Application of STRA6 and miR-1249-5p in the preparation of products for diagnosing adenomyosis

By detecting the expression levels of STRA6 and miR-1249-5p and combining them with their inhibitors, the diagnosis and treatment difficulties of adenomyosis were solved, and early diagnosis and effective treatment were achieved.

CN116287211BActive Publication Date: 2025-10-10PEKING UNION MEDICAL COLLEGE HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310297834.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-24
Publication Date
2025-10-10
Estimated Expiration
2043-03-24

AI Technical Summary

Technical Problem

The existing technology lacks effective methods for diagnosing adenomyosis, the diagnostic criteria are limited and often delayed, and the development of drugs based on specific miRNAs and targeted proteins for the detection and treatment of adenomyosis has not been reported. The existing method of using single genes and their expression products as molecular markers has limitations.

Method used

By detecting the mRNA or protein expression level of the STRA6 gene and the expression level of miR-1249-5p, using STRA6 inhibitors such as miR-1249-5p or a recombinant vector of its encoding gene, products and drugs for diagnosing and treating adenomyosis are prepared, including reagents or kits, using specific primers and biological macromolecules to identify STRA6 and miR-1249-5p.

Benefits of technology

It achieves early diagnosis of adenomyosis, improves the accuracy and efficiency of diagnosis, provides the possibility of targeted treatment, and promotes the treatment effect of adenomyosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287211B_ABST
    Figure CN116287211B_ABST
Patent Text Reader

Abstract

The application provides a use of STRA6 and miR-1249-5p in preparation of a product for diagnosing adenomyosis, and relates to the technical field of biology.The inventors have found that vascular smooth muscle cell membranes of patients with adenomyosis have high specific expression of retinoic acid transport associated protein STRA6, and further research has found that the expression of STRA6 is mediated by miR-1249-5p, under the action of estrogen, miR-1249-5p can directly target the 3'-UTR of the STRA6 gene to regulate intracellular retinoic acid metabolism, affect vascular smooth muscle function and participate in the occurrence of adenomyosis.Therefore, the expression amount of the STRA6 gene and miR-1249-5p can realize the diagnosis of adenomyosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of STRA6 and miR-1249-5p in the preparation of a product for diagnosing adenomyosis. Background Art

[0002] In recent years, the incidence of adenomyosis (AM) has increased significantly, reaching 15-50% in women aged 30-50 years and as high as 90% in women with endometriosis-related infertility. Currently, there is a lack of effective treatments for adenomyosis, and diagnostic criteria are very limited, often leading to delayed diagnosis, sometimes as long as 10 years. Therefore, elucidating the pathogenesis of AM has important theoretical and clinical implications for improving patient symptoms, increasing pregnancy rates, and identifying effective targeted therapeutic agents.

[0003] Recent research results indicate that microRNAs (miRs) play an important regulatory role in development, signal transduction, apoptosis, and cell proliferation. Studies have confirmed the presence of hundreds of miRNAs in tissues. These small RNA molecules are stable, abundant, easy to quantify, and have significant disease specificity. Existing mature technologies, including qualitative and quantitative miRNA molecule technologies, indicate that the use of miRNAs as molecular biomarkers will be more effective than traditional specific protein molecular markers, opening up new perspectives for biomarkers. In vascular lesions such as vascular injury and atherosclerosis, miRs regulate the contraction and synthesis of blood vessels by regulating their target genes. Kuokkanen et al. confirmed that estrogen is involved in the regulation of miRNA expression in the human endometrium.

[0004] However, there are still the following shortcomings in the detection of adenomyosis:

[0005] 1. Existing studies use serological miRNAs as biomarkers to diagnose and monitor the occurrence of AM, but the development of potential drug targets for adenomyosis detection, diagnosis, and treatment based on specific miRNAs and targeted proteins has not been reported.

