Construction and application of c14 alpha hydroxylase cyp14 mutants
By performing site-directed saturation mutagenesis and combinatorial mutagenesis on the CLCYP14 enzyme, the I111L-M115K and I111L-V124W mutants were obtained, which solved the problem of insufficient hydroxylation specificity and conversion rate of the CLCYP14 enzyme in the catalysis of steroidal compounds, and achieved efficient catalysis of steroidal compounds.
Patent Information
- Application Number
- CN202310109698.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-13
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2043-02-13
AI Technical Summary
The existing steroid C14 hydroxylase CLCYP14 has problems with insufficient hydroxylation specificity and conversion rate when catalyzing steroid compounds, especially with poor selectivity and activity for C17 steroid substrates containing side chains.
By employing site-directed saturation mutagenesis and combined mutagenesis strategies, CLCYP14 mutants I111L-M115K and I111L-V124W were screened to improve their hydroxylation specificity and conversion rate to steroid substrates.
It significantly improved the hydroxylation selectivity and conversion rate of steroidal compounds SI, S-II, S-III, S-IV, SV and S-VI, thereby enhancing catalytic efficiency.
Smart Images

Figure CN116240184B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology and protein engineering, in particular to a steroid C14α-hydroxylase CLCYP14 mutant. BACKGROUND
[0002] Steroids are a class of drugs with a wide range of pharmacological and physiological activities, including anti-infection, anti-allergy, anti-virus and anti-shock pharmacological activities. Hydroxylation is one of the most important reactions in the functionalization of steroids, and is a key step in the synthesis of high-value-added steroid drugs. Among the many hydroxylation reactions of steroids, C14-hydroxylated steroid compounds have anticancer biological activity and special gonadotropin effect. C14α-hydroxylated steroids can also be used as key intermediates for simplifying the chemical synthesis of steroid drugs. For example, the 14α-hydroxy derivative of progesterone (PG), 14α-hydroxy-pregn-4-ene-3,20-dione (C14α-OH-PG), can be used as a precursor for the synthesis of progestin, a widely used veterinary contraceptive and anti-gonadotropin drug. The 14α-hydroxy derivative of androstenedione (4-AD), 14α-hydroxy-4-ene-3,17-dione (C14α-OH-AD), can be used as a key precursor for the synthesis of 14α-hydroxy-4-ene-3,6,17-trione, an anticancer drug. In addition, the 14α-hydroxy configuration can be converted to the C14β-configuration, which is the main structural form of steroid drugs in clinical use, and has a large market demand.
[0003] Given that C14-hydroxylated steroids have many excellent biological activities and are widely used in clinical practice, the efficient synthesis of C14-hydroxylated steroids has become a hot and difficult research topic. It is extremely challenging to introduce a hydroxyl group at this position using chemical methods, which is difficult to meet the requirements of industrial production in terms of technology and scale. Microbial transformation can achieve efficient and convenient one-step hydroxylation of steroids. Curvularia lunata is the main source of commercial strains for steroid C14α-hydroxylation. Among them, P450lun, a P450 enzyme from Curvularia lunata strain Curvularia lunata NRRL 2380 that catalyzes steroid C14-hydroxylation, is the first enzyme identified with steroid C14-hydroxylation function. When RSS is used as the substrate, P450lun can catalyze the production of 14α-OH-RSS, as well as 11β-OH-RSS, with poor selectivity.(Chen, J.; Tang, J. L.; Xi, Y. Y.; Dai, Z. B.; Bi, C. H.; Chen, X.; Fan, F. Y.; Zhang, X. L., Production of 14 alpha-hydroxysteroids by a recombinant Saccharomyces cerevisiae biocatalyst expressing of a fungal steroid 14 alpha-hydroxylation system. Appl Microbiol Biot 2019, 103(20), 8363-8374) Recently, the Guo Huiming research group at Nanjing University has discovered P450 enzymes (CYP11411 and CYP44476) that can catalyze the production of corresponding C14α-hydroxylated products of progesterone (PG) and 4-AD from plants (Calotropis gigantea) and toads (Bufo gargarizans), respectively. However, the heterologous expression activity of both in Saccharomyces cerevisiae is extremely poor, with substrate conversion rates less than 3.5%, and poor regioselectivity.(Zhao, Y.; Zhang, B.; Sun, Z. Q.; Zhang, H.; Wang, W.; Wang, Z. R.; Guo, Z. K.; Yu, S.; Tan, R. X.; Ge, H. M., Biocatalytic C14-Hydroxylation on Androstenedione Enabled Modular Synthesis of Cardiotonic Steroids. ACS Catal 2022, 9839-9845).At present, the substrates recognized by the identified steroid C14 hydroxylase are mainly C17 side chain-free steroids such as 4-AD, and C17 side chain-containing steroid substrates are important intermediates for synthesizing high-value-added steroid drugs, so finding a biological catalyst with wide substrate specificity, high stereoselectivity and regional selectivity, and excellent catalytic activity for steroid C14 hydroxylation will greatly promote the development process of synthesizing C14 hydroxylated steroid intermediates.
[0004] In the previous invention CN114196641, we cloned and identified a highly efficient steroid C14 hydroxylase CLCYP14, which can effectively catalyze the conversion of progesterone (PG) to C14a-PG and has better regional selectivity. In the present invention, in order to further improve the hydroxylation specificity and conversion rate of the C14 hydroxylase CLCYP14 to steroid substrates, we screened and obtained the CLCYP14 mutants I111L-M115K and I111L-V124W with high hydroxylation specificity by site-directed saturation mutagenesis technology and combinatorial mutation strategy. Using these two better mutants, a variety of C14 hydroxylated steroid products were synthesized, which has important application and commercial value for the research and development of new efficient and low-toxicity steroid compounds. SUMMARY
[0005] Although the regional selectivity of the steroid C14 hydroxylase CLCYP14 to progesterone (PG) has been improved, the hydroxylation specificity and conversion rate still need to be improved.
