Use of a long non-coding RNA in preparation of a diagnostic product or therapeutic drug for heart failure

By studying the expression and function of LOC107984012, we developed it as a diagnostic biomarker and therapeutic target for heart failure. Using quantitative real-time PCR and RNA interference technology, we overcame the shortcomings in the diagnosis and treatment of heart failure, and improved the diagnostic accuracy and treatment effect.

CN116218996BActive Publication Date: 2026-06-26THE NAVAL MEDICAL UNIV OF PLA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310096823.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-10
Publication Date
2026-06-26
Estimated Expiration
2043-02-10

AI Technical Summary

Technical Problem

The lack of effective application of long non-coding RNA LOC107984012 in the diagnosis and treatment of heart failure in existing technologies has led to insufficient diagnostic and treatment levels for heart failure, especially the problems of younger age of onset, poor prognosis and high mortality.

Method used

The expression and function of LOC107984012 were studied using quantitative real-time PCR and RNA interference technology. The aim was to develop LOC107984012 as a diagnostic reagent and therapeutic drug for heart failure. By specifically interfering with its expression with siRNA, the expression level of LOC107984012 was inhibited or reduced, and it was used as a diagnostic biomarker and therapeutic target for heart failure.

Benefits of technology

LOC107984012 is specifically highly expressed in tissues with heart failure, reflecting changes in cardiac function. It can serve as a diagnostic marker for heart failure, and inhibiting its expression can restore cardiac function and improve the treatment effect of heart failure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116218996B_ABST
    Figure CN116218996B_ABST
Patent Text Reader

Abstract

The application relates to the fields of medical diagnosis and gene drugs, and particularly relates to application of long-chain non-coding RNA in preparation of a heart insufficiency diagnosis reagent or kit. The application also provides application of the long-chain non-coding RNA in preparation of a heart insufficiency treatment drug. The application first finds that LOC107984012 is long-chain non-coding RNA which is highly expressed in a failing heart, and provides a new diagnosis marker and treatment target for heart insufficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of gene therapy and medical diagnostics, specifically to the application of long non-coding RNA in the preparation of diagnostic products or therapeutic drugs for heart failure. Background Technology

[0002] Heart failure (HF) is characterized by impaired systolic and / or diastolic function, resulting in the inability to deliver sufficient blood and oxygen to surrounding tissues to meet normal physiological metabolic needs. Clinically, HF can be accompanied by a series of complex syndromes, also known as heart failure. HF is characterized by high morbidity and mortality, making it a global problem urgently needing a solution. While research on the pathophysiological mechanisms, prevention, and treatment strategies of HF has achieved unprecedented results and progress with continuous advancements in scientific research, clinical practice still faces challenges such as younger age of onset, poor overall prognosis, and high mortality and readmission rates. Therefore, exploring the relationship between the function of novel genes and cardiac ejection function is of great significance for revealing the molecular mechanisms of HF, designing therapeutic drugs, assessing prognosis, and further improving the diagnosis and treatment of heart failure in my country.

[0003] Non-coding RNAs were previously thought to be uninvolved in essential cellular functions and were therefore considered "transcriptional noise" or "genetic junk," leading researchers to ignore these non-coding regions. However, with advancements in scientific research, ncRNAs transcribed from these regions have increasingly become important regulators of cell development and hold significant implications for human diseases, especially lncRNAs. lncRNAs function through various mechanisms: they can bind to transcription factors to regulate target genes; they can recruit DNA target chromatin modification complexes; they can directly participate in the translation, cleavage, and degradation of mRNA; they can bind to the target sites of miRNA effector complexes, rendering them inactive; and they can interact with RNA, DNA molecules, and protein complexes to perform their functions and regulate various physiological and pathological processes.

[0004] There are currently no reports on the biological functions of LncRNA LOC107984012. Summary of the Invention

[0005] The purpose of this invention is to provide a long non-coding RNA, LOC107984012, which can be effectively used for the diagnosis, treatment and diagnosis of heart failure, and its new pharmaceutical use, namely, its application in the preparation of diagnostic products or therapeutic drugs for heart failure.

[0006] In the process of studying the pathogenesis of heart failure, this invention discovered that LOC107984012 is a long non-coding RNA that is mainly expressed in high abundance in heart tissue with decreased ejection function, and is not expressed or only expressed in small amounts in normal heart tissue. This invention is the first to discover the function and application value of LOC107984012.