[0006] 2. Currently, single genes and their expression products are publicly available as molecular markers for the diagnosis and treatment of uterine diseases. By measuring the levels of these genes and their expression products in tissues, it is possible to determine whether a subject has a uterine disease or is at risk for a uterine-related disease. However, this approach has significant limitations. Cellular physiological metabolism is precisely regulated and often influenced by factors within and outside the cell's environment.

[0007] In view of this, the present invention is proposed. Summary of the Invention

[0008] The first object of the present application is to provide an application of STRA6 in preparing a product for diagnosing adenomyosis.

[0009] The second object of the present application is to provide an application of miR-1249-5p in preparing a product for diagnosing adenomyosis.

[0010] The third object of the present application is to provide a reagent for diagnosing adenomyosis to solve at least one of the above problems.

[0011] The fourth object of the present application is to provide an application of an inhibitor of STRA6 in preparing a medicine for treating adenomyosis.

[0012] The fifth object of the present application is to provide a medicine for treating adenomyosis.

[0013] In the first aspect, the present application provides an application of STRA6 in preparing a product for diagnosing adenomyosis, wherein the STRA6 is mRNA or protein of STRA6 gene.

[0014] As a further technical solution, the product comprises a reagent or a kit, and adenomyosis is diagnosed by detecting the expression amount of mRNA or protein of STRA6 gene in a subject.

[0015] In the second aspect, the present application provides an application of miR-1249-5p in preparing a product for diagnosing adenomyosis, wherein the nucleic acid sequence of miR-1249-5p is shown in SEQ ID NO. 1.

[0016] As a further technical solution, the product comprises a reagent or a kit, and adenomyosis is diagnosed by detecting the expression amount of miR-1249-5p in a subject.

[0017] In the third aspect, the present application provides a reagent for diagnosing adenomyosis, wherein the reagent comprises at least one of a primer for detecting mRNA of STRA6 gene, a biological macromolecule for detecting protein of STRA6 gene, or a primer for detecting miR-1249-5p.

[0018] The nucleic acid sequence of miR-1249-5p is shown in SEQ ID NO. 1.

[0019] As a further technical solution, the biological macromolecule comprises an antibody or an antibody functional fragment.

[0020] In the fourth aspect, the present application provides an application of an inhibitor of STRA6 in preparing a medicine for treating adenomyosis, wherein the inhibitor inhibits the expression of STRA6 gene.

[0021] As a further technical solution, the inhibitor includes at least one of the following I)-II):

[0022] Ⅰ)miR-1249-5p;

[0023] II) a recombinant vector containing the gene encoding miR-1249-5p;

[0024] The nucleic acid sequence of miR-1249-5p is shown in SEQ ID NO.1.

[0025] In a fifth aspect, the present invention provides a drug for treating adenomyosis, wherein the drug comprises an inhibitor that inhibits the expression of the STRA6 gene.

[0026] As a further technical solution, the inhibitor includes at least one of the following I)-II):

[0027] Ⅰ)miR-1249-5p;

[0028] II) a recombinant vector containing the gene encoding miR-1249-5p;

[0029] The nucleic acid sequence of miR-1249-5p is shown in SEQ ID NO.1.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The inventors have discovered that STRA6 (stimulated by the retinoic acid gene 6 homolog), a protein involved in retinoic acid (RA) transport, is specifically overexpressed on the vascular smooth muscle cell membranes of patients with adenomyosis (AM). Further research has revealed that STRA6 expression is mediated by miR-1249-5p. Under the influence of estrogen, miR-1249-5p can directly target the 3'-UTR of the STRA6 gene to regulate intracellular retinoic acid metabolism, affecting vascular smooth muscle function and participating in the development of AM. Therefore, adenomyosis can be diagnosed by detecting the expression levels of the STRA6 gene and miR-1249-5p. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0033] Figure 1is the volcano plot of differential miRNA;

[0034] Figure 2 is the heat map of differential miRNA clustering;

[0035] Figure 3 is the differential RNA volcano plot;