[0006] To achieve the above-mentioned purpose, the present application screens and obtains a CLCYP14 mutant with high hydroxylation specificity by site-directed saturation mutagenesis technology and combinatorial mutation strategy, the amino acid sequence of the CLCYP14 is shown as SEQ ID NO: 1, the CLCYP14 mutant is a derivative protein with high hydroxylation specificity to steroid compounds, which is obtained by substitution, replacement, deletion of several amino acids of the amino acid sequence shown as SEQ ID NO: 1.
[0007] Preferably, the mutation site of the CLCYP14 mutant is one or more of F107, P108, I111, T112, M115, R121, T123, V124, V213, F297, H301, T302, M305, P363, V364, S367, F368, T369, K489 and V490.
[0008] Preferably, the mutation site of the CLCYP14 mutant is mutated to alanine, tryptophan or lysine.
[0009] Preferably, the CLCYP14 mutant is I111A, V124A, I111L, M115K or V124W.
[0010] Preferably, the CLCYP14 mutant is double mutant I111L-M115K or I111L-V124W, the amino acid sequence of I111L-M115K is shown as SEQ ID NO: 2, and the amino acid sequence of I111L-V124W is shown as SEQ ID NO: 3.
[0011] The present application also provides a nucleic acid molecule encoding the CLCYP14 mutant.
[0012] The present application also provides an expression vector comprising the nucleic acid molecule encoding the CLCYP14 mutant.
[0013] The present application also provides an expression system comprising the expression vector. The expression system includes prokaryotes and eukaryotes, preferably the prokaryote is Escherichia coli, Pseudomonas or Mycobacterium, and preferably the eukaryote is yeast, Aspergillus oryzae, Aspergillus niger or other filamentous fungi, and more preferably the yeast is Saccharomyces cerevisiae.
[0014] The present application also provides a preparation method of the CLCYP14 double mutant, comprising the following steps:
[0015] 1) using plasmid PESC-CLCYP14 as a template and the following primers as PCR primers, performing polymerase chain reaction
[0016] I111X-For: GTCTTTTCCTGAAGCTNNKACTGAAGATATG
[0017] I111X-Rev: CATATCTTCAGTMNNAGCTTCAGGAAAAGAC;
[0018] 2) obtaining a plasmid fragment of the target site mutation, taking 2 μL of the PCR product to verify the band size by agarose gel electrophoresis, and performing DpnI enzyme digestion on the PCR product for 3 h, then purifying and recovering the product by a small amount of purification kit, and then performing E. coli transformation, picking the transformants respectively, and then extracting plasmids after culturing in a small amount of LB medium, and then obtaining the plasmid encoding I111L by sequencing;
[0019] 3) using the plasmid I111L in step 2) as a template and the following primers as PCR primers, performing polymerase chain reaction
[0020] M115X-For: CTATTACTGAAGATNNKGAAGTTAAGTAT
[0021] M115X-Rev: ATACTTAACTTCMNNATCTTCAGTAATAG, or
[0022] V124X-For: TATACAAGATTGACTNNKGAACATCATACT
[0023] V124X-Rev: AGTATGATGTTCMNNAGTCAATCTTGTAT;
[0024] 4) Obtain the target plasmid fragment of site-directed mutation, take 2 μL PCR product to verify the band size by agarose gel electrophoresis. After the PCR product is digested by DpnI for 3 h, the product is purified and recovered by a small amount of purification kit, and then the E. coli is transformed, and the transformants are picked and cultured in a small amount of LB medium to extract plasmids, and the plasmids encoding I111L-M115K or I111L-V124W are obtained by sequencing;
[0025] 5) Prepare the yeast Saccharomyces cerevisiae competent, add 2 μL of the expression plasmid obtained in step 4), and screen the positive clones by PCR;
[0026] The application also provides an application of the CLCYP14 mutant in catalyzing C14α-hydroxylated products of steroid compounds.
[0027] The method utilizes the I111L-M115K or I111L-V124W recombinant Saccharomyces cerevisiae engineering bacteria capable of expressing to catalyze C14α-hydroxylated products of substrate steroid compounds.
[0028] Preferably, the steroid compound is
[0029]
[0030] The steroid skeleton A / B / C / D ring has different oxidation degrees, the R1 is an alkyl group, a substituted alkyl group, a silicon group or an acyl group; and the R2 is an alkyl group, a carbonyl group or a hydroxyl group.
[0031] Preferably, the steroid compound is S-I (progesterone), S-II (21-hydroxyprogesterone), S-III (5β-hydroxyprogesterone), S-IV (1-dehydroprogesterone), S-V (21-hydroxypregna-1, 4-diene-3, 20-dione) and S-VI (deoxycortisone).
[0032] In the application, in order to further improve the hydroxylation specificity and conversion rate of the C14 hydroxylase CLCYP14 on the steroid substrate, the I111L-M115K and I111L-V124W CLCYP14 mutants with high hydroxylation specificity are screened by the site-directed saturation mutation technology and the combined mutation strategy. Compared with CLCYP14, the I111L-M115K and I111L-V124W have obvious improvement in the hydroxylation selectivity and conversion rate on the steroid compounds S-I, S-II, S-III, S-IV, S-V and S-VI.
