Molecular marker associated with growth traits in sheep, detection method and application thereof

By analyzing the polymorphism of the sheep MKI67 gene, a molecular marker detection method was designed to solve the problem of unclear genetic mechanisms of sheep growth traits, enabling rapid identification and screening of fast-growing sheep, thereby improving breeding efficiency and economic benefits.

CN116254348BActive Publication Date: 2026-04-28GANSU RUNMU BIOLOGICAL ENG CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211104342.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-09
Publication Date
2026-04-28
Estimated Expiration
2042-09-09

AI Technical Summary

Technical Problem

The genetic mechanisms of sheep growth traits are poorly understood in current technologies, and there is a lack of effective molecular markers for selection and breeding, resulting in high production costs and low efficiency.

Method used

By sequencing the sheep MKI67 gene, a C/T polymorphism at position 163bp was discovered. PCR primer pairs and KASPar primer pairs were designed to establish a molecular marker detection method. The sheep that rapidly gain weight were identified by direct sequencing, probe method, gene chip method, or high-resolution melting curve method.

Benefits of technology

This study provides a simple, accurate, and low-cost molecular marker detection method that can effectively identify fast-growing sheep, improve breeding efficiency, reduce production costs, and enhance the economic benefits of sheep farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003840875020000051
    Figure BDA0003840875020000051
  • Figure BDA0003840875020000081
    Figure BDA0003840875020000081
  • Figure BDA0003840875020000091
    Figure BDA0003840875020000091
Patent Text Reader

Abstract

The application provides a molecular marker related to sheep growth traits, a detection method and application thereof. The application finds that a C / T polymorphic site exists in an amplified fragment of a sheep MKI67 gene through PCR amplification and sequence analysis of the sheep MKI67 gene, further detects the polymorphic site of 935 Hu sheep using KASPar primers, establishes a least square model, and performs correlation analysis on genotypes and growth traits, and finally determines that the amplified MKI67 gene fragment can be used as a molecular marker related to sheep growth traits. The application is used for selecting and retaining sheep with TT homozygous genes as breeding sheep for breeding, so as to improve the growth traits of sheep and help improve the economic benefits of the production and breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the technical field of molecular markers, specifically relating to the MKI67 gene fragment as a molecular marker affecting sheep growth traits, detection methods, and applications. Background Technology

[0002] Sheep are one of the most familiar domesticated animals, with a history of domestication spanning over 5,000 years. Every part of the sheep is valuable, and they play a unique role in healthcare, possessing high medicinal value. Sheep are an important source of meat, dairy products, and wool, playing a crucial role in the global agricultural economy. Body weight and conformation are key characteristics of the sheep industry (Tao L, XYHe, Pan LX, et al. Genome-wide association study of body weight and conformation traits in neonatal sheep[J]. Animal Genetics, 2020). In sheep production practices, selecting sheep with good growth traits is crucial; good growth and rapid weight gain can significantly reduce production costs. However, past research has yielded limited understanding of the underlying genetic mechanisms underlying sheep body weight and conformation.

[0003] MKI67 (Ki-67, a proliferation marker gene) is a protein-coding gene, and the expression of human Ki-67 protein is closely related to cell proliferation (Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown. [J]. Journal of Cellular Physiology, 2000, 182.). Obesity is associated with many diseases, including endometrial diseases in postmenopausal women, such as adenocarcinoma, hyperplasia, and endometrial polyps, as well as the risk of malignant transformation of these structures. Glandular expression of MKI67 is higher in obese women than in women of normal weight (Giordano M, Lucas H, R Fiorelli, et al. Expression levels of BCL2 and MKI67 in endometrial polyps in postmenopausal women and their correlation with obesity [J]. Molecular and Clinical Oncology, 2020, 13(6):1-1.). The MKI67 gene is associated with cell proliferation through ribosome synthesis of ribonucleic acid. The MKI67 antigen is present in active phases of the cell cycle (G1, S, G2, and mitosis) but absent in another phase (G0). The expression of the proliferative marker of endometrial polyps (MKI67) in postmenopausal women was studied and linked to obesity (Giordano M, Lucas H, R Fiorelli, et al. Expression levels of BCL2 and MKI67 in endometrial polyps in postmenopausal women and their correlation with obesity[J]. Molecular and Clinical Oncology, 2020, 13(6):1-1.). The MKI67 gene has been reported to affect meat quality traits, particularly tenderness (Abo-Ismail MK, Lansink N, Akano E, et al. Development and validation of a small SNP panel for feed efficiency in beef cattle[J]. Journal of Animal Science, 2018.). However, it is unclear whether MKI67 is associated with growth traits in sheep, or what kind of association exists between them.

