A variant pseudorabies virus gC-gD epitope concatemer and its application

Abstract

The present invention provides a variant pseudorabies virus (PRV) gC-gD epitope concatemer and its application. The amino acid sequence of the variant pseudorabies virus gC-gD expression concatemer is shown in SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2. The present invention uses the variant pseudorabies virus gC-gD epitope concatemer to establish an indirect ELISA detection method for PRV neutralizing antibodies with strong specificity, high sensitivity and good repeatability. The method can fully meet the serological diagnosis requirements of pig herds in pig farms where PRV wild virus is prevalent and pig farms where PRV wild virus has been purified, laying a certain foundation for the development of a new PRV polypeptide vaccine.

Description

Technical Field

[0001] The invention belongs to the technical field of animal husbandry and veterinary medicine, and particularly relates to a pseudorabies virus gC-gD epitope concatemer and an application thereof. Background Art

[0002] Pseudorabies virus (PRV) is a porcine neuroherpesvirus. Although pigs are the natural reservoir for PRV, it can also infect a variety of mammals, including ruminants, carnivores, and rodents. It is a significant neuropathogen in livestock, and animals infected with PRV may die from central nervous system disease. PRV infection poses a serious threat to the swine industry, and the disease is typically controlled using live attenuated or inactivated vaccines. Since 2011, pseudorabies caused by genetic mutations of PRV has reappeared in pig farms in China that were vaccinated with Bartha-K61. The first inventor of the present invention isolated the PRV variant strain FJ-2012 from the affected pig farm and found that the strain had undergone a certain degree of mutation. Numerous studies have shown that antibodies produced by vaccines against classic PRV strains do not fully protect against infection with virulent PRV variants.

[0003] The PRV genome is a linear double-stranded DNA sequence of 150 kb in size, with a G+C content of up to 75%. It contains 72 reading frames and encodes 70-100 proteins. Of the 11 currently known glycoproteins, gC and gD are closely associated with the host immune response. Both gC and gD glycoproteins are envelope proteins, primarily distributed on the surface of the viral envelope. They are highly conserved and can induce high levels of neutralizing antibodies. Subunit vaccines derived from these proteins can protect mice and pigs from PRV infection, exhibiting excellent immunogenicity and reactogenicity, making them the preferred proteins for constructing recombinant DNA vaccines and vaccine immunoassays. Multi-epitope subunit vaccines are a newly developed vaccine development technology in recent years. Epitope vaccines are prepared based on antigenic epitopes. Compared to traditional vaccines, epitope vaccines induce a more targeted immune response, are non-toxic, relatively stable, and easy to produce, store, and use, representing the future direction of vaccine development. Therefore, new genes based on gC and gD sequences can be designed as candidate vaccine antigens, or gC and gD antigen epitope fragments that can stimulate the body to produce protective humoral immune responses can be selected as diagnostic antigens for the detection of PRV antibodies and the development of epitope vaccines.

[0004] This application is the first to concatenate the antigen epitope genes gC and gD on the PRV variant strain, recombinant them into the pET-28a(+) vector, construct the pET-28a(+)-gC and gD prokaryotic recombinant expression plasmids, and transform them into BL21(DE3) for induced expression, obtaining the gC-gD antigen epitope concatenated recombinant protein of the new PRV strain, establishing an indirect ELISA detection method for PRV neutralizing antibodies in pig serum, and also laying the foundation for the research on the development of PRV multi-epitope vaccine. Summary of the Invention

[0005] The purpose of the present invention is to provide a variant pseudorabies virus gC-gD epitope concatemer and application thereof.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention first provides a variant pseudorabies virus gC-gD epitope concatemer, the amino acid sequence of the variant pseudorabies virus gC-gD epitope concatemer is shown in SEQ ID NO.1.

[0008] The present invention further provides a gene encoding the above-mentioned variant pseudorabies virus gC-gD epitope concatemer, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0009] The present invention also provides the use of the variant pseudorabies virus gC-gD epitope concatemer in the preparation of a PRV diagnostic kit and a vaccine.