[0033] The concept, specific structure and technical effects of the present application will be further described in combination with the drawings, so as to fully understand the purpose, features and effects of the present application. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 is the H spectrum of product S-II of Example 1 13 C spectrum;
[0035] Figure 2 is the H spectrum of product S-II of Example 1 1 C spectrum;
[0036] Figure 3 is the docking model of CLCYP14 and substrate S-II;
[0037] Figure 4 is the UPLC result chart of mutant F107A, P108A, I111A, T112A, M115A, R121A, T123A, V124A, V213A, F297A, H301A, T302A, M305A, P363A, V364A, S367A, F368A, T369A, K489A and V490A transforming substrate S-II (21-hydroxyprogesterone);
[0038] Figure 5 is the UPLC result chart of mutant I111X transforming substrate S-II (21-hydroxyprogesterone);
[0039] Figure 6 is the UPLC result chart of mutant M115X transforming substrate S-II (21-hydroxyprogesterone);
[0040] Figure 7 is the UPLC result chart of mutant V124X transforming substrate S-II (21-hydroxyprogesterone);
[0041] Figure 8 is the UPLC result chart of mutant I11L-M115X transforming substrate S-II (21-hydroxyprogesterone);
[0042] Figure 9 is the UPLC result chart of mutant I11L-V124X transforming substrate S-II (21-hydroxyprogesterone);
[0043] Figure 10 is the UPLC result chart of mutant transforming substrate S-I (progesterone);
[0044] Figure 11 is the UPLC result chart of mutant transforming substrate S-II (21-hydroxyprogesterone);
[0045] Figure 12 This is a UPLC result of the mutant strain transforming the substrate S-III (5β-hydroprogesterone);
[0046] Figure 13 This is a UPLC result of the mutant strain transforming the substrate S-IV (1-dehydroprogesterone);
[0047] Figure 14 This is a UPLC result of the mutant strain transforming the substrate SV (21-hydroxypregn-1,4-diene-3,20-dione).
[0048] Figure 15 This is a UPLC result of the mutant strain transforming the substrate S-VI (deoxycortisone);
[0049] Figure 16A It is the product 14α-OH-SI 1 H spectrum Figure 16B It is the product 14α-OH-SI 13 C spectrum, in which 1 HNMR(400MHz, CDCl3)δ5.73(s,1H),3.22(t,J=8.7Hz,1H),2.51–2.22(m,6H),2.12(s,3H),2.03(m,2H),1.90(td,J=11.4,1 1.0,3.3Hz,1H),1.82–1.71(m,5H),1.66(d,J=4.1Hz,1H),1.60–1.51(m,3H),1.51–1.39(m,1H),1.19(s,3H),0.78(s,3H);
[0050] 13 C NMR (101MHz, CDCl3) δ210.4,199.6,170.5,124.1,85.3,59.5,48.1,46.4,38.7,38.4,35.9,34.1,33.5,32.7,31.6,31.0,27.2,21.5,20.2,17.3;
[0051] Figure 17A It is product 14α-OH-S-II 1 H spectrum Figure 17B Product 14α-OH-S-II 13 C spectrum, in which 1HNMR (400 MHz, CDC13) δ 3.23 (t, J = 8.7 Hz, 1H), 2.73 (t, J = 14.3 Hz, 1H), 2.41 (td, J = 14.7, 5.4 Hz, 1H), 2.29 (dddd, J = 13.9, 11.1, 8.3, 2.8 Hz, 1H), 2.21 - 2.15 (m, 2H), 2.04 (m, 3H), 2.12 (s, 3H) 1.97 - 1.86 (m, 1H), 1.85 - 1.76 (m, 2H), 1.75 - 1.62 (m, 2H), 1.56 - 1.47 (m, 3H), 1.46 - 1.38 (m, 3H), 1.34 - 1.29 (m, 2H), 1.19 (s, 1H), 1.03 (s, 3H), 0.75 (s, 3H);
[0052] 13 C NMR (101 MHz, CDC13) δ 213.1, 210.5, 85.6, 59.8, 48.3, 44.3, 42.4, 38.4, 37.4, 37.2, 35.2, 33.6, 33.3, 31.6, 31.5, 26.4, 22.5, 21.5, 20.9, 20.5, 17.5;
[0053] Figure 18A is the product 14a-OH-S-III 1 H spectrum, Figure 18B is the product 14a-OH-S-III 13 C spectrum, wherein 1 HNMR (400 MHz, CDC13) δ 3.23 (t, J = 8.7 Hz, 1H), 2.73 (t, J = 14.3 Hz, 1H), 2.41 (td, J = 14.7, 5.4 Hz, 1H), 2.29 (dddd, J = 13.9, 11.1, 8.3, 2.8 Hz, 1H), 2.21 - 2.15 (m, 2H), 2.04 (m, 3H), 2.12 (s, 3H) 1.97 - 1.86 (m, 1H), 1.85 - 1.76 (m, 2H), 1.75 - 1.62 (m, 2H), 1.56 - 1.47 (m, 3H), 1.46 - 1.38 (m, 3H), 1.34 - 1.29 (m, 2H), 1.19 (s, 1H), 1.03 (s, 3H), 0.75 (s, 3H);
[0054] 13C NMR (101 MHz, CDC13) δ 213.1, 210.5, 85.6, 59.8, 48.3, 44.3, 42.4, 38.4, 37.4, 37.2, 35.2, 33.6, 33.3, 31.6, 31.5, 26.4, 22.5, 21.5, 20.9, 20.5, 17.5;
[0055] Figure 19A is the product 14a-OH-S-IV 1 H spectrum, Figure 19B is the product 14a-OH-S-IV 13 C spectrum, wherein 1 H NMR (400 MHz, CDC13) δ 7.05 (d, J = 10.1 Hz, 1H), 6.24 (dd, J = 10.2, 1.9 Hz, 1H), 6.08 (s, 1H), 3.21 (t, J = 8.6 Hz, 1H), 2.51 (tdd, J = 13.4, 5.1, 1.5 Hz, 1H), 2.41 (ddd, J = 13.3, 4.6, 2.6 Hz, 1H), 2.34 - 2.24 (m, 1H), 2.12 (s, 3H), 2.08 - 1.94 (m, 2H), 1.92 - 1.83 (m, 1H), 1.81 - 1.64 (m, 6H), 1.57 - 1.48 (m, 1H), 1.48 - 1.37 (m, 1H), 1.24 (s, 3H), 1.17 (s, 1H), 0.81 (s, 3H);
[0056] 13 C NMR (101 MHz, CDC13) δ 210.3, 186.5, 168.3, 155.7, 127.7, 124.2, 85.1, 59.4, 48.2, 45.5, 43.4, 38.4, 33.7, 32.6, 31.6, 31.1, 29.0, 22.1, 21.5, 18.5, 17.5;
