A three-component oxidation system and its application in the degradation of 4-hydroxyestrone

Abstract

This invention discloses a three-component oxidation system and its application in the degradation of 4-hydroxyestradiol. Specifically, it discloses a 4,5-exogeneic dioxygenase, HedG1, associated with the oxidative cleavage of 4-OH-E1. This enzyme, supported by an electron transport chain composed of ferrugin HedG2 and ferrugin reductase HedG3, catalyzes the 4,5-seco meta-oxidative cleavage of 4-OH-E1, generating a meta-cleavage product of the A ring. The three-component dioxygenase system HedG1G2G3 based on HedG1 in this invention rapidly reduces the hormonal activity of cyclopentane polyhydrophenanthrene by disrupting the A ring of the cyclopentane polyhydrophenanthrene structure, which is beneficial for the remediation and treatment of environmental estrogen pollution.

Description

Technical Field

[0001] This invention belongs to the field of environmental microbiology and relates to a three-component oxidation system and its application in the degradation of 4-hydroxyestrone. Background Technology

[0002] Steroid estrogens are typical endocrine disruptors. Once inside the body, they mimic the body's own endogenous hormones, disrupting normal endocrine balance. Even trace concentrations can affect organisms, such as inducing feminization in male fish and increasing cancer risk in humans. Human and livestock excrement are major sources of steroid estrogens in the environment. Adult women, especially pregnant women, contribute significantly more to estrogen emissions than adult men. Notably, livestock farming contributes far more to environmental estrogen emissions than humans. Statistics show that in the United States and the European Union, livestock emit up to 83,000 kg of estrogen annually, twice the amount emitted by humans. Therefore, estrogen pollution is a widespread problem that urgently needs to be addressed.

[0003] Microbial degradation is a crucial mechanism for the reduction and transformation of steroidal estrogens in the environment. Microbial degradation can mineralize estrogen, and it is a cost-effective method with no risk of secondary pollution, making it the most promising means of estrogen pollution control. For a long time, estrogen-degrading bacteria have been successively screened from various environmental media. Elucidating the pathways and molecular mechanisms of microbial estrogen metabolism is a core scientific question that needs to be clarified before the practical application of microorganisms. Unfortunately, existing research mostly focuses on the initial / upstream stages of microbial estrogen degradation, with few reports on downstream pathways involving the breakage of the estrogen steroid skeleton, and key genes and enzyme systems involved in estrogen degradation have not been systematically elucidated.

[0004] In estrogen-degrading bacteria, enzymes synthesized under the guidance of degradation genes are the true executors of the degradation process. Genetic engineering techniques can be used to extract these degradation enzymes and construct engineered bacteria with targeted degradation capabilities; or they can be expressed in large quantities for enzyme preparation development. Dioxygenase genes play an important role in the degradation of aromatic compounds and are often associated with compound ring cleavage. Obtaining estrogen-degrading genes and their encoded proteins is of great significance for using enzyme preparations to remediate environmental estrogen pollution. Summary of the Invention

[0005] The purpose of this invention is to provide a novel gene encoding 4,5-exogene diol dioxygenase hedG1, which is involved in the oxidative cleavage of 4-OH-E1, and the dioxygenase HedG1 encoded by it.

[0006] Another object of the present invention is to provide a ferroredoxin (electron transport chain component) encoding gene hedG2 that matches 4,5-exogeneic dioxygenase HedG1, and the ferroredoxin HedG2 encoded therein.

[0007] Another object of the present invention is to provide a ferroredoxin reductase (electron transport chain component) encoding gene hedG3 that matches 4,5-exogeneic dioxygenase HedG1, and the ferroredoxin reductase HedG3 encoded therein.

[0008] Another object of the present invention is to provide an engineered bacterium E. coli BL21(DE3)(pET28a-hedG1) that can express 4,5-exogene dioxygenase HedG1 in large quantities, an engineered bacterium E. coli BL21(DE3)(pET28a-hedG2) that can express ferrugin HedG2 in large quantities, and an engineered bacterium E. coli BL21(DE3)(pET28a-hedG3) that can express ferrugin reductase HedG3 in large quantities.