[0004] This invention explores the association between different genotypes of the MKI67 gene and sheep growth traits by sequencing and analyzing the gene, aiming to provide genetic material for improving the genetic traits of sheep growth and accelerate the breeding process of high-quality meat sheep with independent intellectual property rights. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, this invention provides a molecular marker, detection method, and application related to sheep growth traits. The molecular marker of this invention is amplified from the sheep MKI67 gene, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying and sequencing the DNA sequence of the sheep MKI67 gene, polymorphic sites in the MKI67 gene are identified, the correlation between different genotypes and sheep growth traits is analyzed, and a detection method for the molecular marker containing polymorphic sites is established. This molecular marker can be applied to the breeding of new, high-quality meat sheep breeds.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A molecular marker associated with sheep growth traits, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the Y at position 163 bp represents C or T. Due to a C / T mutation at position 163 of the above sequence, a C / T polymorphism in the sheep MKI67 gene at this site is obtained.

[0008] A PCR primer pair for detecting the above-mentioned molecular marker, preferably comprising a forward primer MF and a reverse primer MR, wherein the nucleotide sequences of the forward primer MF and the reverse primer MR are as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0009] A KASPar primer pair for detecting the above-mentioned molecular markers includes a forward primer A1 for detecting AlleleC, a forward primer A2 for detecting AlleleT, and a reverse universal primer C. The nucleotide sequence of the forward primer A1 is shown in SEQ ID NO.4, the forward primer A2 is shown in SEQ ID NO.5, and the reverse universal primer C is shown in SEQ ID NO.6.

[0010] A kit for detecting the above-mentioned molecular marker, the kit comprising PCR primer pairs or KASPar primer pairs for detecting the above-mentioned molecular marker.

[0011] A method for detecting molecular markers associated with sheep growth traits, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the Y at position 163 bp represents C or T, the method comprising detecting sheep genomic DNA using the above-described PCR primer pairs, KASPar primer pairs, or a kit, and the specific detection method comprising the following steps:

[0012] a) Amplify sheep genomic DNA using the PCR primer pairs, KASPar primer pairs, or kits containing the primer pairs described above;

[0013] b) Identify the polymorphic sites in the amplification products obtained in step a).

[0014] In step b), the above-mentioned typing identification method is direct sequencing, probe method, gene chip method or high-resolution melting curve method.

[0015] The method for detecting molecular markers related to sheep growth traits using the above primer pairs includes the following steps:

[0016] a) Genomic DNA was extracted from sheep blood samples and amplified by high-throughput water bath PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0017] b) After amplification, fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstar instrument.

[0018] The application of the detection methods of molecular markers, primer pairs or kits described above in the detection of growth traits in sheep can determine the level of growth traits by detecting the molecular markers of the present invention in the genomic DNA of the sheep to be tested and analyzing the types of polymorphic sites, thereby screening out sheep with rapid weight gain.

[0019] The application of the detection methods described above, such as molecular markers, PCR primer pairs, KASPar primer pairs, or kits, in sheep breeding involves amplifying and detecting the genomic DNA of sheep using the aforementioned primer pairs or kits to determine the genotype of the MKI67 gene in the sample to be tested, thereby enabling the selection of sheep breeds that grow rapidly.

[0020] Finding gene variation sites and analyzing their association with traits to discover the relationship between genes and traits is an important method for studying gene function and a basis for marker-assisted selection.

[0021] This invention, through PCR amplification and sequencing of the MKI67 gene of the representative sheep breed, Hu sheep, discovered a C / T polymorphism site at position 163 of the amplified fragment. By detecting polymorphism in 935 sheep and establishing a least-squares model, a molecular marker associated with sheep growth traits was identified. This molecular marker can be used for the breeding of new high-quality meat sheep breeds, providing an effective genetic engineering method for the genetic improvement of sheep growth traits, and has significant practical application value.