[0057] Figure 20A is the product 14a-OH-S-V 1 H spectrum, Figure 20B is the product 14a-OH-S-V 13 C spectrum, wherein 1HNMR (400 MHz, CDC13) δ 7.04 (d, J = 10.1 Hz, 1H), 6.22 (dd, J = 10.1, 1.9 Hz, 1H), 6.06 (s, 1H), 4.17 (d, J = 1.3 Hz, 2H), 3.18 (t, J = 8.8 Hz, 1H), 2.51 (tdd, J = 13.5, 5.2, 1.6 Hz, 1H), 2.42 - 2.31 (m, 1H), 2.31 (dddd, J = 13.8, 11.1, 8.4, 2.7 Hz, 1H), 1.99 - 1.93 (m, 2H), 1.91 - 1.83 (m, 2H), 1.81 - 1.64 (m, 5H), 1.62 - 1.56 (m, 2H), 1.51 - 1.34 (m, 2H), 1.23 (s, 3H), 0.83 (s, 3H);
[0058] 13 C NMR (101 MHz, CDC13) δ 211.3, 186.5, 168.4, 155.8, 127.7, 124.1, 84.9, 69.5, 54.9, 48.9, 45.4, 43.4, 38.4, 33.8, 32.6, 30.8, 29.0, 22.0, 21.7, 18.5, 17.6;
[0059] Figure 21A is the product 14a-OH-S-VI 1 H spectrum, Figure 21B is the product 14a-OH-S-VI 13 C spectrum, wherein 1 HNMR (400 MHz, CDC13) δ 5.72 (s, 1H), 4.16 (d, J = 43.9 Hz, 2H), 3.38 (t, J = 9.0 Hz, 1H), 3.08 (d, J = 12.5 Hz, 1H), 2.84 (dt, J = 13.6, 4.3 Hz, 1H), 2.50 - 2.22 (m, 9H), 2.10 - 1.95 (m, 1H), 1.94 - 1.77 (m, 3H), 1.76 - 1.53 (m, 3H), 1.39 (s, 3H), 0.74 (s, 3H);
[0060] 13 C NMR (101 MHz, CDC13) δ 211.3, 186.5, 168.4, 155.8, 127.7, 124.1, 84.9, 69.5, 54.9, 48.9, 45.4, 43.4, 38.4, 33.8, 32.6, 30.8, 29.0, 22.0, 21.7, 18.5, 17.6; DETAILED DESCRIPTION
[0061] The technical content of the present application will become more apparent and easier to understand through the following description of the preferred embodiments of the present application with reference to the accompanying drawings. The present application can be embodied in many different forms and the scope of the present application is not limited to the embodiments mentioned herein.
[0062] Example 1, Synthesis of Steroidal Compound S-II (21-hydroxylated progesterone)
[0063]
[0064] The purchased compound 21-acetylcortisone (S1) (20.0 g, 51.5 mmol) was dissolved in a mixed solution of methanol MeOH (200 mL) and dichloromethane CH2Cl2(80 mL), K2CO3(8.5 g, 61.8 mmol) was dissolved in 40 mL of water and added to the above mixture. The reaction was stirred at room temperature overnight and monitored by TLC after completion of the reaction, the MeOH and CH2Cl2were removed by rotary evaporation, then the mixture was filtered and washed with 50 mL of H2O four times, and dried to obtain compound cortisone (S2) (17.6 g).
[0065] Under argon protection, anhydrous acetonitrile (CH3CN) was added to a flask containing S2 (5.0 g). The resulting mixture was stirred at -20 °C until the substrate was completely dissolved. Then trimethylsilyl iodide (11.6 g) was added dropwise to the above mixture, stirring was continued for 4 h, the progress of the reaction was monitored by TLC, and after the reaction was completed, saturated Na2S2O3solution (200 mL) was added to quench the reaction. Then the reaction mixture was diluted with ethyl acetate (250 mL) and washed with saturated NaCl solution (250 mL) three times. The organic phase was dried with anhydrous sodium sulfate, filtered and concentrated by rotary evaporation. The crude product was separated and purified by silica gel column (20:1 CH2Cl2:EtOAc) to obtain the target compound S-II (4.46 g). The nuclear magnetic identification results of the above target product S-II are as follows: 13 The C spectrum is shown in Figure 1 , 13 C NMR (101 MHz, CDCl3) δ 210.3, 199.6, 170.8, 124.1, 69.5, 59.1, 56.2, 53.7, 44.8, 38.7, 38.5, 35.8, 35.7, 34.0, 32.8, 32.0, 24.6, 23.1, 21.0, 17.5, 13.6; The H spectrum of S-II is shown in 1 The C spectrum is shown in Figure 2 , 1H NMR (400 MHz, CDC13) δ 5.94 (s, 1H), 4.18 (dd, J = 44.1, 4.6 Hz, 2H), 3.25 (s, 1H), 2.48 - 2.18 (m, 6H), 2.08 - 1.82 (m, 3H), 1.76 (ddt, J = 15.0, 9.5, 4.3 Hz, 3H), 1.58 (dtd, J = 22.2, 12.2, 11.0, 3.8 Hz, 2H), 1.49 - 1.22 (m, 4H), 1.18 (s, 3H), 1.12 - 0.90 (m, 2H), 0.68 (s, 3H);
[0066] Example 2: Analysis of key catalytic sites of CLCYP14
[0067] 1) Find the amino acids around the catalytic pocket of CLCYP14 by modeling and molecular docking
[0068] The three-dimensional model of the protein CLCYP14 was established through the website https: / / robetta.bakerlab.org / submit_action.php, and the interaction model of the protein and the substrate S-II was further established by molecular docking in DiscoveryStudio4.5, the related catalytic sites around the catalytic pocket were analyzed, and further, 19 related amino acid residues around the substrate binding pocket of CLCYP14 were predicted, i.e. F107, P108, I111, T112, M115, R121, T123, V124, V213, F297, H301, T302, M305, P363, V364, S367, F368, T369, K489 and V490. The schematic diagram of the catalytic pocket site of CLCYP14 is shown in Figure 3 .