[0009] The ultimate goal of this invention is to provide a three-component dioxygenase system, HedG1G2G3, consisting of 4,5-exogeneic dioxygenase HedG1, ferroredoxin HedG2, and ferroredoxin reductase HedG3, and its application in the degradation of 4-OH-E1.

[0010] The objective of this invention can be achieved by implementing the following techniques:

[0011] A 4,5-exogene dioxygenase gene, hedG1, has the nucleotide sequence SEQ ID NO.1. The gene is 978 bp in length, with a G+C content of 65.74%; it encodes 325 amino acids and has a molecular weight of 35.1 kDa.

[0012] A ferrugin component of the electron transport chain, encoding a gene called hedG2, has the nucleotide sequence SEQ ID NO.2. The gene is 333 bp in length, with a G+C content of 65.77%; it encodes 110 amino acids and has a molecular weight of 11.9 kDa.

[0013] A gene encoding a ferroreductase component of the electron transport chain, hedG3, has the nucleotide sequence SEQ ID NO.3. The gene is 1227 bp in length, with a G+C content of 64.55%; it encodes 408 amino acids and has a molecular weight of 44.1 kDa.

[0014] The dioxygenase HedG1 encoded by the 4,5-exogene diol dioxygenase gene hedG1 described in this invention has the amino acid sequence SEQ ID NO.4.

[0015] The ferroredoxin HedG2 encoded by the electron transport chain ferroredoxin component encoding gene hedG2 described in this invention has the amino acid sequence SEQ ID NO.5.

[0016] The ferroredoxin reductase HedG3 encoded by the electron transport chain ferroredoxin reductase component encoding gene hedG3 described in this invention has the amino acid sequence SEQ ID NO.6.

[0017] A recombinant plasmid containing the 4,5-exogene dioxygenase gene hedG1 described in this invention.

[0018] In a preferred embodiment of the present invention, the dioxygenase gene fragment hedG1 is homologously recombinated with linearized pET28a to obtain the recombinant plasmid pET28a-hedG1.

[0019] A recombinant plasmid containing the hedG2 gene encoding the electron transport chain ferricredoxin component as described in this invention.

[0020] As an optimized method of the present invention, the ferricredoxin gene fragment hedG2 is homologously recombinated with linearized pET28a to obtain the recombinant plasmid pET28a-hedG2.

[0021] A recombinant plasmid containing the ferroredoxin reductase gene hedG3 described in this invention.

[0022] As a preferred embodiment of the present invention, the ferric reductase gene fragment hedG3 is homologously recombinated with linearized pET28a to obtain the recombinant plasmid pET28a-hedG3.

[0023] Engineered bacteria containing the recombinant plasmid pET28a-hedG1 described in this invention.

[0024] In a preferred embodiment of the present invention, the recombinant plasmid pET28a-hedG1 containing the dioxygenase gene hedG1 is transformed into E. coli DH5α to obtain a recombinant microorganism E. coli DH5α (pET28a-hedG1) capable of copying pET28a-hedG1 in large quantities; the recombinant plasmid pET28a-hedG1 is extracted and further transformed into the expression type E. coli BL21(DE3) to obtain an engineered bacterium E. coli BL21(DE3)(pET28a-hedG1) capable of efficiently expressing HedG1.

[0025] Engineered bacteria containing the recombinant plasmid pET28a-hedG2 described in this invention.

[0026] As an optimized method of the present invention, the recombinant plasmid pET28a-hedG2 containing the ferricredoxin gene hedG2 is transformed into E. coli DH5α to obtain a recombinant microorganism E. coli DH5α (pET28a-hedG2) that can copy pET28a-hedG2 in large quantities; the plasmid is extracted and further transformed into the expression strain E. coli BL21(DE3) to obtain an engineered bacterium E. coli BL21(DE3)(pET28a-hedG2) that can express HedG2 in large quantities.

[0027] Engineered bacteria containing the recombinant plasmid pET28a-hedG3 described in this invention.

[0028] As a preferred embodiment of the present invention, the recombinant plasmid pET28a-hedG3 containing the ferric reductase gene hedG3 is transformed into E. coli DH5α to obtain a recombinant microorganism E. coli DH5α (pET28a-hedG3) that can produce a large number of pET28a-hedG3 copies; the recombinant plasmid is extracted and further transformed into the expression type E. coli BL21(DE3) to obtain an engineered bacterium E. coli BL21(DE3)(pET28a-hedG3) that can express HedG3 in large quantities.