[0022] This invention detects the aforementioned molecular markers by designing KASPar primers required for competitive allele-specific PCR (KASP). This detection method does not require the synthesis of specific fluorescent probes for each SNP site. Instead, it is based on its unique ARM PCR principle, allowing all site detections to ultimately use universal fluorescent primers for amplification. This significantly reduces reagent costs and provides high accuracy, offering a simple, accurate, and low-cost method for detecting the molecular markers of this invention.

[0023] The beneficial effects of this invention are as follows:

[0024] This invention provides a molecular marker associated with sheep growth traits, specifically the C / T polymorphism at position 163 of the fragment in SEQ ID NO.1. By determining the genotype of this polymorphism, it is possible to effectively identify whether a sheep is a fast-growing breed, providing an effective detection method for breeding fast-growing sheep. Through the detection of this molecular marker and the site leading to the polymorphism, this invention can be used to select sheep with homozygous TT genes as breeding stock to improve sheep growth traits and thus contribute to increasing the economic benefits of sheep farming. Attached Figure Description

[0025] Figure 1 This is a gel electrophoresis image of the sheep MKI67 gene fragment used as a molecular marker in this invention.

[0026] Figure 2 The sequencing results are for the sheep MKI67 gene mutation site in this invention.

[0027] Figure 3 This is the KASPar SNP typing result of the sheep MKI67 gene mutation site in this invention. Detailed Implementation

[0028] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0029] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.

[0030] Example 1: Amplification of the MKI67 gene

[0031] Using sheep MKI67 gene DNA (GenBank accession number: NC_040252.1) as a template, a pair of primers was designed using Oligo 7.0 software: forward primer MF and reverse primer MR. The primer sequences are as follows:

[0032] MF is as shown in SEQ ID NO.2: 5'-CTCTGTAGGAGCAAATTGACA-3'

[0033] MR is as shown in SEQ ID NO.3: 5'-CACAGACTTCTTTTCGCTT-3'

[0034] (2) Amplification and sequencing of the MKI67 gene

[0035] Genomic DNA extracted from sheep blood was used as a DNA template for PCR amplification. The total reaction volume was 25 μL, including 12.4 μL of 2×PCR Master Mix, 0.8 μL of forward primer MF (concentration of 10 μmol / L), 0.8 μL of reverse primer MR (concentration of 10 μmol / L), 1 μL of DNA template, and 10 μL of ddH2O.

[0036] PCR amplification reaction conditions: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, annealing temperature (see Table 1) for 30 s, 72℃ extension for 30 s, 35 cycles, and a final extension at 72℃ for 10 min.

[0037] Table 1 Primer Information

[0038]

[0039] The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M represents the DL 2000 Marker, and lanes 1-10 represent the results of MKI67 gene amplification. The results showed a 307bp specific amplified fragment. Sequencing of the amplified PCR fragment revealed its nucleotide sequence as shown in SEQ ID NO.1. This fragment contains a polymorphic site, specifically at position 163bp in SEQ ID NO.1, where Y is either C or T. This indicates that the amplified MKI67 gene fragment exhibits C / T polymorphism at position 163bp (see [link to SEQ ID NO.1]). Figure 2).

[0040] Among them, SEQ ID NO.1:

[0041] CTTCTGTAGGAGCAAATTGACAGGTACACCCCTGACTTGCTTAGACTTACTTGCATGTTAGGATATGAATCAATGGAAAATGTTGCAATTGATTCCCCTTTGAGTTCAATTTCAAATGATGTTCTCCACCTTGAGATTCGTAATTTGTATTCCTC ATTCTTGAYATTTTGTGGATGTCTTTTAAATTTTTTTAGGGAGTGTCTCTGCGTTCCAGGCGTCCTGCTAAAACTTCTGTAGAGGAGCAAAGACCTGAGGTTCTTATATCAGCAGAAAAGGTGAAAATAAAAAGAAGCGAAAAGAAGTCTGTG.

[0042] DNA sequence homology retrieval and identification:

[0043] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using BLAST software from the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of the sheep MKI67 gene DNA (GenBank accession number: NC_040260.1).

