, rapid rinsing with anhydrous ethanol, and then spreading the seeds evenly on sterile filter paper to dry. The seeds were then evenly sprinkled onto 1 / 2 MS medium containing kanamycin resistance, placed in a 23℃ light incubator, and positive seedlings were selected and transferred to Arabidopsis thaliana nutrient soil for cultivation.

[0043] Example 6: Positive identification of transgenic Arabidopsis thaliana containing the loquat EjFAD8 gene

[0044] The DNA amplification and identification steps are as follows: Take one leaf from each of the Arabidopsis thaliana strains and wild-type Arabidopsis thaliana strains to be tested, and extract the DNA of the strains to be tested using a plant DNA extraction kit according to the steps. Use the DNA of wild-type Arabidopsis thaliana as a negative template and Agrobacterium containing the target gene as a positive template. Use Taq enzyme and primers EjFAD8-F and EjFAD8-R for PCR amplification and identification.

[0045] The real-time quantitative PCR identification steps are as follows: Specific expression primers for the EjFAD8 gene were designed using DNAMAN, yielding the upstream primer eEjFAD8-F: CAGCGAACTGTTTCTCCCAA and the downstream primer eEjFAD8-R: CTTGGACAGGTCCCATTGTG. The upstream primer for the Arabidopsis thaliana internal reference gene, Actin-F: TATCGCTGACCGTATGAG, and the downstream primer, Actin-R: CTGAGGGAAGCAAGAATG, were synthesized for real-time quantitative PCR. The PCR reaction program was: 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 30 s, for 40 cycles. Then, melting curves were collected: the temperature was adjusted to 60℃ for 90 s for pre-melting; then the temperature was increased at a rate of 1.0℃ / s, holding for 5 s at each 1℃ increase until reaching 95℃. Each reaction was performed in triplicate. The results are as follows: Figure 4 As shown, different levels of EjFAD8 gene expression were detected in transgenic Arabidopsis thaliana OE6, OE7, and OE8.

[0046] Example 7: Phenotypic identification of transgenic Arabidopsis thaliana containing the loquat EjFAD8 gene

[0047] To analyze the effects of heterologous overexpression of the EjFAD8 gene on the growth and development of Arabidopsis thaliana, two transgenic Arabidopsis thaliana lines, OE6 and OE7, in their T3 generation, were selected for treatment observation and phenotypic analysis.

[0048] Wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana cultured normally were transferred to a 0℃ light incubator for 5 days. The results showed that ( Figure 5 A): Wild-type Arabidopsis thaliana exhibited leaf curling and wilting, while the transgenic lines grew normally, indicating that heterologous overexpression of the EjFAD8 gene enhances the cold resistance of Arabidopsis thaliana.

[0049] Wild-type Arabidopsis thaliana and transgenic line T3 seeds were sterilized on a clean bench and then placed on 1 / 2 MS plates, incubated at 23°C. Figure 5 B) and 0℃ Figure 5 C) Vertical culture in a light incubator for 10 days showed no significant difference under 23℃ light incubation. Figure 5 E), the root length of the transgenic lines treated at 0℃ was significantly longer than that of the wild-type lines.Figure 5 F). The results also showed that heterologous overexpression of the EjFAD8 gene enhanced the cold resistance of Arabidopsis thaliana.

[0050] The working staining solution was prepared by dissolving 100 mg DAB in 100 mL of phosphate buffer. Arabidopsis leaves were immersed in the DAB staining solution and stained at room temperature in the dark for 2-6 hours until dark brown staining appeared on positive areas. After rinsing 3-5 times with pure water, the leaves were immersed in 95% ethanol at 40°C for 3-16 hours, and the color was observed. The results showed that there was no significant difference between wild-type and transgenic lines at 23°C, while the staining of transgenic lines was lighter than that of wild-type Arabidopsis leaves at 0°C. Figure 5 D). The results showed that the transgenic lines exhibited better stress resistance by reducing the H2O2 content in their leaves under low-temperature stress.