[0029] A three-component dual oxygenation system HedG1G2G3 comprises the 4,5-exogeneic dioxygenase HedG1, ferroredoxin HedG2, and ferroredoxin reductase HedG3 described in this invention.

[0030] The present invention relates to the application of the three-component dioxygenase preparation system HedG1G2G3, consisting of 4,5-exogeneic dioxygenase HedG1, ferroredoxin HedG2, and ferroredoxin reductase HedG3, in the degradation of 4-OH-E1 in soil and / or water.

[0031] Beneficial effects

[0032] 1) In this invention, the 4,5-exogene dioxygenase gene hedG1, the ferric reductase gene hedG2, and the ferric reductase gene hedG3 were cloned from the estrogen-degrading bacterium Novosphingobium sp. ES2-1 (patent strain preservation number CGMCC 12925).

[0033] 2) Utilizing the principle of homologous recombination, the above three genes were ligated into the linearized pET28a vector to obtain the corresponding recombinant plasmids pET28a-hedG1, pET28a-hedG2, and pET28a-hedG3. These recombinant plasmids were then transformed into E. coli DH5α and E. coli BL21(DE3) respectively, ultimately yielding engineered bacteria E. coli BL21(DE3)(pET28a-hedG1), E. coli BL21(DE3)(pET28a-hedG2), and E. coli BL21(DE3)(pET28a-hedG3) capable of expressing large amounts of 4,5-exogene dioxygenase HedG1, ferroredoxin HedG2, and ferroredoxin reductase HedG3.

[0034] 3) A mixed bacterial agent composed of E. coli BL21(DE3)(pET28a-hedG1), E. coli BL21(DE3)(pET28a-hedG2) and E. coli BL21(DE3)(pET28a-hedG3) can degrade 4-OH-E1.

[0035] 4) Recombinant expression strains E. coli BL21(DE3)(pET28a-hedG1), E. coli BL21(DE3)(pET28a-hedG2), and E.

[0036] After overnight induction with 0.4 mM isopropyl-β-D-thiogalactoside (IPTG), the resin of coli BL21(DE3)(pET28a-hedG3) was purified using His-tagged proteins to obtain His-tagged HedG1, HedG2 and HedG3.

[0037] 5) The three-component dioxygenase preparation system HedG1G2G3, composed of HedG1, HedG2 and HedG3, can remove 4-OH-E1. Attached Figure Description

[0038] Figure 1 Flowchart for constructing recombinant plasmids containing the target gene.

[0039] Figure 2 Colony PCR and linearized pET28a gel electrophoresis were performed on E. coli BL21(DE3) containing recombinant plasmids pET28a-hedG1, pET28a-hedG2, and pET28a-hedG3 using vector-specific primers T7 / T7t.

[0040] Figure 3 The removal efficiency of 4-OH-E1 by different engineered bacterial inoculation treatments.

[0041] Figure 4 SDS-PAGE images of purified HedG1, HedG2, and HedG3. Lane M: protein marker; Lane 1: eluted with 10 mM imidazole; Lane 2: eluted with 20 mM imidazole; Lane 3: eluted with 50 mM imidazole; Lane 4: eluted with 80 mM imidazole.

[0042] Figure 5 Catalytic degradation and enzymatic properties of HedG1G2G3 on 4-OH-E1.

[0043] Figure 6 UPLC-HRMS image of the 4-OH-E1 oxidation products catalyzed by HedG1G2G3.

[0044] Figure 7 HedG1G2G3-catalyzed oxidation products of 4-OH-E1 1 H-NMR (500MHz) image.

[0045] Information on the preservation of biological materials

[0046] The functional bacterium *Novosphingobium subterraneum* ES2-1 is deposited at the China General Microbiological Culture Collection Center (CGMCC), No. 1, Beichen West Road, Chaoyang District, Beijing, China, with accession number CGMCC No. 12925 and deposit date of September 1, 2016. Detailed Implementation

[0047] Example 1: Cloning of 4,5-exogene dioxygenase gene hedG1, ferricoxin gene hedG2, and ferricoxin reductase gene hedG3 and construction of recombinant plasmids.