[0069] 2) Mutate the 19 amino acids around the substrate pocket to alanine
[0070] The previously constructed plasmid PESC-CLCYP14 was used as a template, and the following primers were used as PCR primers to perform polymerase chain reaction, and the primers were synthesized by Beijing Qikexin Biotechnology Co., Ltd. Shanghai Branch.
[0071] F107A-For: GATAATATTTTGTCTGCTCCTGAAGCTATT
[0072] F107A-Rev: AATAGCTTCAGGAGCAGACAAAATATTATC
[0073] P108A-For: AATATTTTGTCTTTTGCTGAAGCTATTACTG
[0074] P108A-Rev: CAGTAATAGCTTCAGCAAAAGACAAAATATT
[0075] I111A-For: GTCTTTTCCTGAAGCTGCTACTGAAGATATG
[0076] I111A-Rev: CATATCTTCAGTAGCAGCTTCAGGAAAAGAC
[0077] R121A-For: GAAGTTAAGTATACAGCTTTGACTGTTGAAC
[0078] R121A-Rev: GTTCAACAGTCAAAGCTGTATACTTAACTTC
[0079] M115A-For: CTATTACTGAAGATGCTGAAGTTAAGTAT
[0080] M115A-Rev: ATACTTAACTTCAGCATCTTCAGTAATAG
[0081] S123A-For: TAAGTATACAAGATTGGCTGTTGAACATCAT
[0082] S123A-Rev: ATGATGTTCAACAGCCAATCTTGTATACTT
[0083] V124A-For: TATACAAGATTGACTGCTGAACATCATACT
[0084] V124A-Rev: AGTATGATGTTCAACAGTCAATCTTGTAT
[0085] V213A-For: GTTGATTTGATGAATGCTGCTACTGCTATG
[0086] V213A-Rev: CATAGCAGTAGCAGCATTCATCAAATCAAC
[0087] F297A-For: CAATTGTCTTTGATCGCTGCTGCAATTCAT
[0088] F297A-Rev: ATGAATTGCAGCAGCGATCAAAGACAATTG
[0089] H301A-For: CTTCGCTGCAATTGCTACTACTTCTATGAC
[0090] H301A-Rev: GTCATAGAAGTAGTAGCAATTGCAGCGAAG
[0091] T302A-For: CTTCGCTGCAATTCATGCTACTTCTATGAC
[0092] T302A-Rev: GTCATAGAAGTAGCATGAATTGCAGCGAAG
[0093] M305A-For: CATACTACTTCTGCTACTGTTACTAATATT
[0094] M305A-Rev: AATATTAGTAACAGTAGCAGAAGTAGTATG
[0095] P363A-For: AGATTTTATGGTGCTGTTATGACTTCTTTTAC
[0096] P363A-Rev: GTAAAAGAAGTCATAACAGCACCATAAAATC
[0097] T364A-For: AGATTTTATGGTCCTGCTATGACTTCTTTTAC
[0098] T364A-Rev: GTAAAAGAAGTCATAGCAGGACCATAAAATCT
[0099] S367A-For: GGTCCTGTTATGACTGCTTTTACTAGAAGAGC
[0100] S367A-Rev: GCTCTTCTAGTAAAAGCAGTCATAACAGGACC
[0101] F368A-For: GGTCCTGTTATGACTTCTGCTACTAGAAGAGC
[0102] F368A-Rev: GCTCTTCTAGTAGCAGAAGTCATAACAGGACC
[0103] T369A-For: ATGACTTCTTTTGCTAGAAGAGCTTTG
[0104] T369A-Rev: CAAAGCTCTTCTAGCAAAAGAAGTCAT
[0105] K489A-For: TTGAAATTGGTGCTGTTTCTATGCCTGATC
[0106] K489A-Rev: GATCAGGCATAGAAACAGCACCAATTTCAA
[0107] V490A-For: TTGAAATTGGTAAAGCTTCTATGCCTGATCC
[0108] V490A-Rev: GGATCAGGCATAGAAGCTTTACCAATTTCAA
[0109] The target plasmid fragment of site-directed mutation was obtained, and 2 μL of the PCR product was subjected to agarose gel electrophoresis to verify the band size. After the PCR product was digested with Dpn I for 3 h, the product was purified and recovered by a small amount of purification kit, and then the E. coli was transformed. The transformants were picked and cultured in a small amount of LB medium, and then the plasmid was extracted and sent to Shanghai Qianke Biological Technology Co., Ltd. for sequencing identification. Further, the mutant expression plasmid was named F107A, P108A, I111A, T112A, M115A, R121A, T123A, V124A, V213A, F297A, H301A, T302A, M305A, P363A, V364A, S367A, F368A, T369A, K489A and V490A.