[0007] The main technical solution of this invention is as follows: This invention uses quantitative real-time PCR to study and find that the expression of LOC107984012 in the hearts of patients with chronic heart failure is significantly abnormal. Simultaneously, the expression level of LOC107984012 is positively correlated with the concentration of isoproterenol stimulation received by cardiomyocytes, indicating that the expression level of LOC107984012 can reflect the pathological stimulation received by cardiomyocytes in heart failure to a certain extent. Furthermore, this invention uses RNA interference technology to study gene function, interfering with the expression of LOC107984012 using specific siRNA, and studying the role of this gene in the process of pathological stimulation of the heart through Western blotting experiments.

[0008] In a first aspect, the present invention provides the application of a long non-coding RNA in the preparation of diagnostic reagents or kits for heart failure, wherein the long non-coding RNA is LOC107984012, whose genomic location is adjacent to the Egr2 gene and located upstream of the Egr2 gene, and the cDNA sequence obtained by reverse transcription is shown in SEQ ID NO:1.

[0009] Furthermore, the reagent is used to detect the expression level of LOC107984012 in biological samples.

[0010] Furthermore, the kit contains reagents for detecting the expression level of LOC107984012 in biological samples.

[0011] Furthermore, the reagent for detecting the expression level of LOC107984012 in biological samples is selected from probes, gene chips, or PCR primers that have detection specificity for LOC107984012.

[0012] Furthermore, the biological sample is selected from: fresh tissues or cells obtained from the subject, formalin-fixed or paraffin-embedded tissues or cells, blood or body fluids.

[0013] In a second aspect, the present invention provides the application of a long non-coding RNA in the preparation of a drug for treating heart failure, wherein the long non-coding RNA is LOC107984012, which is located adjacent to the Egr2 gene in the genome and upstream of the Egr2 gene, and the cDNA sequence obtained by reverse transcription is shown in SEQ ID NO:1.

[0014] Furthermore, the aforementioned heart failure treatment drug uses LOC107984012 as its therapeutic target.

[0015] Furthermore, the aforementioned heart failure treatment drug inhibits or reduces the expression level of LOC107984012.

[0016] A third aspect of the invention provides the use of a reagent that inhibits or reduces the expression level of LOC107984012 in the preparation of a medicament for the treatment of heart failure.

[0017] Furthermore, the reagents described above that inhibit or reduce the expression of LOC107984012 suppress the expression of cardiac function indicators and heart failure factors.

[0018] Furthermore, the reagents used to inhibit or reduce the expression level of LOC107984012 include, but are not limited to: siRNA, shRNA, and ASO.

[0019] In a preferred embodiment of the present invention, the reagent for inhibiting or reducing the expression level of LOC107984012 is selected from siRNA1, siRNA2 or siRNA3, and their target sequences are shown in SEQ ID NO:3 to SEQ ID NO:5, respectively.

[0020] Furthermore, the siRNA 1 has the sense strand shown in SEQ ID NO:6 and the antisense strand shown in SEQ ID NO:7; the siRNA 2 has the sense strand shown in SEQ ID NO:8 and the antisense strand shown in SEQ ID NO:9; and the siRNA 3 has the sense strand shown in SEQ ID NO:10 and the antisense strand shown in SEQ ID NO:11.

[0021] This invention has been experimentally proven to be:

[0022] 1. LOC107984012 is highly expressed in cardiac tissue samples from patients with end-stage heart failure and dilated cardiomyopathy: Quantitative real-time PCR was used to detect the expression level of LOC107984012 in cardiac tissue from patients with heart failure and in cardiac tissue from age-matched donors without any cardiac function. The results showed that the expression level in cardiac tissue from heart failure patients was approximately 50 times higher than that in normal cardiac tissue. Therefore, LOC107984012 can serve as a diagnostic biomarker for heart failure.

[0023] 2. Response of LOC107984012 to Increased Myocardial Sympathetic Activity in Heart Failure: AC16 human cardiomyocytes were seeded into 12-well plates, and DMEM complete medium containing 0, 20, 50, and 100 μM of norepinephrine (ISO), a major neurotransmitter of the sympathetic nervous system, was added to the corresponding wells to achieve pathological stimulation. After 24 h, total RNA was extracted using Trizol reagent and quantitative analysis was performed by fluorescent PCR. The results showed that LOC107984012 expression increased in a dose-dependent manner under the influence of ISO, indicating that the expression level of LOC107984012 can reflect the pathological changes in the heart during heart failure.