[0010] The advantages of the present invention are:

[0011] This study, based on a mutant pseudorabies virus (PRV), identified the gC and gD epitope gene sequences of the major antigenic proteins of the mutant PRV through screening, cloning, and sequencing. After codon optimization, the cDNA sequences were synthesized in tandem and ligated into the multiple cloning site of the prokaryotic expression vector pET-28a(+). The cDNAs were then transformed into BL21(DE3) competent cells and induced for expression using IPTG. Plasmid sequencing and enzyme digestion results confirmed the successful construction of a recombinant expression plasmid for the gC-gD epitope tandem gene. SDS-PAGE and Western blot results demonstrated the successful induction of expression of the gC-gD epitope tandem recombinant protein. This protein was used to establish an indirect ELISA assay for PRV neutralizing antibodies in swine serum with high specificity, sensitivity, and reproducibility, fully meeting the requirements for PRV serological diagnosis. Therefore, the present invention pioneered the in vitro tandem expression of the gC and gD antigen epitope gene sequences of the main antigenic proteins of the PRV variant strain FJ-2012, established the gC and gD antigen epitope cDNA tandem sequences, obtained the induced expressed tandem recombinant proteins and the corresponding amino acid sequences, and laid the foundation for the research on PRV epitope screening, PRV multi-epitope vaccines and diagnostic reagents. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 PCR amplification results of the gC and gD antigen epitope genes of the PRV FJ-2012 strain. M, 2K marker; 1, 2, 3, PCR amplification of the gC antigen epitope gene (405 bp) using FJ-2012 strain nucleic acid as a template; 4, 5, 6, PCR amplification of the gD antigen epitope gene (318 bp) using FJ-2012 strain nucleic acid as a template.

[0013] Figure 2 : Comparison of nucleotides before and after tandem optimization of PRV virus gC-gD antigen epitope gene.

[0014] Figure 3 : PCR verification and enzyme digestion results. A: M, 2K Marker; 1, 2, 3, 4, PCR verification using plasmid as template; B: M1, 2K Marker; M2, 8K Marker; 5, PCR verification using plasmid as template; 6, double enzyme digestion verification.

[0015] Figure 4 : Sequencing peak diagram of gC-gD-PET28a(+) recombinant plasmid.

[0016] Figure 5 : Comparison of sequencing results of gC-gD-PET28a(+) recombinant plasmid with the optimized sequence.

[0017] Figure 6 Inducible expression and identification of recombinant proteins. A, M: Protein Maker; NC, uninduced bacterial precipitate; 2, 3, and 4 are bacterial precipitates after IPTG induction of gC-gD-pET-28a(+)-BL21(DE3) for 2, 4, and 6 hours, respectively; B, M: Protein Maker; 4, purified recombinant protein tandemly expressed with the gC-gD epitopes; NC, uninduced bacterial protein in the control group. DETAILED DESCRIPTION

[0018] Example 1

[0019] 1 Experimental Materials and Methods

[0020] 1.1 Reagents and Materials

[0021] PBST (pH7.4, 0.01 M), FlyCut® EcoRI, FlyCut ® NcoI , EasyPure ® Quick GelExtraction Kit, EasyPure ®Plasmid MiniPrep Kit (EM101), Agarose, GelStain, BL21(DE3) Chemically Competent Cell , ProteinRuler ® II (12-120 kDa), IPTG, His-tagged monoclonal antibody, and horseradish peroxidase-labeled goat anti-pig antibody were purchased from Beijing Quanshijin Co., Ltd.

[0022] 1.2 Amplification of gC and gD epitope genes

[0023] Primers for PCR amplification of the gC and gD antigenic epitopes were designed based on the Becker sequence (JF79721 9.1) of the PRV reference strain registered in GenBank. PCR amplification was performed using nucleic acid from the newly isolated novel pseudorabies virus FJ-2012 strain as a template. The amplified product was sent to Sangon Biotech (Shanghai) Engineering Co., Ltd. for sequencing, thereby obtaining the gC and gD antigenic epitope gene sequences of the FJ-2012 strain. The primers used for PCR were synthesized by Sangon Biotech (Shanghai) Engineering Co., Ltd., namely:

[0024] gC-F: 5'-TACTTTGACGAGCCCCCGCG-3',

[0025] gC-R: 5'- GAAGGCGGCGTCCACCG';

[0026] gD-F: 5'-GATCGTCTGCTGAATGAAGC-3',

[0027] gD-R: 5'-CAGGGCAACCATAAAATCTGT-3'.