[0110] Example 3: Construction of Saccharomyces cerevisiae recombinant engineering bacteria and catalytic analysis
[0111] 1) Preparation of Saccharomyces cerevisiae YPH499 competence
[0112] Saccharomyces cerevisiae YPH499 was cultured in YPD liquid medium at 30°C overnight. (The formula of YPD liquid medium: 1% yeast extract, 2% peptone, 2% glucose). 1 mL of the above-mentioned bacterial solution was inoculated into 10 mL of fresh YPD medium, and cultured at 30°C, 220 rpm for 3-4 h. Under sterile conditions, centrifuged at 1500 rpm for 5 min, after discarding the supernatant, resuspended with 10 mL of solution 1 solution in Frozen-EA Yeast Transformation II™ Kit, centrifuged at 1500 rpm for 5 min, after discarding the supernatant, resuspended with 1 mL of solution 2 (OD about 0.6-1.0) and divided into 1.5 ml EP tubes, 30 μl per tube, frozen at -80°C for standby.
[0113] 2) Transformation of expression plasmid
[0114] The above-mentioned competent cells were added with 2 μL of expression plasmids F107A, P108A, I111A, T112A, M115A, R121A, T123A, V124A, V213A, F297A, H301A, T302A, M305A, P363A, V364A, S367A, F368A, T369A, K489A and V490A obtained in Example 2, respectively, and 300 μL of solution solution 3 in the kit (Frozen-EA Yeast Transformation II™ Kit) was added at the same time, mixed, incubated at 30°C for 40 min, and then coated on a solid plate of screening medium SD-Ura (Beijing Geneno Technology Co., Ltd.) (formula: solid yeast screening medium SD-Ura, 2% glucose, 1.5% agar, all in g / 100 mL), and cultured at 30°C for 36 h or more, and single colonies were picked from the above-mentioned screening plate and inoculated into 5 mL of liquid screening medium, and the liquid screening medium was composed of (yeast screening medium SD-Ura, 2% glucose), and cultured at 30°C for 36 h or more, and the correct positive clones were identified by PCR, and the mutant Saccharomyces cerevisiae engineering bacteria were obtained.
[0115] 3) Saccharomyces cerevisiae engineering bacteria catalyze the synthesis of C14α-OH-S-II from substrate S-II
[0116] Specifically divided into the following 3 steps:
[0117] Seed liquid culture: the above-mentioned Saccharomyces cerevisiae engineering bacteria were inoculated in the corresponding liquid selective medium SD-Ura to prepare seed liquid (30°C, 250 rpm, 16h), and were transferred to 50 mL centrifuge tubes containing 10 mL SD-Ura liquid medium at an inoculation amount of 1%, and were cultured at 30°C, 250 rpm, and then were centrifuged at 1000 rpm for 5 min to discard the culture medium when the OD value reached 1.0.
[0118] Induced culture: 10 mL of SG-Ura liquid medium (yeast screening medium SD-Ura, 2% galactose) was added to the above-mentioned collected yeast cells, which were cultured at 30°C, 250 rpm for 18h, and were centrifuged at 1000 rpm for 5 min to discard the culture medium, and the yeast cells were collected.
[0119] Biological transformation: the above-mentioned collected yeast cells were resuspended with 1 mL of PBS buffer (50 mM, pH 7.2), and were respectively divided into 2 mL EP tubes, 200 uL per tube, and were added with S-II at a final concentration of 100 mg / L, and were subjected to catalytic reaction at 30°C, 250 rpm.
[0120] Sample treatment and UPLC detection: an equal volume of methanol was added to the above-mentioned reaction system, the cells were broken, the reaction was quenched, the supernatant was centrifuged and passed through a 0.22 pm organic filter membrane into a liquid phase bottle for UPLC detection. By UPLC identification and comparison with the standard, as shown in Table 1, the biological transformation results of 19 mutants showed that 3 mutants significantly changed the region specificity of CLCYP14, in which I111A and V124A increased the C14 hydroxylation specificity from 73.4% (hydroxylation specificity of CLCYP) to 84.7% and 80.1%, respectively, and M115A significantly reduced the C14 hydroxylation specificity of CLCYP14. Figure 4
[0121] Example 4: Saturation mutation of key catalytic sites M115, I111 and V124
[0122] 1) Mutant strain construction
[0123] Using plasmid prophase PESC-CLCYP14 as a template, polymerase chain reaction was performed with the following primers as PCR primers, which were synthesized by Beijing Chengke Biological Technology Co., Ltd. Shanghai Branch
[0124] M115X-For: CTATTACTGAAGATNNKGAAGTTAAGTAT
[0125] M115X-Rev: ATACTTAACTTCMNNATCTTCAGTAATAG
[0126] I111X-For: GTCTTTTCCTGAAGCTNNKACTGAAGATATG
[0127] I111X-Rev: CATATCTTCAGTMNNAGCTTCAGGAAAAGAC
[0128] V124X-For: TATACAAGATTGACTNNKGAACATCATACT
[0129] V124X-Rev: AGTATGATGTTCMNNAGTCAATCTTGTAT
[0130] The target plasmid fragment of site-directed mutation was obtained, and 2 μL of the PCR product was verified by agarose gel electrophoresis. After digestion with Dpn I for 3 h, the product was purified and recovered by a small amount of purification kit, and then transformed into E. coli. The transformants were picked and cultured in a small amount of LB medium, and then the plasmid was extracted and sent to Shanghai Qianke Biological Technology Co., Ltd. for sequencing identification. Further, the mutated proteins were named as I111A, I111C, I111D, I111E, I111F, I111G, I111H, I111K, I111L, I111M, I111N, I111P, I111Q, I111R, I111S, I111T, I111V, I111W, I111Y, V124A, V124C, V124D, V124E, V124F, V124G, V124H, V124I, V124K, V124L, V124M, V124N, V124P, V124Q, V124R, V124S, V124T, V124V, V124W, V124Y, M115A, M115C, M115D, M115E, M115F, M115G, M115H, M115I, M115K, M115L, M115N, M115P, M115Q, M115R, M115S, M115T, M115V, M115W, M115Y
[0131] 2) Transformation of expression plasmid
[0132] The competent cells of S. cerevisiae prepared in Example 2 were taken, 2 μL of the obtained expression plasmid was added, and 300 μL of solution 3 in the kit (Frozen-EA Yeast Transformation II™ Kit) was added at the same time, mixed, incubated at 30°C for 40 min, and then coated on the selection medium SD-Ura plate. The correct positive clones were identified by PCR.