[0024] 3. Effects of LOC107984012 on Cardiac Function Indicators: AC16 human cardiomyocytes were seeded into 12-well plates. After 12 hours, LOC107984012-specific RNAi reagent and negative control RNAi were transfected using riboFECT reagent, respectively. After 24 hours, the culture medium in the corresponding wells was replaced with DMEM complete medium containing 100 μM norepinephrine (ISO) to achieve pathological stimulation. After 24 hours, total protein was extracted using protein lysis buffer containing protease inhibitors and phosphatase inhibitors for Western blotting analysis. The results showed that in the negative control RNAi group, ISO induction significantly upregulated cardiac function indicators ANP, BNP, and β-MHC, indicating cardiac failure. However, in the LOC107984012-specific RNAi reagent group, i.e., after LOC107984012 expression was inhibited, the effect of ISO in inducing the increase of cardiac function indicators disappeared.

[0025] 4. Role of LOC107984012 homolog GM32255 in heart failure mice: Based on genomic localization, the mouse homolog of LOC107984012 was identified as GM32255, and its cDNA sequence obtained by reverse transcription is shown in SEQ ID NO:2. Conditional knockout mice of C57BL / 6J-GM32255 cardiomyocytes were obtained using the Cre-loxP system. Wild-type GM32255 mice were obtained through breeding and identification. flox / flox and knockout GM32255 CKO Mice. Mice in each group underwent left anterior descending artery (LAD) ligation surgery to induce heart failure, and cardiac function was assessed by echocardiography eight weeks later. Results showed that, compared with wild-type mice, GM32255 knockout mice exhibited significantly enhanced cardiac function, with representative echocardiograms showing smaller ventricular diameters and stronger ventricular wall pulsation. This indicates that knockout of the LOC107984012 homologous gene has a protective effect on cardiac function.

[0026] The advantages of this invention are:

[0027] LOC107984012 is specifically highly expressed in tissues with heart failure and is closely related to cardiac function. It can serve as a drug target for the treatment of heart failure and improve the treatment level of heart failure. The RNA interference sequence constructed in this invention can play an effective role in the treatment of heart failure targeting LOC107984012. Transcriptional regulation of the LOC107984012 gene can also be used for the biological treatment of heart failure. Attached Figure Description

[0028] Figure 1 Expression levels of LOC107984012 in heart tissue specimens from patients with end-stage heart failure due to dilated cardiomyopathy who underwent heart transplantation and in heart tissue specimens from age-matched donors without any heart disease.

[0029] Figure 2 Analysis of the response of LOC107984012 in AC16 cardiomyocytes to different concentrations of the sympathetic neurotransmitter norepinephrine.

[0030] Figure 3 RNA interference in the expression of LOC107984012.

[0031] Figure 4 Effects of inhibiting LOC107984012 expression levels on ANP, BNP, and β-MHC protein levels, which are cardiac function indicators, after ISO induction.

[0032] Figure 5 The cardiac function of heart failure mice with knockout of the LOC107984012 homolog GM32255 is enhanced. Detailed Implementation

[0033] The specific implementation methods provided by the present invention will be described in detail below with reference to the embodiments.

[0034] Unless otherwise specified, all reagents involved in the embodiments of this invention are commercially available products and can be purchased through commercial channels.

[0035] Example 1:

[0036] 1. Sample preparation

[0037] Human heart samples were collected by the First Affiliated Hospital of Sun Yat-sen University from patients who received heart transplants due to end-stage heart failure caused by dilated cardiomyopathy and from age-matched donors without any heart disease. The study complied with the principles outlined in the Declaration of Helsinki and obtained informed consent from the participants' families.

[0038] AC16 human cardiomyocytes were cultured in DMEM complete medium containing 10% fetal bovine serum and 1% penicillin-streptomycin antibiotics at 37°C in a 5% CO2 incubator. When the cell density reached 90%, the cells were passaged, the original medium was discarded, and the cells were washed twice with 1×PBS. 2 mL of 0.25% trypsin was added, and the cells were digested for 1 min. Complete medium was then added to stop the digestion. Cells were gently pipetted using a sterile disposable pipette and transferred to 15 mL centrifuge tubes. The cells were centrifuged at 1500 rpm for 4 min, the supernatant was discarded, and the cells were resuspended in 12-well plates. Pathological stimulation was achieved by adding DMEM complete medium containing 0, 20, 50, and 100 μM of norepinephrine (ISO), a major neurotransmitter of the sympathetic nervous system, to the corresponding wells.