[0044] Example 2: Establishment of a Genotyping Detection Method

[0045] 1. Primer sequence design

[0046] KASPar primer pairs were designed for the specific detection of the C / T polymorphic site shown in SEQ ID NO.1 of the amplified fragment in Example 1. The nucleotide sequence of the designed KASPar primer pairs is as follows:

[0047] The forward primer A1 used to detect AlleleC is shown in SEQ ID NO.4:

[0048] 5′-GAAGGTGACCAAGTTCATGCTATTCGTAATTTGTATTCCTCATTCTTGAC-3′;

[0049] The forward primer A2 used to detect AlleleT is shown in SEQ ID NO.5:

[0050] 5′-GAAGGTCGGAGTCAACGGATTGATTCGTAATTTGTATTCCTCATTCTTGAT-3′;

[0051] The universal reverse primer C is shown in SEQ ID NO.6: 5'-CTGGAACGCAGAGACACTCCCTAAA-3'.

[0052] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the above KASPar primer pairs was diluted to 10 μmol / L and mixed thoroughly at a volume ratio of 12:12:30 for forward primer A1: forward primer A2: universal reverse primer C.

[0053] 2. DNA quality control

[0054] Genomic DNA extracted from sheep whole blood was detected by 1% agarose gel electrophoresis and Nanodrop 2100, respectively. A DNA extraction kit can be used to extract genomic DNA from whole blood. The qualified DNA requirements are: (1) Agarose gel electrophoresis shows a single DNA band without obvious diffusion. (2) Nanodrop 2100 detection shows A260 / 280 between 1.8 and 2.0 (indicating that the DNA sample is not contaminated with protein); A260 / 230 between 1.8 and 2.0 (indicating that the DNA sample has a low salt ion concentration); and no obvious light absorption at 270 nm (indicating that the DNA sample is not contaminated with phenol). Based on the KASPar detection technology of LGC Company in the UK and the conversion of genome size, the amount of DNA used is calculated to be 10-20 ng / sample. The extracted genomic DNA is diluted to a concentration of 10-20 ng / μL as a DNA template for later use.

[0055] 3. Genotyping test

[0056] First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10-20 ng / μL) and a blank control (No template control, NTC, using sterile water) were added to 384-well reaction plates, respectively. The plates were then dried at 60°C for 30 min (drying oven, LGC Corporation) until the DNA became a dry powder for later use.

[0057] Each primer in the above KASPar primer pair was diluted to 10 μmol / L and mixed with the primer in a volume ratio of 12:12:30 for forward primer A1:forward primer A2:universal reverse primer C to prepare a primer mixture for later use.

[0058] Then, using a Meridian loading station under the Kraken operating system, 1×Master mix (1536 microplate, catalog number: Part No. KBS-1016-011) and primer mixture were added to each reaction well. Immediately after mixing, the microplates were sealed sequentially using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler high-throughput water bath system. The specific procedure was as follows:

[0059] Pre-denaturation at 94℃ for 15 minutes;

[0060] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplify in touch-down order for 10 cycles, decreasing the temperature by 0.6℃ per cycle;

[0061] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0062] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3 As shown in the figure. Each dot represents a sample to be tested. The red dot near the left indicates that the locus is homozygous for the genotype "TT"; the green dot near the center indicates that the locus is heterozygous for the genotype "TC" or "CT"; the blue dot near the right indicates that the locus is homozygous for the genotype "CC"; and the black dot represents NTC (…). Figure 3 (If it cannot be displayed in the text), that is, a blank control.

[0063] 4. Application of the molecular markers of this invention in association analysis of sheep growth traits

[0064] The experiment examined the polymorphism of 935 Hu sheep, determined their genotypes, and established the following least squares model:

[0065] Y ijkl =μ+Genotype i +Batch j +Father k +Mother l +ε ijkl

[0066] Among them, Y ijkl These are observed values ​​of growth traits, where μ is the population mean and Genotype. i For genotypic effects, Batch j Due to the batch effect, Fatherk Due to the paternal effect, Mother l Maternal effect, ε ijkl Assuming random error, let ε ijkl They are independent of each other and follow an N(0, σ2) distribution.