[0133] 3) Recombinant S. cerevisiae engineered strain catalyzed synthesis of C14-hydroxylated product from substrate S-II
[0134] According to the method described in Example 2, the recombinant S. cerevisiae engineered strain was used to transform substrate S-II. As shown in Table 1, UPLC detection analysis showed that the C14-hydroxylation specificity of the mutant strains I111L (90.7%), M115K (88.2%) and V124W (91.4%) was significantly improved compared with wild-type CLCYP14 (73.4%) and the C14-hydroxylation specificity of I111A (84.7%) and V124A (80.1%). Figure 5 Figure 6 and Figure 7 As shown in Table 1, UPLC detection analysis showed that the C14-hydroxylation specificity of the mutant strains I111L (90.7%), M115K (88.2%) and V124W (91.4%) was significantly improved compared with wild-type CLCYP14 (73.4%) and the C14-hydroxylation specificity of I111A (84.7%) and V124A (80.1%).
[0135] Example 5: Combination mutations of I111L-M115X and I111L-V124X
[0136] 1) Construction of expression plasmids I111L-M115X and I111L-V124X
[0137] Using plasmid I111L in Example 4 as a template, polymerase chain reaction was performed with the following primers as PCR primers, respectively, and the primers were synthesized by Beijing Genki Biotechnology Co., Ltd. Shanghai Branch
[0138] M115X-For: CTATTACTGAAGATNNKGAAGTTAAGTAT
[0139] M115X-Rev: ATACTTAACTTCMNNATCTTCAGTAATAG
[0140] V124X-For: TATACAAGATTGACTNNKGAACATCATACT
[0141] V124X-Rev: AGTATGATGTTCMNNAGTCAATCTTGTAT
[0142] The target plasmid fragment of site-directed mutation was obtained, and 2 μL of the PCR product was subjected to agarose gel electrophoresis to verify the band size. After the PCR product was digested with Dpn I for 3 h, the product was purified and recovered by a small amount of purification kit, and then transformed into E. coli. The transformants were picked and cultured in a small amount of LB medium, and then the plasmid was extracted and sent to Shanghai Genesee Biotechnology Co., Ltd. for sequencing identification. Further, the mutant plasmids were named as I111L-V124A, I111L-V124C, I111L-V124D, I111L-V124E, I111L-V124F, I111L-V124G, I111L-V124H, I111L-V124I, I111L-V124K, I111L-V124L, I111L-V124M, I111L-V124N, I111L-V124P, I111L-V124Q, I111L-V124R, I111L-V124S, I111L-V124T, I111L-V124V, I111L-V124W, I111L-V124Y, I111L-M115A, I111L-M115C, I111L-M115D, I111L-M115E, I111L-M115F, I111L-M115G, I111L-M115H, I111L-M115I, I111L-M115K, I111L-M115L, I111L-M115N, I111L-M115P, I111L-M115Q, I111L-M115R, I111L-M115S, I111L-M115T, I111L-M115V, I111L-M115W, I111L-M115Y
[0143] 2) Transformation of expression plasmid
[0144] The competent cells of S. cerevisiae prepared in Example 1 were taken, 2 μL of the above obtained expression plasmid was added, and 300 μL of solution 3 in the kit (Frozen-EA Yeast Transformation II™ Kit) was added at the same time, mixed, incubated at 30 °C for 40 min, and then coated on the selection medium SD-Ura. The correct positive clones were identified by PCR.
[0145] 3) Synthesis of C14α-hydroxylated product by recombinant S. cerevisiae engineering bacteria catalyzing substrate S-II
[0146] According to the method described in Example 2, the recombinant S. cerevisiae engineering bacteria was used to catalyze the substrate S-II to synthesize the C14α-hydroxylated product, such as Figure 8 and Figure 9As shown in Table 2, UPLC detection analysis showed that the C14 hydroxylation selectivity of mutant I111L-M115K and I111L-V124W to substrate S-II was increased to 92.6% and 94.4%, respectively.
[0147] Example 6, Transformation of different steroid compounds by CLCYP14 and its mutants
[0148] According to the method described in Example 2, the Saccharomyces cerevisiae engineering bacteria containing CLCYP14, I111A, M115K, V124A, I111L-M115K and I111L-V124W were inoculated into 50 mL centrifuge tubes containing 15 mL of SD-Ura liquid medium, respectively, and cultured at 30°C with 250 rpm shaking. When the OD value reached 1.0, the culture was centrifuged at 1000 rpm for 5 min and the medium was discarded. The collected yeast cells were added with 15 mL of SG-Ura liquid medium and cultured at 30°C with 250 rpm shaking for 18 h. The culture was centrifuged at 1000 rpm for 5 min and the medium was discarded. The collected yeast cells were resuspended with 1.2 mL of PBS buffer (50 mM, pH 7.2), and each was divided into 2 mL EP tubes, 200 uL per tube. S-I, S-II, S-III, S-IV, S-V and S-VI were added at a final concentration of 100 mg / L, respectively, and the catalytic reaction was carried out at 30°C with 250 rpm shaking.
