A dCas9-based c-nhej site-directed inhibition system and application

By binding to DNA break ends with dCas9-sgRNA, the c-NHEJ repair pathway is blocked, solving the off-target effect problem caused by small molecule inhibitors of c-NHEJ in CRISPR gene editing. This achieves site-specific inhibition of c-NHEJ, improving the efficiency and precision of HR-mediated gene editing.

CN116286975BActive Publication Date: 2026-05-29YIMUHE HANGZHOU BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YIMUHE HANGZHOU BIOTECHNOLOGY CO LTD
Filing Date
2023-02-21
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing CRISPR gene editing technologies, c-NHEJ small molecule inhibitors tend to exacerbate off-target effects when improving HR-mediated gene editing efficiency, and global inhibition affects cytotoxicity, making it difficult to achieve targeted and efficient inhibition of c-NHEJ to improve HR repair efficiency.

Method used

A site-specific inhibition system for c-NHEJ based on dCas9 was adopted. By binding dCas9-sgRNA to the DNA break ends, the binding of KU70/KU80 was blocked, thereby site-specifically inhibiting c-NHEJ and promoting HR repair. This included designing dSpCas9-sgRNA to be used in combination with non-SpCas9 nucleases and dSaCas9-sgRNA to be used in combination with non-SaCas9 nucleases to bind to HR-mediated homologous templates.

Benefits of technology

It improves the efficiency of HR-mediated gene editing, including gene-targeted knock-in and correction efficiency, while avoiding the aggravation of off-target effects, achieving site-specific and efficient c-NHEJ inhibition, and enhancing the precision and safety of CRISPR gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004088447520000051
    Figure BDA0004088447520000051
  • Figure BDA0004088447520000061
    Figure BDA0004088447520000061
  • Figure BDA0004088447520000071
    Figure BDA0004088447520000071
Patent Text Reader

Abstract

The application discloses a dCas9-based c-NHEJ site-directed inhibition system and application in improving HR-mediated gene editing efficiency, and the system comprises the following elements: (1) element 1: a nuclease for site-directed induction of DSB in eukaryotic cells and accompanying elements thereof; (2) element 2: dCas9-sgRNA for binding to the end of DNA break; (3) element 3: a homologous template for HR-mediated gene editing. The system synergistically improves gene editing efficiency. The application provides site-directed and efficient inhibition of the c-NHEJ repair pathway, site-directed and efficient improvement of the HR repair efficiency, effective improvement of the HR-mediated CRISPR gene editing efficiency, and reduction of off-target effects.
Need to check novelty before this filing date? Find Prior Art

Description

(I) Technical Field

[0001] This invention relates to a classic non-homologous end junction (c-NHEJ) site-specific suppression system based on dCas9 and its application. (II) Background Technology

[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) gene editing technology originates from an immune defense mechanism in bacteria and archaea, consisting of two elements: a Cas nuclease and a single-guide RNA (sgRNA). After the Cas nuclease and sgRNA assemble into a stable complex, they begin searching for target sequences on the genome. Once a pre-existing spacer sequence is found near the motif PAM, the Cas nuclease interacts with the PAM and unwinds the DNA double helix, allowing the spacer sequence on the sgRNA to pair complementaryly with the single-stranded target DNA, forming an RNA-DNA hybrid. Subsequently, the activated Cas nuclease cleaves both the DNA strand in the RNA-DNA hybrid and the single-stranded non-target DNA strand, producing a DNA double-strand break (DSB). By manipulating the cell's endogenous DSB repair pathway, a certain proportion of the gene-editing product is produced, achieving the goal of gene editing.

[0003] Cas nuclease-induced DNA replication-coupled strand breaks (DSBs) are primarily repaired using two evolutionarily conserved repair pathways within the cell: homologous recombination (HR) and non-homologous end joining (NHEJ). HR is mainly active during the S and G2 phases of the cell cycle, primarily using sister chromatids as homologous templates to repair DSBs coupled to DNA replication. NHEJ, on the other hand, operates throughout the entire cell cycle, repairing DNA breaks by joining the two ends of the DNA fragment. NHEJ is mainly executed by several core factors, including KU70 / KU80, DNA-PKcs, and XRCC4 / DNA ligase 4. This NHEJ pathway is often referred to as classical NHEJ (c-NHEJ). However, when some core NHEJ factors cannot participate in a timely manner, NHEJ can still rely on other factors or substitutes, but with reduced efficiency, increased frequency of deletions or insertions, longer lengths, and a greater need for microhomology (MH) for the joining process. To distinguish it from c-NHEJ, we call this pathway alternative end-joining (a-EJ). During DSB repair, these three repair pathways can compete with each other. Because KU70 / KU80 are among the most abundant proteins in eukaryotic cells and have strong binding affinity to DSB ends, c-NHEJ dominates among these three repair pathways. Inhibiting c-NHEJ significantly improves the utilization of HR and a-EJ. Therefore, inhibiting c-NHEJ using small molecule inhibitors (such as DNA-PKcs inhibitors NU7441, NU7926, M3814, KU0060648, and DNA ligase 4 inhibitor SCR7) is currently a major strategy for improving HR-mediated gene editing efficiency.

[0004] In gene editing, Cas nucleases can perform off-target cleavage, producing off-target effects that severely impact the precision and safety of gene editing. To reduce off-target effects, many research teams have constructed numerous SpCas9 variants with low off-target rates and high gene editing specificity through directed evolution and rational design. However, these designs also come with a certain degree of decreased gene editing efficiency. To improve the gene editing efficiency of these SpCas9 variants, c-NHEJ small molecule inhibitors should be a viable option. However, we found that when using c-NHEJ small molecule inhibitors to enhance HR-mediated CRISPR / Cas gene editing efficiency, these small molecules can also act on off-target sites, increasing α-EJ efficiency and exacerbating off-target effects. Therefore, only a strategy of site-specific inhibition of c-NHEJ, rather than whole-cell non-target inhibition, can both improve the efficiency of target CRISPR / Cas gene editing and avoid the aggravation of off-target effects.

[0005] Our research found that the process of Cas9 nuclease-induced DSB is very unique, especially since Cas9 may remain at the ends of some target sites for a considerable period of time after target cleavage, affecting the end binding of repair factors and ultimately influencing the selection of repair pathways and gene editing results. Although previous studies have suggested that dCas9 target binding can relax adjacent chromatin structures, increasing target recognition and cleavage by CRISPR nucleases in that region, thus improving the efficiency of NHEJ and HR-mediated gene editing, given the strong binding ability of dSpCas9-sgRNA to targets (dissociation constant Kd is approximately 0.2-4 nM), an obvious conjecture is that dSpCas9-sgRNA can block the end binding of DSB repair factors through site competition, inhibiting DSB repair pathways including HR, c-NHEJ, and a-EJ. Moreover, compared to other DSB repair factors, KU70 / KU80 has a stronger terminal binding ability (dissociation constant Kd is approximately 0.15-0.4 nM), and the competition from dSpCas9-sgRNA is more likely to target other factors rather than KU70 / KU80, resulting in a smaller impact on KU70 / KU80-dependent c-NHEJ. However, when we target dCas9 (including SpCas9 and dSaCas9) to the DNA break ends, we found that through site competition, dCas9 can block the terminal binding of c-NHEJ factors KU70 / KU80, but not the terminal binding of HR factor Mre11. Thus, site-specific inhibition of c-NHEJ improves HR efficiency and avoids exacerbating off-target effects. The following invention is designed according to this principle and has been tested and validated. (III) Summary of the Invention

[0006] The purpose of this invention is to provide a site-specific inhibition system based on dCas9 non-homologous end joining (c-NHEJ) and its application. This system improves HR efficiency, achieves the goal of improving the efficiency of HR-mediated gene editing without causing off-target effects, and solves the problems of low efficiency and serious off-target effects in CRISPR gene editing technology. In particular, it overcomes the problem of aggravated off-target effects in the application of c-NHEJ small molecule inhibitors in gene editing.

[0007] The technical solution adopted in this invention is:

[0008] This invention provides a dCas9-based c-NHEJ site-directed inhibition system, comprising: (1) Element 1: a nuclease and its accompanying elements for site-directed induction of DSB in eukaryotic cells; (2) Element 2: dCas9-sgRNA for binding to DNA break ends; and (3) Element 3: a homologous template for HR-mediated gene editing. The system synergistically improves gene editing efficiency.