[0028] 1.3 Construction of gC-gD recombinant expression vector

[0029] Based on the gene sequences of the gC and gD antigen epitopes of the FJ-2012 strain, a gC-gD tandem coding sequence was designed and codon optimized. The gC-gD tandem gene fragment was synthesized by Fuzhou Shangya Biotechnology Co., Ltd. and inserted between the NcoI and EcoRI restriction sites of the pET-28a+ vector to construct the recombinant plasmid gC-gD-PET28a(+). This recombinant plasmid was transformed into BL21(DE3) competent cells and extracted according to the instructions of the plasmid extraction kit. PCR and double enzyme digestion (NcoI and EcoRI) were used as templates for verification. The recombinant plasmid was then sent to Sangon Biotech (Shanghai) Engineering Co., Ltd. for sequencing. The primers used in the PCR were synthesized by Sangon Biotech (Shanghai) Engineering Co., Ltd., namely:

[0030] F: 5'- CCCAATCCATGGCCTATTTTGATGAACCGCCGCGT -3',

[0031] R: 5'- CCCAATGAATTCGGCAGGGCAACCATAAAATCTGTCAG -3'.

[0032] 1.4 Inducible expression of gC-gD epitope tandem recombinant protein

[0033] The correct monoclonal colonies were cultured overnight in LB liquid medium containing 50µg / mL kanamycin (200rpm, 37℃). Inoculated into fresh LB liquid medium (containing 50µg / mL kanamycin) at a ratio of 1vol% and cultured at 37℃ with shaking (200rpm) until the OD 600When the pH value was 0.6, IPTG was added to a final concentration of 0.5 mmol / L and the expression of the target protein was induced at 37°C. At 2, 4, and 6 hours of IPTG induction, 500 µL of culture medium was collected and centrifuged at 3000 × g for 5 minutes to collect the bacterial pellet. The cells were resuspended in an appropriate amount of 1× SDS-Loading buffer and boiled in a boiling water bath for 10 minutes. After centrifugation at 12000 × g for 10 minutes, 8 µL of the supernatant was collected and analyzed by 12% SDS-PAGE and Western blot using an anti-His tag antibody. The recombinant target protein was purified using a Ni-NTA purification column, and the concentration of the refolded recombinant protein was determined by BCA assay.

[0034] 1.5 Establishment of indirect ELISA antibody detection method

[0035] According to the array titration method, 100 μL of gC-gD epitope tandem recombinant protein at different concentrations of 5 mg / L, 3 mg / L, 1 mg / L, and 0.5 mg / L was added to the ELISA plate per well. After coating at 4°C for 12 hours, it was blocked with PBST containing 2% BSA at 100 μL / well. After blocking at 37°C for 1 hour, the blocking solution was discarded. After washing with PBST three times, pig serum of different dilution ratios was added at 100 μL / well and incubated at 37°C for 60 minutes. After washing with PBST three times, horseradish peroxidase-labeled antibody (HRP) at a dilution of 1:2000 was added at 100 μL / well and incubated at 37°C for 60 minutes. After washing with PBST three times, TMB substrate colorimetric solution was added at 100 μL / well and incubated at room temperature for 15 minutes. The OD value of each well was read using an enzyme reader. 650 The optimal antigen (gC-gD epitope tandem recombinant protein) coating concentration and serum dilution ratio were determined through analysis. The cutoff value for result determination was then determined using PRV-negative serum. The stability of the method was verified through inter- and intra-batch replicates.

[0036] 1.6 Detection of clinical pig serum antibodies

[0037] The indirect ELISA antibody detection method established based on the gC-gD fusion protein obtained by the present invention is used to detect PRV neutralizing antibodies in clinical pig sample serum.

[0038] 1.6.1 Comparison with gB antibody testing

[0039] The method established in the present invention was used to test 90 pig sera randomly sampled from several pig farms. At the same time, the gB antibody was detected using the IDEXX pseudorabies virus gB antibody detection kit (competitive ELISA method), and the test results were compared and analyzed.

[0040] 1.6.2 Comparison of PRV antibody testing in different pig farms

[0041] The method established by the present invention was used to test 60 pig sera from PRV wild virus positive pig farms and 60 pig sera from PRV completely purified pig farms, and the test results were compared and analyzed.