[0149] An equal volume of methanol was added to the above reaction system, the cells were broken and the reaction was quenched. The supernatant was centrifuged and passed through a 0.22 μm organic filter membrane into a liquid phase bottle for UPLC detection. As shown in Table 2, the C14 hydroxylation selectivity of mutant I111L-M115K and I111L-V124W to substrate S-I was increased to 87.1% and 92.2%, respectively, and the conversion rate was increased to 62.3% and 75.3%, respectively. Figure 10 As shown in Table 2, the C14 hydroxylation selectivity of mutant I111L-M115K and I111L-V124W to substrate S-II was increased to 92.6% and 94.4%, respectively, and the conversion rate was increased to 71.4% and 72.5%, respectively. Figure 11 As shown in Table 2, the C14 hydroxylation selectivity of mutant I111L-M115K and I111L-V124W to substrate S-II was increased to 92.6% and 94.4%, respectively, and the conversion rate was increased to 71.4% and 72.5%, respectively. Figure 12 As shown in Table 2, the C14 hydroxylation selectivity of mutant I111L-V124W to substrate S-III was increased to 90.2%, and the conversion rate was increased to 71.7%. Figure 13 As shown in Table 2, the C14 hydroxylation selectivity of mutant I111L-M115K and I111L-V124W to substrate S-IV was increased to 91.8% and 86.3%, respectively, and the conversion rate was increased to 75.5% and 72.4%, respectively. Figure 14As shown, the mutant I111L-V124W increased the C14 hydroxylation selectivity of the substrate S-V to 90.3% and the conversion rate to 77.8%. As shown in Fig. 16, the mutant I111L-M115K increased the C14 hydroxylation selectivity of the substrate S-I to 93.2% and the conversion rate to 76.7%. Figure 15 As shown, the mutants I111L-M115K and I111L-V124W increased the C14 hydroxylation selectivity of the substrate S-I to 93.2% and 94.5% and the conversion rate to 76.7% and 78.3%. They showed better effects than the wild strain CLCYP14 and the previous mutants I111A and V124A.
[0150]
[0151] The products after the catalytic reaction of S-I, S-II, S-III, S-IV, S-V, S-VI were detected by nuclear magnetic resonance (NMR), and the results are shown in Figs. 17-21. The results show that the mutants I111L-M115K and I111L-V124W successfully achieved C14 alpha hydroxylation of the substrates S-I, S-II, S-III, S-IV, S-V, S-VI.
[0152] The above describes preferred embodiments of the present application in detail. It should be understood that those skilled in the art can make many modifications and changes without creative labor based on the concept of the present application. Therefore, any technical solution obtained by logical analysis, reasoning or limited experiment based on the existing technology according to the concept of the present application should be within the protection scope defined by the claims.
Claims
1. Use of a CLCYP14 double mutant in catalyzing the synthesis of a steroid compound to produce the corresponding 14α-hydroxylated product, characterized in that, The CLCYP14 double mutant is mutant I111L-M115K or mutant I111L-V124W, the amino acid sequence of the mutant I111L-M115K is shown as SEQ ID NO: 2, and the amino acid sequence of the mutant I111L-V124W is shown as SEQ ID NO: 3; the mutant I111L-M115K catalyzes steroid compounds S-I, S-II, S-IV or S-VI, and the mutant I111L-V124W catalyzes steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI; the structural formula of the steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI is as follows: 。 2. Use of a nucleic acid molecule encoding a CLCYP14 double mutant for catalyzing the synthesis of a steroid compound to produce the corresponding 14α-hydroxylated product, characterized in that, The CLCYP14 double mutant is mutant I111L-M115K or mutant I111L-V124W, the amino acid sequence of the mutant I111L-M115K is shown as SEQ ID NO: 2, and the amino acid sequence of the mutant I111L-V124W is shown as SEQ ID NO: 3; the mutant I111L-M115K catalyzes steroid compounds S-I, S-II, S-IV or S-VI, and the mutant I111L-V124W catalyzes steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI; the structural formula of the steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI is as follows: 。 3. Use of an expression vector containing a nucleic acid molecule encoding a CLCYP14 double mutant for catalyzing the synthesis of a steroid compound to produce the corresponding 14α-hydroxylated product, characterized in that, The CLCYP14 double mutant is mutant I111L-M115K or mutant I111L-V124W, the amino acid sequence of the mutant I111L-M115K is shown as SEQ ID NO: 2, and the amino acid sequence of the mutant I111L-V124W is shown as SEQ ID NO: 3; the mutant I111L-M115K catalyzes steroid compounds S-I, S-II, S-IV or S-VI, and the mutant I111L-V124W catalyzes steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI; the structural formula of the steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI is as follows: 。 4. The use of a recombinant engineering strain of Saccharomyces cerevisiae containing a nucleic acid molecule encoding a CLCYP14 double mutant for catalyzing the synthesis of a steroid compound to produce the corresponding 14α-hydroxylated product, characterized in that, The CLCYP14 double mutant is mutant I111L-M115K or mutant I111L-V124W, the amino acid sequence of the mutant I111L-M115K is shown as SEQ ID NO: 2, and the amino acid sequence of the mutant I111L-V124W is shown as SEQ ID NO: 3; the mutant I111L-M115K catalyzes steroid compounds S-I, S-II, S-IV or S-VI, and the mutant I111L-V124W catalyzes steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI; the structural formula of the steroid compounds S-I, S-II, S-III, S-IV, S-V or S-VI is as follows: 。
Citation Information
Patent Citations
Steroid C14 alpha hydroxylase, expression vector, engineering bacterium and application of steroid C14 alpha hydroxylase
CN114196641A