[0039] 2. Extraction of total RNA

[0040] Take 5-10 mg of heart tissue sample into a 2 mL enzyme-free sterile grinding tube with steel balls, add 1 mL of Trizol, and grind in a tissue homogenizer for 5 min at a frequency of 50 Hz; add 0.2 mL of chloroform to each tube at a ratio of 5:1, vortex 30 times, and let stand for 5 min until the liquid initially separates into layers; after centrifugation at 12000×g for 15 min at 4℃, a clear upper aqueous phase, a white intermediate phase, and a red lower organic phase can be seen. Carefully aspirate the upper aqueous phase layer into a new 1.5 mL EP tube; add an equal volume of isopropanol and mix by inverting. After standing at 4℃ for 10 min, centrifuge at 12000×g at 4℃ for 10 min. A white precipitate is visible at the bottom of the tube; discard the supernatant. Add 75% ethanol to wash the precipitate, and centrifuge at 7500×g at 4℃ for 8 min. Discard the supernatant, open the cap and air dry until the white precipitate becomes transparent. Add approximately 20 μL of DEPC water to each tube and incubate at 55℃ for 10 min to dissolve the RNA. The sample concentration and purity are determined using a NanoDrop 2000 analyzer, and the samples are stored at -80℃.

[0041] 3. Reverse transcription

[0042] Using Takara PrimeScript TM For reverse transcription using the RT Master Mix kit, prepare the reaction solution system according to the following components and perform the operation on ice.

[0043] 5×PrimeScript RT Master Mix 4μL

[0044] Total RNA 1000ng

[0045] Add RNase-Free H2O to a final volume of 20 μL.

[0046] After gentle mixing, reverse transcription was performed under the following conditions: 37℃ for 15 min; reverse transcriptase inactivation reaction at 85℃ for 5 sec, followed by storage at 4℃.

[0047] 4. Quantitative Real-Time PCR

[0048] After reverse transcription, cDNA was used for RT-qPCR to detect the expression levels of related molecules. The reaction system was prepared as follows:

[0049]

[0050] The reaction conditions are as follows:

[0051]

[0052] The results are shown in the figure. The expression of LOC107984012 in the tissues of heart failure patients was approximately 50 times higher than that in normal donors. Figure 1 Furthermore, it was found that LOC107984012 responded to increasing ISO concentration in a dose-dependent manner. These results indicate that LOC107984012 was significantly highly expressed in heart failure tissue or cardiomyocyte models, and its expression increased with increasing ISO stimulation concentration, with the expression trend mirroring the changes throughout the disease course.

[0053] Example 2:

[0054] 1. Expression interference of LOC107984012

[0055] Using BLAST search, three siRNA sequences were designed to interfere with Lnc4012 in the specific sequence region of LOC107984012. The interfering sequences were mixed in equal proportions to form the RNAi-lnc4012 reagent and co-transfected into cells. The specific sequences are shown below.

[0056] Table 1

[0057]

[0058] siRNA 1:

[0059] Chain of Justice: GCAACUAUUGAAAUGCAAA(SEQ ID NO:6);

[0060] Antonym chain: CGUUGAUAACUUUACGUUU (SEQ ID NO:7);

[0061] siRNA 2:

[0062] Chain of Justice: CACCAAGUCUGCAGGGAAG (SEQ ID NO:8);

[0063] Antonym chain: GUGGUUCAGACGUCCCUUC(SEQ ID NO:9);

[0064] siRNA 3:

[0065] Chain of Justice: GUGACAUCCUGGUCAAAUA (SEQ ID NO:10);

[0066] Antonym: CACUGUAGGACCAGUUUAU (SEQ ID NO:11).

[0067] 2. Transfection:

[0068] (1) Cells were seeded in 12-well plates.

[0069] (2) Dilute an appropriate amount of 10×riboFECT with 1×PBS TM Buffer to 1×. Remove riboFECT. TM Reagent, fully vortexed and allowed to return to room temperature before use.

[0070] (3) Use 60 μL of 1×riboFECT per well TM Dilute 2.5 μL of ssRNA with buffer to a final concentration of 50 nM and mix gently.

[0071] (4) Add 6 μL riboFECT TM Reagent, mix gently, and incubate at room temperature for 0-15 minutes.