[0042] 2 Results

[0043] 2.1 Construction of epitope tandem expression recombinant vector

[0044] According to the results of PCR amplification and sequencing of gC and gD antigen epitope genes of FJ-2012 strain ( Figure 1 , SEQ ID NO.3, SEQ ID NO.4), designed the gC-gD tandem coding sequence, and optimized the codons ( Figure 2 , SEQ ID NO.2), construct gC-gD-PET28a (+) recombinant plasmid, transform T1 competent cells, pick clones, shake the bacteria and extract the plasmid, use the extracted plasmid as a template, perform PCR amplification, and observe by agarose gel electrophoresis. The results are shown in Figure 3 , a clear target band can be seen, which is consistent with the expected band size (723bp). The extracted plasmid was double-digested with NcoI and EcoRI, and the digested product was run on the gel, and the expected band can be seen. The extracted plasmid was sent for sequencing, and the sequencing results showed ( Figure 4 ), the peak shape is single, indicating that the sequencing result is good, and the alignment with the expected gC-gD fragment is 100% ( Figure 5 ), indicating that the gC-gD-pET28a (+) recombinant plasmid was successfully constructed.

[0045] 2.2 Inducible expression and verification of gC-gD recombinant protein

[0046] The obtained recombinant plasmid gC-gD-pET-28a (+) was transformed into BL21 (DE3) and induced with IPTG for 2 h, 4 h, and 6 h. The bacterial precipitates were collected and lysed. SDS-PAGE gel showed a clear recombinant protein band at about 27 kDa ( Figure 6 A), and WB experiments also showed a specific band at about 27 kDa ( Figure 6 B) It shows that the gC-gD antigen epitope recombinant protein of the PRV variant strain FJ-2012 constructed in the present invention is expressed in BL21 (DE3), and the amino acid sequence of the recombinant protein is shown in SEQ ID NO.1.

[0047] 2.3 Indirect ELISA method for gC-gD recombinant protein

[0048] 2.3.1 Optimal antigen coating concentration and optimal serum dilution

[0049] The array titration test results showed that when the antigen coating concentration was 3 mg / L and the sample serum was diluted 1:50, the positive sample serum OD 650 The larger value is 0.801, and the negative sample serum OD 650 The value is 0.359, and the ratio of the two (positive sample serum OD 650 Serum OD of negative sample 650 The ratio (P / N value) also reaches a maximum of 2.23. Therefore, the optimal antigen coating concentration of the indirect ELISA antibody detection method established by the present invention is 3 mg / L, and the optimal serum dilution is 1:50.

[0050] Table 1 Optimal concentration of gC-gD recombinant protein coating and optimal serum dilution (OD 650 value)

[0051]

[0052]

[0053] 2.3.2 Determination of the critical value of the indirect ELISA method

[0054] According to the above method and steps, 20 pig sera that were negative for PRV antibodies (i.e., negative for both PRV-gB and PRV-gE antibodies) were tested. The serum OD 650 The mean value (Mean) is 0.339, the variance (SD) is 0.03, and the coefficient of variation is 8.8%. Based on Mean+3×SD=0.429 and Mean+2×SD=0.399, the judgment criteria for the indirect ELISA method for detecting PRV neutralizing antibodies using gC-gD recombinant protein in this study were preliminarily determined: OD of the tested sample 650 A value greater than or equal to 0.429 is considered positive, less than or equal to 0.399 is considered negative, and values ​​between the two are considered suspicious.

[0055] Table 2 Negative threshold of gC-gD recombinant protein indirect ELISA method

[0056]

[0057] 2.3.3 Specificity Verification

[0058] The method established in this study was used to detect positive pig sera (both gB and gE antibodies were positive). The results showed that the positive sera for PRRSV, PEDV, PCV-2, CSFV and PPV were all negative, and only the PRV antibody-positive serum was positive. Therefore, the indirect ELISA antibody detection method established in the present invention has good specificity and has no cross-reaction to other pathogen antibodies.

[0059] Table 3 Results of specificity test of gC-gD recombinant protein indirect ELISA method

[0060]

[0061] 2.3.4 Repeatability test

[0062] The results of repeated testing of samples within the batch using the method established in this study showed that the OD 650 The variance of the values ​​was between 0.006 and 0.013, and the coefficient of variation was between 1.1% and 2.4%. The results of repeated tests between batches showed that the OD values ​​of each sample were tested repeatedly. 650 The variance of the values ​​is between 0.009 and 0.026, and the coefficient of variation is between 3.0% and 4.0%. Therefore, the indirect ELISA antibody detection method established by the present invention is stable and usable, and has good repeatability.