[0009] The nuclease and its accompanying elements used for site-specific induction of DSB in eukaryotic cells consist of the coding DNA sequences of Cas nuclease and its accompanying sgRNA, such as I-SceI, SpCas9-sgRNA, SaCas9-sgRNA, LbCas12a-sgRNA and various SpCas9-sgRNA variants.

[0010] The dCas9-sgRNA used to bind to DNA break ends consists of DNA sequences encoding dCas9 and its sgRNA; it blocks KU70 / KU80 end binding, site-specifically inhibits c-NHEJ, and promotes HR repair. Examples include dCas9 (dSpCas9) and its associated sgRNA (dSpCas9-sgRNA) from Streptococcus pyogenes and dCas9 (dSaCas9) and its associated sgRNA (dSaCas9-sgRNA) from Staphylococcus aureus. The dSpCas9-sgRNA is suitable for use in combination with non-SpCas9 nucleases that site-specifically induce DSB, and the dSaCas9-sgRNA is suitable for use in combination with non-SaCas9 nucleases that site-specifically induce DSB.

[0011] The homologous template used for HR-mediated gene editing can be an endogenous homologous sequence or an exogenous double-stranded DNA sequence or single-stranded DNA sequence with homologous sequences at both ends and the target sequence in between.

[0012] The present invention also provides an application of the dCas9-based c-NHEJ site-directed inhibition system in improving the efficiency of HR-mediated gene editing, wherein the gene editing efficiency includes gene-targeted knock-in efficiency or gene correction efficiency.

[0013] The c-NHEJ site-specific inhibition system, which aims to inhibit c-NHEJ at specific intracellular sites and enhance HR-mediated gene editing efficiency, was constructed according to the following method:

[0014] 1) Selecting a target site: Based on the goal of gene editing, select the target site for gene editing in the genome of the target cell, such as selecting the Rosa26 endogenous site in mouse embryonic stem cells as the target site for gene knock-in.

[0015] 2) Design Element 1: Select a CRISPR nuclease based on the gene editing target site, design a target spacer sequence accompanying the sgRNA, and construct the CRISPR nuclease and its sgRNA expression plasmid for transfection into target cells, expression within the target cells, site-directed induction of DSB, and gene editing. CRISPR nucleases include LbCas12a, SaCas9, and SpCas9 and their variants, but are not limited to these three types; the accompanying sgRNA backbones of these CRISPR nucleases are different. If Element 1 is LbCas12a or SaCas9, the design of its accompanying sgRNA follows the standard design method. If Element 1 is SpCas9 or its variants eSpCas9 or Cas9-HF1, the design of its accompanying sgRNA and truncated 18-nt sgRNA also follows the standard design method.

[0016] 3) Design Element 2: Based on the type of CRISPR nuclease that induces DSB at site, select the dCas9 type that targets and binds to the sequence near the DSB end. Design a target spacer sequence for the dCas9-accompanying sgRNA based on the sequence near the DSB break. Construct the expression plasmid with the accompanying sgRNA according to standard methods. The sgRNA target position is within 100 bp upstream and downstream of the DSB break, but it cannot overlap with the target sequence of Element 1. In the cell, the dCas9-sgRNA co-expressed with the CRISPR nuclease-sgRNA that induces DSB at site will be guided to the vicinity of the DSB end, bind to its target sequence, block the binding of KU70 / KU80 ends, inhibit c-NHEJ at site, and improve the efficiency of HR-mediated gene editing. The pairing principle between the dCas9 type and the CRISPR nuclease that induces DSB at site follows: dSpCas9 and its accompanying sgRNA are paired with non-SpCas9 nucleases, while dSaCas9 and its accompanying sgRNA are paired with non-SaCas9 nucleases.

[0017] 4) Design Element 3: After selecting the gene editing target site, design a homologous sequence template according to the purpose of gene editing, i.e., correcting the sequence or knocking in a specific gene (when designing a single-stranded homologous sequence, the length of the homologous arm is generally 30-70 bp on each side; when designing a double-stranded homologous sequence, the length of the homologous arm is generally about 400 bp or longer on each side, such as 400-800 bp). For example, in order to correct the I-Sce-GFP gene at the Rosa26 site of mouse embryonic stem cells, a double-stranded or single-stranded correction sequence is designed based on the I-Sce-GFP gene sequence. The correction sequence carries double-stranded or single-stranded homologous sequences on both sides as homologous sequence templates. If it is necessary to insert the GFP gene into the Rosa26 site of mouse embryonic stem cells, a plasmid containing 800 bp homologous sequences on each side is designed and constructed according to the gene knock-in target site. A 2.3 kb GFP gene and its expression cassette are inserted in the middle of the homologous sequences on both sides as an exogenous homologous sequence template.

[0018] The operation steps of the c-NHEJ site-specific inhibition system based on dCas9 to improve the efficiency of HR-mediated gene editing are as follows: In a 24-well plate, element 2 (dCas9-sgRNA expression plasmid), combined with element 1 (target-cleaved CRISPR nuclease-sgRNA expression plasmid) and element 3 (homologous template) as total DNA for transfection, are transiently transfected into target cells (e.g., mouse embryonic stem cells). Flow cytometry or antibiotic selection is performed 3-10 days after transfection to detect gene editing efficiency. In the transfected DNA, the mass ratio of element 1 and element 2 to element 3 is 1:1:2. Taking the target knock-in of the GFP gene at the Rosa26 site in mouse embryonic stem cells as an example, the transfection system of the 24-well plate is set as follows: 200 μL of DMEM medium per well, total cell number 1 x 10⁻⁶. 5 0.5 μg of total DNA (element 1, element 2, and element 3) was transfected into 33 μL of OptiMEM (#11058021, Gibco), and then mixed with 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen). The mixture was allowed to stand for 20 min, then added to one well of a 24-well plate and thoroughly mixed with the cells. Six hours after transfection, DMEM was added to a final volume of 1000 μL. The medium was replaced with fresh medium after 24 hours. Ten days later, the cells were recovered for flow cytometry analysis of GFP knock-in efficiency. In the transfected DNA, element 1 (nuclease cleavage system) and element 2 (dSpCas9-sgRNA) binding systems each accounted for 0.125 μg, with 0.25 μg of DNA homologous template.

[0019] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0020] 1. Site-specific and highly efficient inhibition of the c-NHEJ repair pathway. dCas9 possesses strong binding affinity and persistent retention capacity. At DNA ends, it can effectively compete for space, blocking the DSB end recognition and binding of KU70 / KU80, further hindering the recruitment of DNA-PKcs and XRCC4-DNA ligase 4, thus inhibiting c-NHEJ. However, dCas9's competition for space does not block but rather promotes the DSB end recognition and binding of the HR factor Mre11, thus not inhibiting HR. Therefore, for site-specific DSB induced by I-SceI, LbCas12a, and SaCas9 nucleases, sgRNAs can be designed to accurately bind dSpCas9 near the breakpoint, blocking c-NHEJ end recognition and inhibiting the c-NHEJ repair pathway. Similarly, for site-specific DSB induced by SpCas9-sgRNA variants, sgRNAs can be designed to accurately bind dSaCas9 near the breakpoint, achieving a similar c-NHEJ inhibitory effect.

[0021] 2. Targeted and efficient improvement of HR repair efficiency. dCas9 binds to and inhibits c-NHEJ at the DSB terminal. A portion of the DSB that would normally require c-NHEJ repair will instead use the HR repair pathway, thus improving HR repair efficiency. Under normal circumstances, the repair of most DSBs relies on c-NHEJ; therefore, c-NHEJ inhibition significantly improves HR efficiency, a result that has been confirmed.

[0022] 3. Effectively improves the efficiency of HR-mediated CRISPR gene editing, including targeted gene correction and gene knock-in efficiency. In CRISPR gene editing, HR-mediated gene editing efficiency is relatively low, severely limiting its application and widespread adoption. dCas9-based c-NHEJ site-specific inhibition can effectively improve the efficiency of HR-mediated CRISPR gene editing, including targeted gene correction and gene knock-in efficiency.