[0048] 1.1 Extraction of total genomic DNA from strain ES2-1

[0049] Single colonies of strain ES2-1 were picked and inoculated into R2A liquid medium, and cultured at 30℃ and 150 rpm for 36 h. The bacterial culture was centrifuged at 8,000 g for 5 min, and the supernatant was discarded. The bacterial cells were resuspended in sterile water, centrifuged again under the same conditions, and the above steps were repeated twice. Genomic DNA of strain ES2-1 was extracted using the TIANamp Bacteria DNA Kit and stored at -20℃ for later use. 4 μL of the extracted total DNA was electrophoresed on a 1.0% agarose gel, and the electrophoretic bands were observed using a gel imaging system (Bio-RadGelDoc XR+, US) to check the extraction efficiency.

[0050] 1.2 Cloning of the target gene

[0051] 1.2.1 Cloning of 4,5-exodiol dioxygenase gene hedG1, ferricoxin gene hedG2, and ferricoxin reductase gene hedG3

[0052] Using the genomic DNA of strain ES2-1 as a template, overlap extension PCR was performed. Figure 1 Fragments of the 4,5-exogene dioxygenase gene hedG1, ferricredoxin gene hedG2, and ferricredoxin reductase gene hedG3 were obtained.

[0053] The overlapping extension PCR primers for the 4,5-exogene dioxygenase gene hedG1 are as follows:

[0054] hedG1-F:tggacagcaaatgggtcgcATGGCCATTTCATCGCTTGGATA

[0055] hedG1-R:gcagccggatctcagtggCTAGCGTCCCGGCATCTCGT

[0056] The primers for overlap extension PCR amplification of the ferroredoxin gene hedG2 are as follows:

[0057] hedG2-F:tggacagcaaatgggtcgcATGGCCAAGGTGACTTTCGTCC

[0058] hedG2-R:gcagccggatctcagtggCTAGATTCCCGGTTGCTCCGC

[0059] The overlapping extension PCR amplification primers for the ferroreductase gene hedG3 are as follows:

[0060] hedG3-F:tggacagcaaatgggtcgcATGAAATCGATAGCCGTGGTCG

[0061] hedG3-R:gcagccggatctcagtggCTAACCAGCCTGCTTGAGGATTTC

[0062] The primers for overlap extension PCR amplification of the linearized pET28a vector are as follows:

[0063] pET28a-F:CCACTGAGATCCGGCTGCTAA

[0064] pET28a-R:GCGACCCATTTGCTGTCCA

[0065] The PCR reaction systems (50 μL) for amplifying the corresponding target genes using each primer pair are as follows:

[0066]

[0067] The PCR reaction procedures for amplifying the corresponding target genes using each primer pair are shown in Table 1:

[0068] Table 1. PCR amplification procedure for the target gene overlap extension

[0069]

[0070]

[0071] After amplification, the product was electrophoresed on an agarose gel, and then the gel containing the correct fragment size was cut off under UV light. The amplified product was recovered using the AxyPrep DNA Gel Extraction Kit, and the concentration of the recovered PCR product was determined using a NanoDrop 2000c spectrophotometer.

[0072] 1.3 Construction of recombinant plasmids containing the target gene

[0073] Utilizing Trelief based on the principle of homologous recombination TM The SoSoo Cloning Kit is used to fuse the target gene with the linearized pET28a vector fragment. The reaction system consists of 10 μL of 2×SoSoo Mix (5 μL), the linearized vector, the target gene (molar ratio of linearized vector fragment to target gene fragment is 1:5), and ddH2O (5 μL total). The fusion cloning is completed by incubation at 50°C for 15 min.