[0072] (5) Add the transfection complex to the culture medium without antibiotics.

[0073] (6) Remove the cells and wash twice with 1×PBS. Add 1 mL of culture medium containing the transfection reagent.

[0074] (7) After 48 hours of culture, the lncRNA content was determined by real-time PCR.

[0075] Results: Compared with the negative control group (RNAi-NC), the expression of LOC107984012 in the RNAi-lnc4012 interference group was significantly reduced, indicating that the interference effect of RNAi-lnc4012 was strong. Figure 3 ).

[0076] Example 3:

[0077] 1. Sample preparation

[0078] AC16 human cardiomyocytes were seeded into 12-well plates and divided into two groups: a control group (RNAi-NC) and a group receiving LOC107984012 interference (RNAi-LOC107984012). The corresponding AC16 cells were transfected with LOC107984012-specific RNAi reagent and a negative control RNAi, respectively. 24 hours after transfection, the cells were further divided into a control group and a model group (treated with ISO stimulation), and the corresponding complete culture medium was replaced to achieve a normal growth environment and ISO pathological stimulation, respectively. After 24 hours, the cell culture dishes / plates were removed, the culture medium was aspirated, and the cells were washed three times with 1×PBS.

[0079] 2. Total protein extraction

[0080] Add 100 μL of protein lysis buffer containing protease inhibitors and phosphatase inhibitors. Scrape the cells off with a cell scraper and transfer them to a 1.5 mL EP tube. Incubate on ice for 10 min. Then centrifuge at 14000×g for 15 min at 4 °C. Transfer the supernatant to a new 1.5 mL EP tube, add 5× Loading Buffer, mix well, and denature at 99 °C for 10 min.

[0081] 3. Gel electrophoresis

[0082] Using ExpressPlus TM PAGE pre-prepared gels are used for protein electrophoresis. Remove the tape from the bottom of the pre-prepared gel, smoothly push the comb out of the gel plate, and place the gel plate into the gel electrophoresis apparatus. Pour enough 1×Tris-MOPS-SDS running buffer into the inner tank of the electrophoresis tank to cover the sample wells by 5-7 mm. Add the same electrophoresis buffer to the outer tank to ensure proper cooling. Electrophoresis at 140V for 50 min to allow the bromophenol blue bands to reach the bottom of the gel.

[0083] 4. Transfer membrane

[0084] During transfer, equilibrate the NC membrane in 1×eBlot L1 NC membrane equilibration concentrate for at least 1 min; carefully remove the gel after electrophoresis and immerse it in distilled water for at least 1 min. Lay a dry sponge pad on the side of the transfer clamp marked with "+", remove the membrane from the equilibration concentrate, lay it flat on the dry sponge pad, spread the gel flat on the membrane, remove air bubbles with a transfer roller, lay another dry sponge pad flat on the gel, close the transfer clamp, and insert the transfer clamp into the eBlot L1 rapid wet transfer instrument channel for transfer.

[0085] 5. Immunoblotting

[0086] After the transfer was completed, use 1×BlockPRO TMBlock the NC membrane with Protein-Free Blocking Buffer at room temperature for at least 1 min. Incubate the NC membrane with the corresponding primary antibody diluted in Blocking Buffer overnight at 4°C. The next day, after recovering the primary antibody, wash the membrane with 1×PBST for 30 min, changing the PBST every 5 min. Incubate the NC membrane with the corresponding species secondary antibody diluted in Blocking Buffer at room temperature in the dark for 30 min, then wash the membrane with 1×PBST in the dark for 15 min, changing the PBST every 5 min. Photograph the NC membrane using an Odyssey imaging scanner and store the images. Measure the expression and secretion of cardiac function indicators ANP, BNP, and β-MHC.

[0087] The results showed that in the RNAi-NC group, the proteins of cardiac function markers ANP, BNP, and β-MHC were significantly upregulated after ISO induction, indicating abnormal cardiomyocyte function. However, after the expression of LOC107984012 was inhibited, i.e., in the RNAi-LOC107984012 group, the increase in the protein levels of cardiac function markers induced by ISO disappeared, indicating that specific interference with LOC107984012 expression can restore abnormal cardiac function. Figure 4 ).