[0023] 4. dCas9-based site-specific inhibition of c-NHEJ does not exacerbate off-target effects in CRISPR gene editing. Off-target effects are a serious problem in CRISPR gene editing applications. To improve the efficiency of HR-mediated CRISPR gene editing, a major existing technology utilizes c-NHEJ small molecule inhibitors, such as DNA-PKcs inhibitors NU7441, NU7926, M3814, KU0060648, and DNA ligase 4 inhibitor SCR7. However, global c-NHEJ small molecule inhibitors will increase the utilization rate of α-EJ at off-target sites, exacerbating off-target effects. Furthermore, the global effects of c-NHEJ small molecule inhibitors can cause some cytotoxicity. In contrast, dCas9-based site-specific inhibition of c-NHEJ does not affect the selection of repair pathways at off-target sites. Therefore, this strategy has high specificity, does not aggravate off-target effects, and can replace c-NHEJ small molecule inhibitors, thus improving HR-mediated CRISPR gene editing efficiency while avoiding the worsening of off-target effects. (iv) Description of the attached drawings

[0024] Figure 1 This is a schematic diagram of the three components of the c-NHEJ local suppression system based on dCas9 of the present invention.

[0025] Figure 2 This is a schematic diagram illustrating the application of the c-NHEJ site-specific inhibition system based on dCas9 in gene editing. A represents the schematic diagram of the function when element 2 uses dSpCas9; B represents the schematic diagram of the function when element 2 uses dSaCas9.

[0026] Figure 3 This is a diagram illustrating the competition between dCas9 and c-NHEJ factors Ku70 / Ku80 and HR factor Mre11 for terminal binding in this invention. A represents a schematic diagram of the competitive interaction between element 2 (dCas9-sgRNA) and NHEJ repair factors Ku70 / Ku80 and HR factor Mre11 when it is retained near the target site; B represents a schematic diagram of PCR primers designed at different distances from the DNA break to quantitatively enrich DNA fragments; C represents a bar graph of DNA fragment enrichment by chromatin immunoprecipitation detection element 2 (dCas9) at different distances from the DNA break; D represents a bar graph of DNA fragment enrichment by Ku80 at different distances from the DNA break; E represents a bar graph of DNA fragment enrichment by Mre11 at different distances from the DNA break.

[0027] Figure 4This is a site-specific inhibition diagram of c-NHEJ based on dCas9 in Example 2. A represents a schematic diagram of the NHEJ reporter system and a schematic diagram of adding element 2 at different positions near element 1; B represents the inhibition of c-NHEJ by element 2 when LbCas12a is used as element 1; C represents the inhibition of c-NHEJ by element 2 when SaCas9 is used as element 1. The numbers in parentheses for each sgRNA in B and C represent its distance from the breakpoint induced by element 1.

[0028] Figure 5 This is a site-specific boosting diagram of HR based on dCas9 in Example 3. A represents a schematic diagram of DSB induced near the I-SceI recognition site using element 1 in the HDR reporter system. B represents a schematic diagram of the binding site of element 2 on the HDR reporter system. C represents the effect of the inhibitor and element 2 on HDR repair efficiency when I-SceI is used as element 1; D represents the effect of the inhibitor and element 2 on HDR repair efficiency when LbCas12a is used as element 1; E represents the effect of the inhibitor and element 2 on HDR repair efficiency when SaCas9 is used as element 1. The numbers in parentheses for each sgRNA in CE represent its distance from the breakpoint induced by element 1.

[0029] Figure 6 This is the site-specific enhancement graph for gene targeting correction based on dSpCas9 in Example 4. A represents the gene correction I-SceI-GFP reporter system. B represents the FACS graph showing the effect of c-NHEJ inhibitor NU7441 and element 2 on gene targeting correction efficiency when LbCas12a is used as element 1. C represents the FACS graph showing the effect of NU7441 and element 2 on gene targeting correction efficiency when SaCas9 is used as element 1.

[0030] Figure 7 This is a diagram illustrating the site-specific enhancement of gene targeting knock-in based on dSpCas9 in Example 5. A represents a schematic diagram of the targeted insertion of the GFP gene at the Rosa26 site in mouse cells. B represents a FACS diagram showing the enhanced gene targeting knock-in efficiency induced by element 2 at different locations on element 1 (LbCas12a-gR6d, LbCas12a-gR13c). C represents a FACS diagram showing the enhanced gene targeting knock-in efficiency induced by element 2 at different locations on element 1 (SaCas9-gR6e, SaCas9-gR6f).

[0031] Figure 8This is a graph showing the off-target effects of Example 6. A represents the FACS detection graph of the effect of c-NHEJ inhibitor NU7441 and element 2 on the off-target effects of SaCas9-gSaHR. B represents the FACS detection graph of the effect of NU7441 and element 2 on the off-target effects of LbCas12a-gR-6d. C represents the effect of NU7441 and element 2 on the off-target effects of SaCas9-gR-6f.

[0032] Figure 9 This is a diagram illustrating the gene targeting correction and site-specific enhancement based on dSaCas9 in Example 7. A represents a schematic diagram of the HDR reporter system using element 1 (i.e., I-SceI and SpCas9 variants) to induce DSB near the I-SceI recognition site. The target sites of the two dSaCas9-accompanying sgRNAs are also marked. B represents the effect of using dSaCas9 as element 2 on HDR induced by SpCas9 variants eSpCas9, SpCas9-HF1, and SpCas9-truncated sgRNAs; the number in parentheses for each sgRNA represents its distance from the breakpoint induced by element 1. C represents a schematic diagram of the gene correction I-SceI-GFP reporter system and gene correction. D represents the effect of dSaCas9-sgRNA as element 2 on element 1 (i.e., eSpCas9-gHR). C 2) FACS detection diagram showing the effect of induced gene targeting correction efficiency. E represents dSaCas9-sgRNA as element 2 against element 1 (i.e., SpCas9-HF1-gHR). C 2) FACS detection plot showing the effect of induced gene targeting correction efficiency. F represents dSaCas9-sgRNA as element 2 against element 1 (i.e., SpCas9-gHR). C FACS detection graph showing the effect of gene targeting correction efficiency induced by 4-T17). (V) Detailed Implementation

[0033] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0034] Nucleotide sequence description in the embodiments of this invention:

[0035] SEQ ID NO.1: NHEJ Reporting System (pPGK+Koz-ATG+ATG-GFP).

[0036] SEQ ID NO.2: HDR reporting system (TrGFP+pPGK+I-SceIGFP).

[0037] SEQ ID NO.3: Modified I-SceI-GFP gene correction reporter system (pPGK+I-SceIGFP).

[0038] SEQ ID NO.4: Single-stranded DNA for gene correction (ODNs I-SceIGFP).

[0039] SEQ ID NO.5: Double-stranded DNA core sequence for gene correction (dsDNATrGFP).

[0040] SEQ ID NO.6: Template sequence 1 for gene-targeted knock-in, containing the homologous sequence (mRosa26#6pCMV-GFP).

[0041] SEQ ID NO.7: Homologous sequence 2 for gene-targeted knock-in, containing the homologous sequence (mRosa26#13pCMV-GFP).

[0042] SEQ ID NO.8: Backbone sequence without SpCas9-sgRNA targeting sequence (SpCas9-U6);

[0043] SEQ ID NO.9: Backbone sequence without SaCas9-sgRNA targeting sequence (SaCas9-U6).

[0044] Example 1: The principle of dCas9 terminal binding site-specific inhibition of c-NHEJ

[0045] according to Figure 1 and Figure 2 See Figure 3 When dCas9 (a component of the A-component) is retained near the target site, it competes with the NHEJ repair factors Ku70 / Ku80 and the HR factor Mre11. Specific experimental results are as follows:

[0046] A targeting cleavage site for LbCas12a protein-gLbCas12a-HR (element 1) was designed on the HDR reporter system (TrGFP+pPGK+I-SceIGFP, nucleotide sequence as shown in SEQ ID NO.2) (spacer sequence of gLbCas12a-HR as shown in ATTACCCTGTTATCCCTACGATG), and a binding site for dCas9-gGw4 (element 2) was designed upstream of the DSB cleavage at -54bp to -31bp (gGw4 spacer sequence as shown in CCTCGAACTTCACCTCGGCG). Elements 1 and 2 were transfected into mouse embryonic stem cells carrying the HDR reporter system. 0.5 μg of transfected DNA was mixed with 33 μL of OPTI-MEM to form solution A, and 1.2 μL of Lipofectamine 2000 was mixed with 33 μL of OPTI-MEM to form solution B. After incubating the mixture of solutions A and B for 20 min, the mixture was then incubated with 200 μL of a solution containing 1x10⁻¹⁰ ions / mL of OPTI-MEM.5 The cells were mixed with DMEM culture medium and cultured in 24-well plates. Cell culture conditions were 37°C and 5% CO2. Cells were collected 24 hours after plasmid transfection and subjected to routine chromatin immunoprecipitation (ChIP). Specifically, the ChIP experiment used… The process was performed using the Plus EnzymaticChromatin IP Kit (#9003, CST). First, 1x10... 7 Cells were fixed with 1% formaldehyde at 37°C for 10 min, followed by incubation with 0.125M glycine at room temperature for 5 min to terminate the reaction. Cells were resuspended in 1 mL Buffer A and incubated on ice for 10 min, followed by centrifugation at 3000 rpm at 4°C for 5 min to obtain a precipitate. The precipitate was resuspended in Buffer B and washed once, then resuspended in 100 μL Buffer B, and 0.5 μL Micrococcal nuclease was added for digestion at 37°C for 10 min to digest DNA to a size of 150-600 bp. The digestion reaction was terminated by adding 10 μL 0.5M EDTA, and centrifuged at 12000g at 4°C for 5 min to obtain a precipitate. The precipitate was resuspended in 100 μL ChIP Buffer, and the nuclear membrane was broken by sonication. The precipitate was centrifuged at 12000g at 4°C for 10 min and the precipitate was removed. 100 μL of the supernatant containing chromatin fragments was added to 400 μL ChIP Buffer, and 10 μL was used as an input control. Add 1 μg of antibody (Ku80 antibody, Flag-tagged antibody, Mre11 antibody; and control IgG antibody, as described below) to the remaining liquid and incubate at 4°C for 12 h. Then add 20 μL of Protein G magnetic beads and incubate at 4°C for 2 h. Place the sample on a magnetic rack to adsorb the magnetic beads, remove the supernatant, wash the magnetic beads three times with 1 mL of low-salt solution and once with 1 mL of high-salt solution to obtain the final magnetic beads enriched with the target chromatin. Add 150 μL of ChIP Elution Buffer to each chromatin precipitate sample and input control, incubate at 65°C for 30 min, and use a magnetic rack to adsorb the magnetic beads to obtain the elution buffer. Add 6 μL of 5M NaCl and 2 μL of Proteinase K to the elution buffer and incubate at 65°C for 2 h to decrosslink. Then extract the enriched DNA fragments using a DNA purification column. Design PCR primers (Table 1) at different distances from the DNA break (within 3 kb upstream and downstream of the DSB break point) to quantitatively enrich the DNA fragments and investigate the binding level of the corresponding proteins on the DNA. Figure 3 (B)

[0047] Table 1 Primers used for qPCR detection of target DNA enrichment:

[0048]

[0049]

[0050] (1) Flag antibody against dCas9

[0051] As described above, elements 1 and 2 were transfected into mouse embryonic stem cells carrying an HDR reporter system. Cells were collected after 24 hours for ChIP experiments. Flag antibodies were used to enrich Flag-dSpCas9 of element 2 (dCas9-sgRNA) and the target DNA bound to element 2. Figure 3 As shown in Figure C, in cells transfected with element 1 (i.e., LbCas12a-gLbCas12a-HR) to induce DSB fragmentation, Flag antibody cannot enrich any DNA fragments without sgRNA-mediated target binding of Flag-dCas9, indicating that no dCas9 binds to the DNA sequence of the HDR reporter system (as shown in dSpCas9-CtrlIP:Flag vs. dSpCas9-CtrlIP:IgG). If element 2 (i.e., dSpCas9-gG) cleaves the target, the Flag antibody will not enrich any DNA fragments. W 4) The presence of Flag-dSpCas9 indicates significant enrichment of Flag-dSpCas9 at two sites upstream of the DNA cleavage site of element 1 (LbCas12a-gLbCas12a-HR) in the HDR reporter system: -253bp to -148bp and -102bp to -33bp. This suggests that element 2 (i.e., dSpCas9-gG) is present. W 4) Effectively combines to exert its effect at the target site ( Figure 3 In C, such as dSpCas9-gG W 4 IP: Flag for dSpCas9-gG W 4. IP: IgG (as shown).

[0052] (2) Ku80 antibody

[0053] As described above, elements 1 and 2 were transfected into mouse embryonic stem cells carrying an HDR reporter system. Cells were collected after 24 hours for ChIP experiments. DNA fragment enrichment was performed using an antibody against Ku80; the Ku80-enriched DNA fragments represented the binding sites of Ku80 on the HDR reporter system. In cells transfected with element 1 (i.e., LbCas12a-gLbCas12a-HR) to induce DSB breaks, when there was no sgRNA-mediated target binding of Flag-dCas9 (i.e., element 2 was incomplete), Ku80 was significantly enriched at two sites on the free ends of the DNA: -253bp to -148bp and -102bp to -33bp. Figure 3(dSpCas9 Ctrl IP: Ku80 vs. dSpCas9 Ctrl IP: IgG). If transfected element 2 is intact, element 2 (i.e., dSpCas9-gG) W 4) When Ku80 binds to the target site of the DSB free end generated by DNA cleavage by element 1 (i.e., LbCas12a-gLbCas12a-HR), the binding of Ku80 to the free end is significantly reduced (-253bp to -148bp and -102bp to -33bp), indicating that element 2 (i.e., dSpCas9-gG) W 4) The binding of the Ku70 / Ku80 complex to the DNA ends is hindered. Figure 3 In D, such as dSpCas9-gG W 4 IP: Ku80 to dSpCas9-gG W 4. IP: IgG (as shown).

[0054] (3) Mre11 antibody

[0055] As described above, elements 1 and 2 were transfected into mouse embryonic stem cells carrying an HDR reporter system. Cells were collected after 24 hours for ChIP experiments. DNA fragment enrichment was performed using an antibody against Mre11. The DNA fragments enriched by the Mre11 antibody represent the binding sites of Mre11 on the HDR reporter system. In cells transfected with element 1 (i.e., LbCas12a-gLbCas12a-HR) to induce DSB breakage, when there was no sgRNA-mediated target binding of Flag-dCas9 (i.e., element 2 was incomplete), Mre11 was enriched in small amounts on both sides of the breakage site, especially at -888bp to -801bp and 769bp to 899bp. Figure 3 E, dSpCas9 Ctrl IP:Mre11 vs dSpCas9 Ctrl IP:IgG (as shown). If element 2 of the transfection is intact, element 2 (i.e., dSpCas9-gG) W 4) Mre11 binds to the target site at the free end of the DSB generated by DNA cleavage in element 1 (i.e., LbCas12a-gLbCas12a-HR), and Mre11 binds to the target site in element 2 (i.e., dSpCas9-gG). W 4) The enrichment at the junction is significantly improved, especially at -2736 to -2608 bp, -1825 to -1675 bp, and -888 to -801 bp, where the improvement can be as high as 10 times, indicating that element 2 (i.e., dSpCas9-gG) W 4) The combination not only does not block, but actually promotes the recruitment of Mre11 at the DSB terminal. Figure 3 In E, such as dSpCas9-gG W4 IP: Mre11 vs dSpCas9-gG W 4. IP: IgG (as shown).

[0056] Example 2: dCas9 terminal binding inhibits c-NHEJ participation in terminal DSB repair

[0057] Leveraging the strong binding affinity of dCas9, binding dCas9-sgRNA to the ends of DNA breaks can prevent c-NHEJ from recognizing DNA ends, thereby inhibiting c-NHEJ's participation in end-cell brain spur (DSB) repair. To test this strategy, we induced DSB production using LbCas12a and SaCas9, then used dCas9-sgRNA to bind to the damaged ends to examine the level of NHEJ repair at the break points, comparing the effects with those of DNA-PKcs inhibitor treatment. The specific experimental steps are as follows:

[0058] The NHEJ reporter system (pPGK+Koz-ATG+ATG-GFP, nucleotide sequence shown in SEQ ID NO.1) was used for testing. This reporter system contains a GFP module (i.e., the ATG-GFP module). Under normal conditions, the NHEJ reporter system initiates translation from "Koz-ATG" (i.e., the Koz-ATG module), encoding frameshifted GFP, and the cell does not fluoresce. After inducing DSB between "Koz-ATG" and "ATG-GFP" using a nuclease, the cell will have a certain probability of correctly frameshifting GFP during NHEJ repair, thus causing the cell to emit green fluorescence. While inducing DSB using LbCas12a and SaCas9, multiple sets of dCas9-sgRNAs (sgRNAs are listed in Table 2, including gEJc1, gEJc2, gEJc3, gEJc4, gEJc6, gEJc7, gEJc8, gEJc9, gEJw1, gEJw2, gEJw8, and gEJw9) were designed near the break point to block c-NHEJ. Figure 4 (A). The proportion of green fluorescent cells can be measured by flow cytometry, and the proportion of green fluorescent cells also represents the relative efficiency of m-NHEJ repair.