[0063] Table 4 Results of the repeatability test of the indirect ELISA method for gC-gD recombinant protein

[0064]

[0065] 2.3.5 Sensitivity test

[0066] The serum of PRV antibody-positive pigs (both gB and gE antibodies were positive) was tested for 2 N The results of the test using this method showed that after the positive serum was diluted 16 times and then diluted 1:50 for detection, it could still be detected as positive after 800 times dilution, indicating that the indirect ELISA antibody detection method established by the present invention has high sensitivity.

[0067] Table 5 Sensitivity test of gC-gD recombinant protein by indirect ELISA method (OD 650 value)

[0068]

[0069] 2.4 Preliminary Application and Compliance Rate

[0070] The indirect ELISA antibody detection method established by the present invention and a commercial antibody detection kit were used to test 90 clinical pig sera. The results showed that the method established by the present invention had a positive rate of 71.11% (64 / 90) for PRV neutralizing antibodies, a negative rate of 9.24% (17 / 90), and a suspicious rate of 4.89% (9 / 90). The commercial kit had a positive rate of 74.44% (67 / 90) for PRV gB antibodies, a negative rate of 8.7% (70 / 90), and a suspicious rate of 3.8%. The overall concordance rate between the two methods was 96.67%, calculated by dividing the number of concordant results between the two methods by the total number. These results demonstrate that the indirect ELISA antibody detection method established by the present invention and the commercial antibody detection kit provide essentially consistent results. This research invention can be used for clinical testing, providing a new method for PRV antibody epidemiological research and vaccine immune efficacy monitoring.

[0071] Table 6 Comparative test results of 90 pig sera from clinical samples

[0072]

[0073] 2.5 PRV antibody test results in different pig farms

[0074] The method established by the present invention and the commercial antibody detection kit were used to test 60 pig sera from PRV wild-type positive pig farms and 60 pig sera from PRV wild-type clear pig farms. Both pig farms were immunized with a gE gene-deficient vaccine of the classic pseudorabies strain. The antibody test results showed that the neutralizing antibody positivity rate detected by the present invention in the PRV wild-type positive pig farms was 95% (57 / 60), while the neutralizing antibody positivity rate in the PRV wild-type clear pig farms was only 80% (48 / 60). The gB antibody positivity rate detected in the PRV wild-type clear pig farms using the commercial kit was 96.67% (58 / 60). The PRV antibody test results from different pig farms showed that the neutralizing antibody positivity rate in the PRV wild-type clear pig farms was significantly lower than that in the PRV wild-type positive pig farms, and also significantly lower than the gB antibody positivity rate detected by the commercial antibody detection kit. This indirectly reflects that the antibodies produced by immunization with the gE gene-deficient vaccine of the classic PRV strain cannot fully react with the gC-gD epitope fusion protein of the variant FJ-2012 strain. Therefore, the method invented in this study has important clinical guiding significance for detecting the PRV antibody status in pig farms positive for PRV wild virus and inferring the ability of PRV wild virus to completely purify pig farms from infection with PRV mutant strains; and the gC-gD epitope fusion protein constructed in this study can be used to prepare polypeptide vaccines, which can effectively resist infection with PRV mutant strains.

[0075] Table 7 PRV antibody test results in different pig farms

[0076]

[0077] In summary, this study constructed a tandem expression vector containing PRV gC and gD epitopes, transformed the E. coli expression system for induced expression, and obtained a gC-gD epitope tandem recombinant protein with good expression characteristics and immunocompetence, laying a certain foundation for the development of a new PRV vaccine. The present invention utilizes E. coli to express the PRV gC-gD epitope tandem recombinant protein in vitro. The production process is simple, and the expressed recombinant protein has good immunogenicity and antigenicity, with good application prospects. In order to clarify the mechanism by which PRV gC-gD immunization in piglets reduces virus transmission, future research needs to carry out cellular immunity-related research.

[0078] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A variant pseudorabies virus gC-gD epitope concatemer, characterized in that: The amino acid sequence of the variant pseudorabies virus gC-gD expression concatemer is shown in SEQ ID NO.

1.

2. A gene encoding the variant pseudorabies virus gC-gD epitope concatemer according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. Use of the variant pseudorabies virus gC-gD epitope concatemer according to claim 1 in preparing a diagnostic kit for porcine pseudorabies virus.

Images