[0051] Example 8: Expression levels of low-temperature stress-related genes in transgenic Arabidopsis lines

[0052] Specific expression primers for low-temperature stress-related genes were designed using DNAMAN: AtCBF1 upstream primer AtCBF1-F: AATTGTTTGGCTCCGATTACG, downstream primer AtCBF1-R: CCCACTTACCGGAGTTTCTT; AtCBF2 upstream expression primer AtCBF2-F:

[0053] GACCTTGGTGGAGGCTATTT, downstream primer AtCBF2-R:ATCCCTTCGGCCATGTTATC; AtCBF3 upstream primer AtCBF3-F:TTATATGCACGATGAGGCGA, downstream primer AtCBF3-R:ATGATTCCACTGTACGGACG; AtICE1 upstream expression primer AtICE1-F:GTTCGGGAATGAGGAGGTTT, downstream primer AtICE1-R:AACACTCTCAGCCGCTTTAC; AtRD29A upstream expression primer AtRD29A-F:CTTGTCGACGAGAAGCAAAGAA, downstream primer AtRD29A-R:TCTTGATGGAGAATTCGTGTCC; AtCOR15A upstream primer AtCOR15A-F:GTCGTCGTTTCTCAACGCAAGA, downstream primer AtCOR15A-R:GCTTTCTCAGCTTCTTTACCCA. Quantitative real-time PCR showed that the expression levels of various low-temperature stress-related genes in the transgenic lines were significantly increased after low-temperature treatment compared with the wild type. Figure 6B). The results showed that heterologous expression of the EjFAD8 gene significantly altered the changes in related genes in the key regulatory pathway of the cryogenic stress pathway, ICE-CBF-CORs.

[0054] Example 9: Determination of downstream unsaturated fatty acids of FAD8 in transgenic Arabidopsis thaliana lines

[0055] Leaves of 1g each from wild-type and transgenic Arabidopsis thaliana cultured at 23℃ and treated at 0℃ were immediately frozen in liquid nitrogen and sent to the company for non-targeted relative quantitative lipidomics analysis. The results showed that the content of various unsaturated fatty acids in transgenic Arabidopsis thaliana was increased compared with that in wild-type Arabidopsis thaliana, especially SQDG (16:0 / 18:1), which was significantly increased in transgenic Arabidopsis thaliana. Figure 6 A). The results showed that heterologous expression of the EjFAD8 gene increased the content of SQDG (16:0 / 18:1) in Arabidopsis thaliana, thereby increasing cold resistance.

[0056] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Loquat EjFAD8 protein, which is a protein composed of the amino acids shown in SEQ ID No.

2.

2. The gene encoding the loquat EjFAD8 protein as described in claim 1.

3. The gene as described in claim 2, characterized in that, The sequence is shown in SEQ ID No.

1.

4. A vector containing the gene of claim 2 or 3.

5. Engineered bacteria containing the gene described in claim 2 or 3.

6. Use of the gene described in claim 2 or 3 to increase the cold resistance of Arabidopsis thaliana by increasing the synthesis of unsaturated fatty acids under low temperature stress.

7. The use as described in claim 6, characterized in that, The gene described in claim 2 or 3 is transferred into the Arabidopsis genome and overexpressed in transgenic Arabidopsis, thereby enhancing the plant's cold resistance at low temperatures by increasing the content of unsaturated fatty acids.

8. The use of the gene described in claim 2 or 3 to enhance the cold resistance of Arabidopsis thaliana by increasing the expression of genes in the cryoregulatory pathway and reducing H2O2 content at low temperatures.

9. The use as described in claim 8, characterized in that, The gene described in claim 2 or 3 is transferred into the Arabidopsis genome and overexpressed in transgenic Arabidopsis. Under low temperature conditions, the plant's cold resistance is enhanced by increasing the expression of genes in the low temperature regulation pathway and reducing H2O2 content.