[0059] Table 2. Spacer sequences targeted by sgRNA targets

[0060]

[0061] (1) DNA-PKcs inhibitors

[0062] Cell transfection was performed in 24-well plates, with transfection element 1 consisting of 0.5 μg LbCas12a-sgRNA or 0.5 μg SaCas9-sgRNA.

[0063] 0.5 μg of transfected DNA (element 1) was dissolved in 1 μL of OptiMEM (#11058021, Gibco) and mixed with 33 μL of OptiMEM containing 1.2 μL of lipofectamine 2000 (#11668019, Invitrogen), resulting in a total transfection mixture of 68.2 μL. The mixture was incubated at room temperature for 20 min. Simultaneously, a suspension of mouse embryonic stem cells containing the NHEJ reporter system was prepared by adding 200 μL of a solution containing 1 x 10⁻⁶ cells / mL of lipofectamine 2000. 5 Cell suspension was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to the well containing 200 μL of cell suspension and mixed thoroughly. After culturing at 37°C for 6 h, DMEM medium containing either 1 mL / L DMSO or 5 μM DNA-PKcs inhibitor NU7441 (TopScience Cat#T6276) was added, and the cells were cultured for another 24 h. The medium was then replaced with 1 mL of fresh medium containing the same concentration of the drug. After 72 h, cells were collected and GFP fluorescence efficiency was detected by flow cytometry. As an inhibitor of C-NHEJ, NU7441 significantly inhibited LbCas12a and SaCas9-induced m-NHEJ efficiency, with inhibition efficiencies of 40% and 25%, respectively. Figure 4 (gCtrl columns of B and C). Because LbCas12a and SaCas9 have strong re-cleavage capabilities, most m-NHEJ products are mediated by the c-NHEJ pathway.

[0064] (2) dSpCas9-sgRNA

[0065] Multiple dCas9-sgRNAs (Table 2) were designed within a 200 bp range upstream and downstream of the DNA breakpoint for end binding to investigate the effect of dCas9 end blocking on the efficiency of LbCas12a and SaCas9-induced m-NHEJ. The distance between the first 3 and 4 positions of each dCas9-recognized PAM sequence and the LbCas12a and SaCas9-induced breakpoints was defined as the dCas9 end binding distance, and was marked on the X-axis of the bar chart.

[0066] Cell transfection was performed in 24-well plates, with 0.25 μg of element 1 (LbCas12a-sgRNA or SaCas9-sgRNA) and 0.25 μg of element 2 (dSpCas9-sgRNA) per well. 0.5 μg (1 μL total) of the DNA to be transfected (element 1 and element 2) was dissolved in 33 μL of OptiMEM (#11058021, Gibco), and mixed with 33 μL of OptiMEM containing 1.2 μL of lipofectamine 2000 (#11668019, Invitrogen), resulting in a total transfection mixture of 68.2 μL. The mixture was incubated at room temperature for 20 min. Simultaneously, a suspension of mouse embryonic stem cells containing the NHEJ reporter system was prepared by adding 200 μL of a solution containing 1 x 10⁻⁶ cells / mL of OptiMEM. 5 A suspension of cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to each well containing 200 μL of cell suspension and mixed thoroughly. After incubation at 37°C for 6 h, 800 μL of fresh DMEM medium was added to each well. After 24 h of transfection, 1 mL of fresh DMEM medium was added. Cells were collected after 72 h, and GFP fluorescence efficiency was detected by flow cytometry. The results were consistent with DNA-PKcs, using gEJ... C 6. gEJ C 7. gEJ C 8. gEJ W 8 or gEJ W 9. dCas9 is bound downstream of the LbCas12a cleavage site, and gEJ is used. C 1. gEJ C 2. gEJ W 1. gEJ C 3. gEJ W 2 or gEJ C 4. Binding dCas9 upstream of the LbCas12a cleavage site significantly reduces the efficiency of LbCas12a-induced m-NHEJ, with an inhibition efficiency of 40%-80%. Figure 4 (B) In SaCas9-induced m-NHEJ, gEJ C 2. gEJ W 1. gEJ C 3. gEJ W 2. gEJ C 4. gEJ C 6. gEJ C 7. gEJ C 8. gEJ W 8 or gEJ W 9 can also effectively inhibit m-NHEJ efficiency, with an inhibition effect of 30%-60%. Figure 4 (C)

[0067] We observed that binding most dCas9-sgRNAs to both sides of LbCas12a or SaCas9-induced breaks within 100 bp effectively reduced the efficiency of LbCas12a and SaCas9-induced m-NHEJ, by up to 4-fold. This effect is consistent with the performance of DNA-PKcs inhibitors in treating LbCas12a and SaCas9-induced m-NHEJ. These results demonstrate that dCas9-sgRNA binding to both sides of DNA break ends can inhibit c-NHEJ.

[0068] Example 3: dCas9 terminal binding inhibits c-NHEJ to promote HDR

[0069] Inhibition of the c-NHEJ pathway promotes the occurrence of the HDR pathway; therefore, we will test whether dCas9 end binding can improve HDR efficiency. HDR efficiency can be tested using an HDR reporter system (TrGFP+pPGK+I-SceIGFP, nucleotide sequence shown in SEQ ID NO.2). This reporter system contains two GFP modules: one is a 5'-deleted GFP (TrGFP), which serves as a homologous template during recombination (a rectangle with a notch upstream of the reporter system), similar to element 3, but inherent in the HDR reporter system itself; the other is a GFP containing the I-SceI site (a rectangle downstream of the reporter system), so normally, cells do not emit any fluorescence. By inducing DSB near the I-SceI site using nucleases, cells can generate green fluorescent cells (wtGFP) via the HDR pathway using the TrGFP homologous sequence of an adjacent sister chromatid as a template (indicated by the purple arrow). Therefore, the proportion of green fluorescent cells represents the relative efficiency of HDR. Figure 5 (A)

[0070] Cell transfection was performed in 24-well plates. Transfection element 1 consisted of 0.5 μg of I-SceI, 0.5 μg of LbCas12a-sgRNA, or 0.5 μg of SaCas9-sgRNA. 0.5 μg (1 μL total) of the DNA to be transfected was dissolved in 33 μL of OptiMEM (#11058021, Gibco), and mixed with another 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen), resulting in a total transfection mixture of 68.2 μL. The mixture was incubated at room temperature for 20 min. Simultaneously, a suspension of mouse embryonic stem cells containing the HDR reporter system was prepared by adding 200 μL of a solution containing 1 x 10⁻⁶ cells / mL of HDR reporter system. 5A suspension of cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to each well containing 200 μL of cell suspension and mixed thoroughly. After incubation at 37°C for 6 h, 800 μL of DMEM medium containing either 1 mL / L DMSO or 5 μM NU7441 (TopScienceCat#T6276) was added to each well. 24 h after transfection, the medium was replaced with 1 mL of fresh DMEM medium containing the same concentration of drug. Cells were collected after 72 h, and GFP fluorescence efficiency was detected by flow cytometry. The results showed that treatment with DNA-PKcs inhibitors effectively improved HDR efficiency (…). Figure 5 (gCtrl in C, D, E)