[0074] 1.4 Construction of engineered bacteria containing recombinant plasmids

[0075] Add 10 μL of the cloning product to E. coli DH5α competent cells, incubate on ice for 25 min, then heat shock at 42°C for 45 s, quickly transfer to an ice bath and incubate for 2 min. Add 500 μL of antibiotic-free LB broth, incubate at 37°C and 200 rpm for 1 h, then spread 600 μL of the recovery solution onto a medium containing 50 mg·L⁻¹ of antibiotics. -1 Incubate kanamycin (Km) on solid LB agar plates overnight at 37°C. Pick single colonies and perform colony PCR using pET28a vector-specific primers T7 (5'-TAATACGACTCACTATAGGG-3') and T7t (5'-TGCTAGTTATTGCTCAGCGG-3'). Figure 2 This was used to preliminarily verify whether the colony contained recombinant plasmids. Single colonies that showed positive PCR results were picked and inoculated with a solution containing 50 mg / L of [agent / inotropic agent].-1 The culture was amplified and cultured in LB liquid medium at Km for 8 h. Plasmids were extracted and sequenced using a plasmid extraction kit following the manufacturer's instructions. Finally, the recombinant plasmid, confirmed by sequencing, was transformed into E. coli BL21(DE3) to construct an engineered bacterium capable of expressing the target gene product in large quantities.

[0076] Example 2: Degradation of 4-OH-E1 by engineered bacteria containing the target gene

[0077] The engineered strains E. coli BL21(DE3)(pET28a-hedG1), E. coli BL21(DE3)(pET28a-hedG2), E. coli BL21(DE3)(pET28a-hedG3), and the control strain E. coli BL21(DE3)(pET28a) containing only the pET28a plasmid were inoculated into a solution containing 50 mg·L⁻¹ of iodine. -1 After culturing in LB liquid medium for 8 hours, the bacterial cells were collected by centrifugation at 8,000g, resuspended in sterile water, and centrifuged again under the same conditions, repeated twice. Subsequently, the bacterial cells were resuspended in sterile inorganic salt medium (MSM) and the absorbance (OD) of the bacterial suspension at 600 nm was measured. 600nm The value was 1 ± 0.1. Then, according to... Figure 3 The inoculation setup shown was as follows: the engineered bacteria were inoculated into MSM containing 70 μM 4-OH-E1 at a 5% inoculation rate and cultured at 37°C and 180 rpm for 6 h. The results showed that the mixed bacterial agent composed of engineered bacteria E. coli BL21(DE3)(pET28a-hedG1), E. coli BL21(DE3)(pET28a-hedG2), and E. coli BL21(DE3)(pET28a-hedG3) could degrade 4-OH-E1 to more than 95% within 6 hours; the effect of inoculating only E. coli BL21(DE3)(pET28a-hedG1) was the second best; while the two treatments of inoculating only the control bacteria E. coli BL21(DE3)(pET28a), and only E. coli BL21(DE3)(pET28a-hedG2) and E. coli BL21(DE3)(pET28a-hedG3) did not show significant degradation of 4-OH-E1. The results above indicate that the protein encoded by the dioxygenase gene hedG1 can catalyze the degradation of 4-OH-E1; the ferroreductin encoded by hedG2 and the ferroreductin reductase encoded by hedG3 can serve as the most compatible electron transport partners with the dioxygenase encoded by hedG1.

[0078] Example 3: Overexpression of the target gene and purification of the gene product

[0079] 3.1 Induction of target gene expression and acquisition of gene product

[0080] E. coli BL21(DE3) engineered bacteria containing the corresponding recombinant plasmid were inoculated into a solution containing 50 mg·L⁻¹ of [amount missing]. -1 After culturing in LB liquid medium at 37°C and 200 rpm for 8 h, 0.4 mM isopropyl-β-D-thiogalactoside (IPTG) was added, and the cells were induced overnight at 18°C ​​and 180 rpm. Cells were centrifuged at 8,000 g and 4°C for 10 min, the supernatant was discarded, and the cells were resuspended in sterile water. Centrifugation was repeated twice under the same conditions, and the cells were resuspended in 15 mL of buffer containing 20 mM HEPES (pH 7.4), 2 mM DTT, 250 mM NaCl, and 5% glycerol (v / v). Then, whole-cell proteins were released using an ultrasonic cell disruptor under the following conditions: disruption power 400 W, total working time 10 min, working time 4 s, and interval time 8 s. 3.2 Purification of gene products HedG1, HedG2, and HedG3