[0088] Example 4:

[0089] 1. GM32255 gene knockout

[0090] Cas9 mRNA and gRNA were obtained through in vitro transcription. A homologous recombination vector (donor vector) containing a 3.0 kb 5' homologous arm, a 1.9 kb flux region, and a 3.0 kb 3' homologous arm was constructed using in-fusion cloning. Cas9 mRNA, gRNA, and the donor vector were microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. The sequences of the gRNA were as follows:

[0091] CCCCGCGTATCTCACCAATTCGG(SEQ ID NO:12);

[0092] AAGGAGAATGTATTGCCAATTGG (SEQ ID NO: 13).

[0093] The injected fertilized eggs were transferred into pseudopregnant mice, and the offspring were born approximately 20 days later, becoming the F0 generation mice. Genotyping was performed using PCR amplification and sequencing. Due to the rapid early cleavage rate of the fertilized eggs, the resulting F0 generation mice were chimeric. Through passaging, stably heritable F1 generation mice were obtained. Homozygous F1 mice were bred and mated with Myh6-Cre mice. After breeding and identification, wild-type GM32255 mice were obtained. flox / flox and knockout GM32255 CKO Mouse. The primer sequences for identification are:

[0094] Forward: GCCAAGTTTTCCACATGGGT (SEQ ID NO: 14);

[0095] Reverse: CACTATTCACGAACCGCGTG (SEQ ID NO: 15).

[0096] 2. Ligation of the left anterior descending branch of the heart

[0097] A left anterior descending coronary artery ligation model was used to induce heart failure in mice. Hair on the chest and abdomen of the mice was removed using Veet depilatory cream. Mice were anesthetized with isoflurane, and the thorax was opened at the fourth-fifth intercostal space on the left side to expose the heart. A vein running towards the apex was visible between the left atrial appendage and the conus arteriosus; the deep vein was the left anterior descending coronary artery. The vein was ligated with 6-0 sutures approximately 1 cm below the lower edge of the left atrial appendage. The thoracic cavity was then closed and sutured. After the mice regained consciousness, they were fed normally. Eight weeks after surgery, echocardiography was performed using mice anesthetized with isoflurane and hair on the chest and abdomen removed with depilatory cream. The echocardiographic results were recorded using a two-dimensional long-axis view generated by the MyLab high-resolution in vivo micro-imaging system and an SL3116 transducer. The main parameters measured included left ventricular ejection fraction (EF%), left ventricular fractional shortening (FS%), and ventricular wall undulation.

[0098] Echocardiography results showed that after ligation of the left anterior descending artery, the left ventricular ejection fraction (EF%) in wild-type mice was less than 50%, indicating decreased cardiac contractility and myocardial damage. In contrast, GM32255 knockout mice showed significantly increased EF% and FS%, reflecting improved cardiac ejection function. Furthermore, representative echocardiograms showed reduced ventricular diameter and enhanced ventricular wall pulsatility, indicating that GM32255 knockout has a protective effect on cardiac function. Figure 5 ).

[0099] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. The application of a reagent for detecting the expression level of LOC107984012 in biological samples in the preparation of diagnostic reagents or kits for heart failure, characterized in that, The long non-coding RNA is LOC107984012, and its cDNA sequence obtained by reverse transcription is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The reagent used to detect the expression level of LOC107984012 in biological samples is selected from probes, gene chips, or PCR primers that have specificity for detecting LOC107984012.

3. The application according to claim 1, characterized in that, The biological samples are selected from: fresh tissues or cells obtained from the subject, formalin-fixed or paraffin-embedded tissues or cells, blood or body fluids.

4. The application of reagents that inhibit or reduce the expression level of LOC107984012 in the preparation of drugs for treating heart failure; the reagents that inhibit or reduce the expression level of LOC107984012 include: siRNA 1, siRNA 2, and siRNA 3 have target sequences as shown in SEQ ID NO:3 to SEQ ID NO:5, respectively; the sense strand of siRNA 1 is shown in SEQ ID NO:6, and the antisense strand is shown in SEQ ID NO:7; the sense strand of siRNA 2 is shown in SEQ ID NO:8, and the antisense strand is shown in SEQ ID NO:9; the sense strand of siRNA 3 is shown in SEQ ID NO:10, and the antisense strand is shown in SEQ ID NO:11.

Citation Information

Patent Citations

  • Application of long-chain non-coding RNA in preparation of hepatocellular carcinoma diagnostic product or therapeutic drug

    CN112458168A

  • Application of Ckip-1 3' UTR in medicine for preventing and / or treating heart failure disease

    CN113559266A