[0071] Similarly, we designed multiple sets of dCas9-sgRNA ( Figure 5 Table 2 shows the B and sgRNAs, including gG. C 1 to gG C 8. gG C 11-to-gG C 18. gG W 1. gG W 3 to gG W 5. gG W 7 to gG W 11) Test whether dCas9 terminal binding can promote the HDR pathway on an HDR reporter system. The distance between the first 3 and 4 positions of each dCas9-recognized PAM sequence and the induction breakpoint of I-SceI, LbCas12a, or SaCas9 is defined as the dCas9 terminal binding distance, and is marked on the X-axis of a bar chart. Transfect each well of 24 cells with 0.25 μg of element 1 (I-SceI, LbCas12a-sgRNA, or SaCas9-sgRNA) and 0.25 μg of element 2 (dSpCas9-sgRNA), for a total of 1 μL. Dissolve 0.5 μg of DNA (element 1 and element 2) (total 1 μL) to be transfected in 33 μL of OptiMEM (#11058021, Gibco), and mix with 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen), for a total of 68.2 μL of transfection mixture. Incubate at room temperature for 20 min. Simultaneously prepare a suspension of mouse embryonic stem cells containing the HDR reporter system, adding 200 μL of a solution containing 1 x 10⁻⁶ cells / mL of HDR reporter system. 5A suspension of cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to the well containing 200 μL of cell suspension and mixed thoroughly. After culturing at 37°C for 6 h, 800 μL of fresh DMEM medium was added. 24 h after transfection, the medium was replaced with 1 mL of fresh DMEM. Cells were collected after 72 h, and GFP fluorescence efficiency was detected by flow cytometry. Among the 25 designed dCas9-sgRNAs, dCas9 binding at multiple sites enhanced HDR efficiency. In I-SceI-induced HDR, dCas9 terminal binding increased HDR efficiency by up to 5.5-fold; dCas9 terminal binding also increased LbCas12a and SaCas9-induced HDR efficiency by up to 3-fold. Figure 5 (CE). This enhancement effect is consistent with that of DNA-PKcs inhibitor treatment, and in some cases even surpasses the effect of DNA-PKcs inhibition. Generally speaking, the closer the dCas9 blocking site is to the DNA breakpoint, the better the blocking effect and the stronger its ability to enhance HDR efficiency. The farther away from the breakpoint, the weaker or even absent the effect becomes. This may be because DNA-PKcs hardly bind at a distance from the breakpoint, so dCas9 blocking has no effect.

[0072] Example 4: dCas9 terminal binding inhibits c-NHEJ to enhance HDR-mediated gene correction

[0073] dCas9 end binding can inhibit the c-NHEJ pathway and promote end-HDR repair. We will test whether the dCas9 end binding strategy can be applied to improve HDR-based gene correction. The efficiency of gene correction was tested using the I-SceI-GFP gene correction reporter system (pPGK+I-SceIGFP, nucleotide sequence shown in SEQ ID NO.3). Under normal circumstances, I-SceI-GFP expresses inactive GFP, so the cells do not fluoresce. A break was induced near I-SecI, and an exogenous template, including oligodeoxynucleotides (ssODN) or double-stranded DNA (dsDNA), was provided (shown in the dashed box). The exogenous template carries a partially correct GFP sequence. After HDR repair by the homologous sequence on the exogenous template, the cells express GFP fluorescent protein. The gene correction efficiency was obtained by FACS detection. Figure 6 (A). The I-SceI-GFP gene correction reporter system deletes the TrGFP gene from the original HDR reporter system, therefore, exogenous insertion element 3 must be used as the repair template during HDR repair. Homologous templates are introduced using both single-stranded short DNA fragments (ssODN) and double-stranded circular DNA (dsDNA) during testing.

[0074] To compare the effects of element 2 and the DNA-PKcs small molecule inhibitor, we first tested the DNA-PKcs small molecule inhibitor. 24-well plate cells were transfected with element 1 (LbCas12a or SaCas9) to cleave near the I-SceI recognition site of the I-SceI-GFP gene, and element 3 (ssODN, dsDNA) was used as a repair template. The transfected DNA contained 0.25 μg of LbCas12a-sgRNA or SaCas9-sgRNA in the nuclease cleavage system, 0.125 μg of oligodeoxynucleotide homologous template (ssODN, nucleotide sequence as shown in SEQ ID NO. 4), and 0.25 μg of double-stranded DNA homologous template (dsDNA, nucleotide sequence as shown in SEQ ID NO. 5). Dissolve the DNA to be transfected (element 1 and element 3) (1 μL total) in 33 μL of OptiMEM (#11058021, Gibco), and mix with 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen), for a total of 68.2 μL of transfection mixture. Incubate at room temperature for 20 min. Simultaneously prepare a suspension of mouse embryonic stem cells containing a gene correction reporter system, and add 200 μL (containing 1 x 10⁻⁶ cells / mL) to the suspension. 5 A suspension of cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to each well containing 200 μL of cell suspension and mixed thoroughly. After incubation at 37°C for 6 h, 800 μL of DMEM medium containing either 1 mL / L DMSO or 5 μM NU7441 (TopScience Cat#T6276) was added to each well. 24 h after transfection, the medium was replaced with 1 mL of fresh DMEM medium containing the same concentration of drug. GFP fluorescence was detected by flow cytometry after 72 h. + Cell frequency represents the efficiency of gene-targeted correction by cells. Whether using ssODN or dsDNA as a template, the gene correction efficiency induced by LbCas12a and SaCas9 is approximately between 1-2%, and treatment with DNA-PKcs inhibitors can slightly improve the gene correction efficiency. Figure 6 (B,C,NU7441 to DMSO).

[0075] Terminal binding dSpCas9-gG W 4 or dSpCas9-gG C 13 can effectively enhance LbCas12a-induced HDR, while dSpCas9-gG C 7 and dSpCas9-gG C13 can effectively enhance SaCas9-induced HDR, so we also used these dCas9-sgRNAs to investigate the effect of end-blocking on gene correction efficiency. Element 1 (LbCas12a or SaCas9) cuts near the I-SceI recognition site of the I-SceI-GFP gene and binds element 2 (dSpCas9) near the breakpoint, while providing element 3 (ODNs or dsDNA). Transfection contained elements 1, 2, and 3, with plasmid mass allocated in a 1:1:2 ratio, totaling 0.5 μg (1 μL). The DNA to be transfected (elements 1, 2, and 3) (total 1 μL) was dissolved in 33 μL of OptiMEM (#11058021, Gibco), and mixed with 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen), resulting in a total of 68.2 μL of transfection mixture. The mixture was incubated at room temperature for 20 min. Simultaneously prepare a suspension of mouse embryonic stem cells containing a gene correction reporter system, and add 200 μL (containing 1 x 10⁻⁶ cells / mL). 5 A suspension of cells was transferred to one well of a 24-well plate. Each well was transfected with 0.125 μg of element 1 (LbCas12a-sgRNA or SaCas9-sgRNA) and 0.125 μg of element 2 (dSpCas9-sgRNA), 0.25 μg of oligodeoxynucleotide (ssODN) homologous template, and 0.25 μg of double-stranded DNA homologous template. Then, 68.2 μL of the transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to each well containing 200 μL of cell suspension and mixed thoroughly. After culturing at 37°C for 6 h, 800 μL of fresh DMEM medium was added to each well. 24 h after transfection, the medium was replaced with 1 mL of fresh DMEM. Cells were collected after 72 h, and GFP fluorescence efficiency was detected by flow cytometry. The results showed that dSpCas9-sgRNA... W 4 or dSpCas9-gG C 13 binding to the end significantly enhances the efficiency of LbCas12a-mediated gene correction, with the ODNs group showing a nearly 4-fold increase and the dsDNA group showing a nearly 2-fold increase. Figure 6 (Middle B). Similarly, SaCas9-induced gene correction in dSpCas9-gG C 7 and dSpCas9-gG C There was also a significant improvement even with 13% blockade, with an improvement of nearly 2-fold in both ODNs and dsDNA groups. Figure 6 (C)

[0076] Example 5: dCas9 end binding enhances the efficiency of precise targeted integration of large DNA fragments into the genome.