[0081] Cell lysates of engineered bacteria E. coli BL21(DE3)(pET28a-hedG1), E. coli BL21(DE3)(pET28a-hedG2), and E. coli BL21(DE3)(pET28a-hedG3) were centrifuged at 15,000g and 4°C for 10 min, respectively. The supernatant was collected, and HedG1, HedG2, and HedG3 were purified using a His-tagged protein purification kit. The steps were as follows: 1 mL of purification resin (equilibrated before use) was added to approximately 15 mL of the centrifuged supernatant. After thorough contact at 4°C and 100 rpm for 1 h, the mixture was transferred entirely to Ni... 2+ In a 1,3-nitrotriacetic acid (NTA) resin column, the column was sequentially eluted with 1 mL of NTA buffer containing 0, 10, 20, 50, and 80 mM imidazole. The eluent from each NTA buffer was collected, and protein elution was analyzed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Figure 4 After combining the eluates of individual target protein bands, the proteins were dialyzed in 1 L of PBS buffer. Finally, the proteins were concentrated by centrifugation at 3,500 g and 4 °C for at least 40 min using 10 kDa ultrafiltration centrifuge tubes, and the concentrations of HedG1, HedG2, and HedG3 were determined using a BCA protein assay kit.

[0082] Example 4: Catalytic oxidation of 4-OH-E1 by a three-component dual oxygenation system consisting of HedG1, HedG2, and HedG3 (HedG1G2G3).

[0083] 4.1 Catalytic oxidation and enzymatic properties of HedG1G2G3 for 4-OH-E1

[0084] 4.1.1 Enzymatic properties of HedG1G2G3 oxidizing 4-OH-E1

[0085] The reaction system consisted of 0.5 mL Tris-HCl buffer, 50 μM 4-OH-E1, 20 μg HedG1, 1 μg HedG2, 2 μg HedG3, 1 mM NADH / NADPH, and 2 μM Fe. 2+ Composition. The treatment inoculated with the inactivated reductase component (95℃ water bath for 10 min) served as a negative control; the treatment without enzyme inoculation served as a blank control (CK). The reaction started with the enzyme preheated to 25℃. One hour later, the residual concentration of 4-OH-E1 in the reaction system was measured, and the removal rate of 4-OH-E1 was calculated. The results showed that, compared with the two control groups, HedG1G2G3 exhibited significant consumption of 4-OH-E1. Figure 5 a).

[0086] 3.1.2 Cofactor Dependence of HedG1G2G3

[0087] The molar extinction coefficient of NAD(P)H during the reaction time (6220M) was tracked using a light absorption full-wavelength microplate reader. -1 ·cm -1 The changes in the electron transport system (at 340 nm) were used to determine the dependence of the reductase component on NADH or NADPH. Enzymatic characterization results showed that the three-component dual-oxygenation system HedG1G2G3 depended on NADH as an electron donor. Figure 5 b).

[0088] 4.1.3 Enzyme kinetic parameters of HedG1G2G3

[0089] In a 0.5 mL enzyme-catalyzed reaction system (NAD(P)H concentration of 200 μM and substrate concentration varying from 50 to 500 μM), the substrate consumption was indirectly calculated by measuring the NAD(P)H consumption over 10 min (2 mol of NAD(P)H is required to provide electrons for the oxidation of 1 mol of substrate). One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze 1 μM of substrate per minute at 25 °C. The Michaelis constant (Km) was calculated by establishing a double-reciprocal model of reaction rate versus substrate concentration. m ) and maximum reaction rate (V max The results showed that HedG1G2G3 had a K-type affinity for the substrate 4-OH-E1. m and V max The concentrations were 80.5 ± 7.7 μM and 4.6 ± 0.2 U·mg, respectively. -1( Figure 5 c).