[0067] Genotyping results showed that among 935 individuals, there were 27 individuals with the TT genotype, 147 individuals with the TC genotype, and 761 individuals with the CC genotype. The results of the genotype-trait association analysis are shown in Table 2. In the table, BW represents sheep body weight in kg. 80d represents the sheep's body weight on day 80; 100d represents the sheep's body weight on day 100, and so on. The data in the table represent the average body weight for the same genotype.

[0068] Table 2. Association analysis of the MKI67g.163C>T gene polymorphism with growth traits in sheep.

[0069]

[0070]

[0071] Note: Different superscript letters in the same row indicate significant differences (P<0.05), while the same superscript letter indicates no significant differences (P>0.05).

[0072] The results showed that the MKI67 g.163C>T mutation site was significantly associated with sheep growth traits as the testing period lengthened. Individuals carrying the TT genotype had significantly higher body weights than those carrying the CC and TC genotypes (P<0.05), indicating that the T allele was the dominant allele. This suggests that the MKI67 g.163C>T mutation site can serve as a potential molecular marker affecting sheep growth traits (P<0.05), and provides a detection technique for identifying rapidly growing sheep in breeding. In particular, artificial insemination using semen from TT genotype rams can greatly improve breeding efficiency and produce flocks with superior growth rates.

Claims

1. The application of a PCR primer pair for detecting molecular markers associated with sheep growth traits in sheep breeding, characterized in that, The PCR primer pair includes a forward primer MF and a reverse primer MR, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at its 163bp represents C or T. This mutation leads to C / T polymorphism of the molecular marker, and individuals carrying the TT genotype have significantly higher body weights than individuals carrying the CC and TC genotypes. The purpose of the breeding is to select sheep that grow rapidly.

2. The application of a KASPar primer pair for detecting molecular markers associated with sheep growth traits in sheep breeding, characterized in that, The KASPar primer pair includes a forward primer A1 for detecting AlleleC, a forward primer A2 for detecting AlleleT, and a reverse universal primer C. The nucleotide sequence of the forward primer A1 is shown in SEQ ID NO.4, the forward primer A2 is shown in SEQ ID NO.5, and the reverse universal primer C is shown in SEQ ID NO.

6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at its 163bp represents C or T. This mutation leads to C / T polymorphism of the molecular marker, and individuals carrying the TT genotype have significantly higher body weights than individuals carrying the CC and TC genotypes. The purpose of the breeding is to select sheep that grow rapidly.

3. The application of a kit for detecting molecular markers associated with sheep growth traits in sheep breeding, characterized in that, The kit includes PCR primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4-6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein Y at its 163bp represents C or T, and this mutation leads to C / T polymorphism of the molecular marker. Individuals carrying the TT genotype have significantly higher body weights than individuals carrying the CC and TC genotypes. The purpose of the breeding is to select sheep that grow rapidly.

4. An application of a method for detecting molecular markers associated with sheep growth traits in sheep breeding, comprising the following steps: a) Amplify sheep genomic DNA using PCR primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4-6, or using a kit that includes said PCR primer pairs or KASPar primer pairs; b) Genotyping the polymorphic site at 163 bp of the amplified product sequence obtained in step a) as shown in SEQ ID NO.1; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at its 163bp represents C or T. This mutation leads to C / T polymorphism of the molecular marker, and individuals carrying the TT genotype have significantly higher body weight than individuals carrying the CC and TC genotypes. The purpose of the breeding is to select sheep that grow rapidly.

5. The application according to claim 4, characterized in that, The typing identification method in step b) is sequencing, fluorescent probe, gene chip, or high-resolution melting curve method.

6. The application according to claim 4, characterized in that, PCR amplification was performed using the KASPar primer pair described in claim 3. After amplification, the genotyping result was determined by detecting the fluorescence signal.

7. PCR primer pairs or KASPar primer pairs for detecting molecular markers associated with sheep growth traits, or kits containing the aforementioned PCR primer pairs or KASPar primer pairs, or the application of methods for detecting molecular markers associated with sheep growth traits in the detection of sheep growth traits; characterized in that, The nucleotide sequences of the PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; The nucleotide sequences of the KASPar primer pairs are shown in SEQ ID NO.4-6; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The Y at its 163bp position represents C or T. This mutation leads to the C / T polymorphism of the molecular marker. Individuals carrying the TT genotype have significantly higher body weights than individuals carrying the CC and TC genotypes.