[0077] We investigated whether dCas9 end binding could improve the efficiency of large DNA fragment targeted integration into the genome. The specific experimental procedures are as follows:

[0078] The mouse genomic endogenous site Rosa26 was selected as the gene integration site. LbCas12a and SaCas9 can induce DSB production at this genomic site within cells. Element 3 contains an 800bp homologous sequence of mouse Rosa26, with a complete GFP gene containing the pCMV promoter inserted in the middle. When element 1 induces DSB at the mouse Rosa26 site, cells have a certain probability of using element 3 as a homologous template for HDR repair, thereby stably expressing the GFP gene. A 2.3kb pCMV-β-globin-GFP expression module was used as a reporter gene for precise targeted integration into the genome. Homologous sequences of 800bp length were inserted on both sides of the cleavage site, and this double-stranded circular DNA was used as a template (the reporter gene expression module is shown in SEQ ID No. 6, and the homologous sequences on both sides are shown in SEQ ID No. 7). LbCas12a and SaCas9 induce DSB and use the homologous template for HDR repair, integrating the GFP expression module into the genome, allowing cells to permanently express GFP green fluorescence. Figure 7 (A)

[0079] We designed dCas9-binding sgRNAs flanking the cleavage sites of LbCas21a and SaCas9 for DNA end blocking. Element 1 (LbCas12a or SaCas9-sgRNA) was transfected into 24-well plates after cleavage of the mRosa26 gene. Element 2 (dSpCas9-sgRNA) was used to target and bind to three different sites upstream and downstream of the cleavage site, while element 3 (double-stranded circular DNA) was provided as a homologous template. The plasmid weights of elements 1, 2, and 3 were allocated in a 1:1:2 ratio during transfection. The accompanying sgRNA sequences of element 1 are shown in Table 3, those of element 2 in Table 2, and the core sequences of element 3 are shown in SEQ ID No. 6 and SEQ ID No. 7. For 24-well cells, each well was transfected with 0.125 μg of element 1 (LbCas12a-sgRNA or SaCas9-sgRNA) and 0.125 μg of element 2 (dSpCas9-sgRNA). The homologous template for element 3 was 0.25 μg of double-stranded DNA, totaling 0.5 μg (1 μL). The transfected DNA (elements 1, 2, and 3) (total 1 μL) was dissolved in 33 μL of OptiMEM (#11058021, Gibco), and then mixed with 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen), resulting in a total transfection mixture of 68.2 μL. The mixture was incubated at room temperature for 20 min. Simultaneously, a suspension of mouse embryonic stem cells was prepared by adding 200 μL (containing 1 x 10⁻⁶ cells / mL) to the suspension. 5 A suspension of 200 μL cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture (which had been allowed to stand at room temperature for 20 min) was added to the well containing 200 μL of cell suspension and mixed thoroughly. After incubating at 37°C for 6 h, 800 μL of fresh DMEM medium was added to each well. 24 h after transfection, the DMEM medium was replaced with 1 mL of fresh DMEM. Cells were then passaged every 48 h, and GFP fluorescence was detected by flow cytometry after 10 days. The obtained GFP... + Cell frequency represents the efficiency of targeted gene knock-in in cells.

[0080] Table 3. Spacer sequences targeted by sgRNA targets

[0081] sgRNA name sequence gSa-Gc2 GGCAACATCCTGGGGCACAAGC gSa-Gw6 CGCCCTCGAACTTCACCTCGGC gSa-Gw7 CCTTCAGCTCGATGCGGTTCAC gSa-Gw8 GTTGTACTCCAGCTTGTGCCC gSaEJ AGGATGGATCCTAGGGATAA gSaHR TGAAGGGCATCGTAGGGATAA gSa-R-6e TAAATGTGGTATCTTTAGAACC gSa-R-6f GTATCTTTAGAACCAAGGGTCT gLbCas12a-EJ CCCTGTTATCCCTAGGATCCATC LbCas12a-HR ATTACCCTGTTATCCCTACGATG LbCas12a-R-6d GAACCAAGGGTCTTAGAGTTTTA gLbCas12a-R-13c ACCATTAGGGCAAATGGCAACAT

[0082] At the Rosa26 site, the gene integration efficiencies induced by LbCas12a-gR6d, SaCas9-gR6e, and SaCas9-gR6f were between 1% and 2%, while the gene integration efficiency induced by LbCas12a-gR13c was relatively low, around 0.1%. In the control group, which only underwent GFP template transfection without inducing target site cleavage, the baseline proportion of GFP-positive cells was close to 0 after 10 days, indicating that large DNA fragments are directionally integrated into the target site via the HDR pathway. Figure 7 (B, C). Binding dSpCas9-gR1 to the downstream end of LbCas12a-gR6d-induced DSB increased gene integration efficiency from 1.6% to 2.3%; dSpCas9-gR2 increased the gene integration efficiency induced by LbCas12a-gR13c from 0.15% to 0.3%. Figure 7 (Middle B). In SaCas9-gR6e-induced gene integration, dSpCas9 terminal binding guided by gL1, gR1, gR2, and gR3 all improved integration efficiency to varying degrees, from 2.1% to 2.7-3.2%; while dSpCas9 terminal binding mediated by gL1 and gR3 improved the SaCas9-gR6f-induced gene integration efficiency from 2.6% to 3.5-4.0%. Figure 7 (C)

[0083] Example 6: The effect of dCas9 blocking on off-target effects

[0084] We investigated the impact of dCas9 blockade on off-target effects. Unlike DNA-PK inhibitors, dCas9 targeting the cleavage ends theoretically should not affect off-target sites. Therefore, we selected the cleavage sites of LbCas12a-gR-6d and SaCas9-gR-6f during gene integration to examine off-target effects.

[0085] Transfecting element 1 (LbCas12a-gR6d or SaCas9-gR6f) into 24-well cells resulted in cleavage at the mouse Rosa26 gene locus. Off-target sites were predicted using the CRISPOR website, and deep sequencing of DNA near the cleavage site was performed to detect the probability of base mutations at these sites. The nuclease cleavage system of the transfected DNA consisted of 0.5 μg of LbCas12a-sgRNA or SaCas9-sgRNA (total 1 μL), dissolved in 33 μL of OptiMEM (#11058021, Gibco), and then mixed with 33 μL of OptiMEM containing 1.2 μL of lipofectamine 2000 (#11668019, Invitrogen), resulting in a total transfection mixture of 68.2 μL. The mixture was incubated at room temperature for 20 min. Simultaneously, a suspension of mouse embryonic stem cells was prepared, and 200 μL (containing 1 x 10⁻⁶ cells) was added.5 A suspension of cells was added to one well of a 24-well plate. Then, 68.2 μL of the transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to the well containing 200 μL of cell suspension and mixed thoroughly. After incubating at 37°C for 6 h, 800 μL of DMEM medium containing either 1 mL / L DMSO or 5 μM NU7441 (TopScience Cat#T6276) was added to each well. After 24 h of transfection, the medium was replaced with 1 mL of fresh DMEM medium containing the same concentration of drug.

[0086] In the dSpCas9 end-binding assay, transfection included element 1 and element 2, with plasmid mass allocated 1:1. 0.25 μg of element 1 (LbCas12a-sgRNA or SaCas9-sgRNA) and 0.25 μg of element 2 (dSpCas9-sgRNA) were transfected into each well of a 24-well plate. A total of 68.2 μL of transfection mixture was added and incubated at room temperature for 20 min. Simultaneously, a suspension of mouse embryonic stem cells was prepared by adding 200 μL (containing 1 x 10⁻⁶ sgRNA) to the suspension. 5 A suspension of 100 cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to the well containing 200 μL of cell suspension and mixed thoroughly. After incubating at 37°C for 6 h, 800 μL of fresh DMEM medium was added to each well. After 24 h of transfection, 1 mL of fresh DMEM medium was added. After 72 h, cells were recovered, genomic DNA was isolated and purified, and PCR amplification was performed on the target sites and the 250 bp sequences near the tested off-target sites. Next-generation DNA sequencing was performed using PE150, and routine bioinformatics analysis was conducted to determine the quasi-target and off-target efficiencies. The PCR amplification primer sequences for the quasi-target sites (SaCas9+gSaHR, LbCas12a+gR-6d, and SaCas9+gR-6f) and their corresponding off-target sites are shown in Table 4.

[0087] Table 4 Primers used to detect the editing efficiency of quasi-target and off-target sites.

[0088]

[0089] Treatment with DNA-PKcs inhibitors slightly reduced the editing efficiency at the target site, suggesting that LbCas12a and SaCas9 possess re-cleavage capabilities; however, at off-target sites, DNA-PKcs inhibitors either had no effect on off-target editing efficiency or improved it. When using dSpCas9 for end binding, the editing efficiency at the quasi-target site decreased slightly, suggesting that dSpCas9 inhibited the c-NHEJ pathway at the target site; however, dSpCas9 binding had no effect on the editing efficiency at off-target sites. Figure 8(AC). The off-target effect of a site is obtained by dividing the off-target editing efficiency by the quasi-target editing efficiency. The results show that DNA-PKcs inhibitors exacerbate the off-target effect, while the dSpCas9 end-binding strategy does not aggravate the off-target effect. Figure 8 (AC). Therefore, this invention is a new technology that can target and effectively improve the efficiency of HR-mediated gene integration. The fact that it does not increase off-target effects is a major advantage of this invention over traditional NHEJ inhibitors.