[0090] 4.2 Products of the oxidation of 4-OH-E1 by HedG1G2G3

[0091] An equal volume of methanol was added to terminate the enzymatic reaction. After freeze-drying the sample, 5 mL of methanol was added, and the mixture was sonicated for 30 min to extract the reaction product. The mixture was allowed to stand at room temperature for approximately 10 min. The supernatant was transferred to a clean glass tube, and after the methanol had completely evaporated, 1 mL of chromatographic grade methanol was added to redissolve the product. The solution was filtered through a 0.22 μm organic filter membrane and then frozen at –20 °C for analysis. The molecular weight of the product from the oxidation of 4-OH-E1 by HedG1G2G3 was determined by ultra-high performance liquid chromatography-high resolution mass spectrometry (UPLC-HRMS) under the following conditions: 2 μL of sample was injected at 0.4 mL / min. -1 The flow rate was pumped into the UPLC column (2.1 × 100 mm ACQUITY UPLC BEHC18 column). The mobile phase gradient was 0–0.5 min, 5% buffer A; 0.5–11 min, 5%–95% buffer B; 11–13 min, 95% buffer B. Buffer A was ultrapure water containing 0.1% formic acid, and buffer B was methanol containing 0.1% formic acid. HRMS used an electrospray ionization source in positive ion mode to acquire molecular weight, with a acquisition range of 50–1200 m / z. The ionization parameters were set as follows: cone voltage 40 V; capillary voltage 3.0 kV; desolvent gas temperature 400 °C; ion source temperature 120 °C. The analytical results showed that the mass-to-charge ratio (m / z, [M+H]) of the product generated by the oxidation of 4-OH-E1 catalyzed by HedG1G2G3 was... + The m / z of 4-OH-E1 is 319.1478, which is higher than the molecular weight of an oxygen molecule, indicating that HedG1G2G3 can catalyze the double oxygenation reaction of 4-OH-E1, and the resulting oxidation product has the chemical formula C. 18 H 22 O5( Figure 6 ).

[0092] The original 0.5 mL enzyme reaction system was expanded to 100 mL, and the reaction time was extended to 3 h at 25 °C before freeze-drying. Then, 20 mL of methanol was added, and the mixture was sonicated for 30 min to extract the reaction product. After standing at room temperature for 10 min, the supernatant was transferred to a clean glass tube, and after the methanol had completely evaporated, a 1H NMR spectrum was performed. 1 H-NMR analysis was used to characterize the product structure. The sample was dissolved in 0.6 mL of deuterated chloroform, and data were collected at room temperature. 11H-NMR analysis showed that the product was an A-ring cleavage product containing a carboxyl group, while the structures of rings B, C, and D remained unchanged. This structural feature is consistent with the structure of the meta-A-ring cleavage product downstream of 4-OH-E1 reported in previous literature, indicating that HedG1 can catalyze the 4,5-seco oxidative cleavage of 4-OH-E1 with the support of electron transfer via HedG2G3, generating the meta-A-ring cleavage product C. 18 H 22 O5( Figure 7 ).

Claims

1,4,5-Exodiol dioxygenase encoding gene hedG1 The application of the encoded dioxygenase HedG1 in the degradation of 4-hydroxyestradiol, wherein the amino acid sequence of the dioxygenase HedG1 is shown in SEQ ID NO.

4.

2. A three-component dual-oxygenation system composition HedG1G2G3, characterized in that, It consists of dioxygenase HedG1 with the amino acid sequence shown in SEQ ID NO. 4, ferroreductin HedG2 with the amino acid sequence shown in SEQ ID NO. 5, and ferroreductin reductase HedG3 with the amino acid sequence shown in SEQ ID NO.

6.

3. The application of the three-component dual-oxygenation system composition HedG1G2G3 according to claim 2 in the degradation of 4-hydroxyestradiol.

4. An engineered bacterial composition, characterized in that, Genes containing 4,5-exogene dioxygenase hedG1 E. coli with recombinant expression plasmid E. coli BL21(DE3) contains the ferricopentatoxin-encoding gene. hedG2 E. coli with recombinant expression plasmid E. coli BL21(DE3) and genes containing ferritin reductase hedG3 E. coli with recombinant expression plasmid E. coli BL21(DE3) composition; the 4,5-exogene diol dioxygenase encoding gene. hedG1 The nucleotide sequence is shown in SEQ ID NO. 1, and the ferroredoxin encoding gene is described. hedG2 The nucleotide sequence is shown in SEQ ID NO. 2, and the ferroredoxin reductase gene is described. hedG3 The nucleotide sequence is shown in SEQ ID NO.

3.

5. The use of the engineered bacterial composition according to claim 4 in the degradation of 4-hydroxyestradiol.

Images