[0090] Example 7: dSaCas9 terminal binding regulates DSB repair pathway selection

[0091] In addition to using dSpCas9 for end-binding regulation of DSB repair pathway selection, this strategy can be extended to different CRISPR systems, such as in conjunction with HDR reporting systems. Figure 9 (A) This study utilizes dSaCas9 for end-binding to enhance HDR efficiency. Because SpCas9 has a stronger end-binding ability than SaCas9, dSaCas9 can only regulate the ends of SpCas9 variants (eSpCas9l and SpCas9-HF1) and uses truncated 17-nt sgRNA in conjunction with SpCas9-induced DSB repair. The aforementioned dSaCas9 is bound to the SpCas9 variant (i.e., eSpCas9-gHR). C 2 and SpCas9-HF1-gHR C 2) Paired with SpCas9, a truncated 17-nt sgRNA (i.e., SpCas9-gHR) C The DSB terminus induced by 4-T17 can be used to test the effect of dSaCas9 terminus binding on the HDR efficiency induced by the SpCas9 variant.

[0092] Therefore, we transfected each well of a 24-well cell plate with 0.25 μg of element 1 (eSpCas9-gHR). C 2. SpCas9-HF1-gHR C 2 or SpCas9-gHR C 4-T17) and 0.25 μg element 2 (dSaCas9 and accompanying sgRNA gSaG) W 7 and gSaG C2. (See Table 3), total 1 μL. Specifically, dissolve 0.5 μg of DNA (element 1 and element 2) (total 1 μL) to be transfected in 33 μL of OptiMEM (#11058021, Gibco), and mix with 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen), for a total of 68.2 μL of transfection mixture. Incubate at room temperature for 20 min. Simultaneously, prepare a suspension of mouse embryonic stem cells containing the HDR reporter system, and add 200 μL containing 1 x 10⁻⁶ cells / mL of HDR reporter system. 5 A suspension of cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to the well containing 200 μL of cell suspension and mixed thoroughly. After incubation at 37°C for 6 h, 800 μL of fresh DMEM medium was added. 24 h after transfection, the medium was replaced with 1 mL of fresh DMEM. Cells were collected after 72 h, and GFP fluorescence efficiency was detected by flow cytometry. We found that dSaCas9-gSaG... C 2. eSpCas9, SpCas9-HF1 and SpCas9-gHR C 4-T17-induced HDR efficiency was improved by 2x, 4x, and 2x respectively, showing a good improvement effect. Figure 9 (B). This indicates that dSaCas9 end binding also acts as a local c-NHEJ inhibitor to promote HDR, demonstrating the strong flexibility and scalability of the dSaCas9 end binding strategy to improve HDR efficiency.

[0093] In cells containing the I-SceI-GFP gene correction reporter system, we further tested the application of a dSaCas9-based end-binding strategy in HDR-mediated gene correction. Figure 9 (C) Select the SpCas9 mutant (i.e., eSpCas9-gHR). C 2 and SpCas9-HF1-gHR C 2) and using SpCas9 with truncated sgRNA (i.e., SpCas9-gHR) C 4-T17) induced fragmentation, and gene correction was performed using ODNs or dsDNA plasmids as homologous templates. 0.125 μg of element 1 (eSpCas9-gHR) was transfected into each well of a 24-well plate. C 2. SpCas9-HF1-gHR C 2 or SpCas9-gHR CThe transfection consisted of 0.125 μg of element 2 (dSaCas9-sgRNA) and 0.125 μg of single-stranded DNA homologous template (ssODN), 0.25 μg of double-stranded DNA homologous template (dsDNA), and a total transfection DNA volume of 1 μL. Element 1 used the accompanying sgRNA gHR. C 2 and gHR C The spacer sequence for 4-T17 target targeting is shown in Table 2. The spacer sequence for sgRNA target targeting used in element 2 is shown in Table 3. The sequence of element 3 is shown in SEQ ID No. 4 and SEQ ID No. 5.

[0094] Specifically, dissolve 1 μL of DNA (element 1 and element 2) (total 1 μL) to be transfected in 33 μL of OptiMEM (#11058021, Gibco), and mix with 33 μL of OptiMEM containing 1.2 μL of Lipofectamine 2000 (#11668019, Invitrogen), for a total of 68.2 μL of transfection mixture. Incubate at room temperature for 20 min. Simultaneously, prepare a suspension of mouse embryonic stem cells containing the I-SceI-GFP gene correction reporter system, and add 200 μL of a solution containing 1 x 10⁻⁶ ppm of ... 5 A suspension of cells was transferred to one well of a 24-well plate. Then, 68.2 μL of transfection mixture, which had been allowed to stand at room temperature for 20 min, was added to the well containing 200 μL of cell suspension and mixed thoroughly. After incubation at 37°C for 6 h, 800 μL of fresh DMEM medium was added. 24 h after transfection, the medium was replaced with 1 mL of fresh DMEM. Cells were collected after 72 h, and GFP fluorescence efficiency was detected by flow cytometry. dSaCas9-gSaG C 2-end binding significantly improved the gene knock-in efficiency induced by eSpCas9 and SpCas9-HF1 by 4-fold, consistent with the effect of treatment with the DNA-PKcs inhibitor NU7441. Figure 9 (D, E). Using truncated gHR C 4-T17 and dSaCas9 terminal binding also improved SpCas9-induced gene correction efficiency by approximately 2-fold, which was slightly less effective than treatment with the DNA-PKcs inhibitor NU7441 (3-fold improvement). Figure 9 These results demonstrate that end binding of dSaCas9 can effectively improve the efficiency of gene correction mediated by high-fidelity SpCas9 mutants, expanding the application of gene knock-in strategies based on dCas9-based local NHEJ inhibitors.

Claims

1. A c-NHEJ site-specific suppression system based on dCas9, characterized in that, The system comprises: (1) Element 1: a nuclease and its accompanying elements for site-specific induction of DSB in eukaryotic cells; (2) Element 2: dCas9-sgRNA for binding to DNA break ends, wherein the dCas9-sgRNA includes dSpCas9-sgRNA or dSaCas9-sgRNA, wherein the dSpCas9 is paired with a non-SpCas9 nuclease and the dSaCas9 is paired with a non-SaCas9 nuclease; (3) Element 3: a homologous template for homologous recombination-mediated gene editing.

2. The c-NHEJ local suppression system based on dCas9 as described in claim 1, characterized in that, The nuclease and its accompanying elements used for site-specific induction of DSB in eukaryotic cells consist of the DNA sequence encoding the Cas nuclease and its accompanying sgRNA.

3. The c-NHEJ local suppression system based on dCas9 as described in claim 1 or 2, characterized in that, The nucleases and their accompanying elements used for site-specific induction of DSB in eukaryotic cells include I-SceI, SpCas9-sgRNA, SpCas9-sgRNA variants, SaCas9-sgRNA, or LbCas12a-sgRNA.

4. The c-NHEJ local suppression system based on dCas9 as described in claim 1, characterized in that, The homologous template used for homologous recombination-mediated gene editing is an endogenous homologous sequence or an exogenous double-stranded DNA sequence or single-stranded DNA sequence with homologous sequences at both ends and the target sequence in between.

5. The application of the c-NHEJ site-directed inhibition system based on dCas9 as described in claim 1 in improving the efficiency of homologous recombination-mediated gene editing.

6. The application as described in claim 5, characterized in that, The gene editing efficiency includes gene-targeted knock-in efficiency or gene correction efficiency.

7. The application as described in claim 5, characterized in that, The c-NHEJ site-specific inhibition system was constructed as follows: 1) Selecting target sites: Based on the target of gene editing, select the target sites for gene editing in the genome of the target cell; 2) Design element 1: Select the CRISPR nuclease based on the gene editing target site, design the target spacer sequence accompanying the sgRNA, and construct the CRISPR nuclease and its sgRNA expression plasmid; 3) Design element 2: Based on the type of CRISPR nuclease that induces DSB at a specific location, select the type of dCas9 that targets and binds to the sequence near the end of DSB, and design the target spacer sequence of dCas9 accompanied by sgRNA based on the sequence near the DSB break. 4) Design element 3: After selecting the gene editing target site, design homologous sequence templates according to the purpose of gene editing.

8. The application as described in claim 7, characterized in that, Step 3) The sgRNA target location is within 100 bp upstream and downstream of the DSB break, but it cannot overlap with the target sequence of element 1.

9. The application as described in claim 7, characterized in that, Step 4) When designing homologous sequences for single-stranded sequences, the length of the homologous arm on both sides should be 30-70 bp; when designing homologous sequences for double-stranded sequences, the length of the homologous arm on both sides should be 400-800 bp.