[0036] Figure 4 Schematic diagram of the pathway of differentially expressed genes with differential mRNA;

[0037] Figure 5 The differential miRNA and mRNA interactions of HA-VSMCs were observed when 250 nM estrogen was treated;

[0038] Figure 6 Luciferase reporter gene assay was used to detect the targeting interaction between miR-1249-5p and STRA6;

[0039] Figure 7 To detect the expression of STRA6 in the vascular smooth muscle cells of the endometrial spiral arteries of AM patients;

[0040] Figure 8 This is the anatomy of the mouse experimental uterus;

[0041] Figure 9 HE staining of mouse uterine tissue;

[0042] Figure 10 Immunohistochemical staining of mouse experimental uterus. DETAILED DESCRIPTION

[0043] Below in conjunction with embodiment and example, embodiment of the present invention is described in detail, but those skilled in the art will appreciate that the following embodiment and example are only used to illustrate the present invention, and should not be considered as limiting the scope of the present invention. Based on the embodiment in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work premise all fall within the scope of protection of the present invention. Unspecified conditions are carried out according to the conditions of normal conditions or manufacturer's recommendations. Reagents used or instruments not specified by the manufacturer are conventional products that can be purchased commercially.

[0044] In a first aspect, the present invention provides use of STRA6 in preparing a product for diagnosing adenomyosis, wherein the STRA6 is the mRNA or protein of the STRA6 gene.

[0045] The inventors have found that, compared with healthy subjects, the mRNA or protein of STRA6 gene is differentially expressed and up-regulated in adenomyosis patients, the expression level of the mRNA or protein of STRA6 gene is related to adenomyosis, and the diagnosis of polycystic ovary syndrome can be realized by detecting the expression level of the mRNA or protein of STRA6 gene.

[0046] In some preferred embodiments, the product comprises a reagent or kit for diagnosing adenomyosis by detecting the expression level of the mRNA or protein of STRA6 gene in the subject.

[0047] In a second aspect, the present application provides an application of miR-1249-5p in preparing a product for diagnosing adenomyosis, wherein the nucleic acid sequence of the miR-1249-5p is shown as SEQ ID NO. 1:

[0048] GGGAGGAGGGAGGAGATGGGCCAAGTTCCCTCTGGCTGGAACG CCCTTCCCCCCCTTCTTCACCTG (SEQ ID NO. 1).

[0049] The inventors have found that the expression of STRA6 is mediated by miR-1249-5p, compared with healthy subjects, the miR-1249-5p is differentially expressed and down-regulated in adenomyosis patients, the expression level of the miR-1249-5p is related to adenomyosis, and the diagnosis of polycystic ovary syndrome can be realized by detecting the expression level of the mRNA or protein of STRA6 gene.

[0050] In some preferred embodiments, the product comprises a reagent or kit for diagnosing adenomyosis by detecting the expression level of the miR-1249-5p in the subject.

[0051] In a third aspect, the present application provides a reagent for diagnosing adenomyosis, wherein the reagent comprises at least one of a primer for detecting the mRNA of STRA6 gene, a biological macromolecule for detecting the protein of STRA6 gene, or a primer for detecting miR-1249-5p.

[0052] The nucleic acid sequence of the miR-1249-5p is shown as SEQ ID NO. 1.

[0053] The reagent provided by the present invention detects the expression level of the STRA6 gene mRNA by using primers that specifically recognize the STRA6 gene mRNA, detects the expression level of the STRA6 gene protein by using biomacromolecules that specifically recognize the STRA6 gene protein, or detects the expression level of miR-1249-5p by using primers that specifically recognize miR-1249-5p. The reagent provided by the present invention diagnoses adenomyosis by detecting the expression level of the STRA6 gene mRNA, the expression level of the STRA6 gene protein, or the expression level of miR-1249-5p.

[0054] In some preferred embodiments, the amplification primers for miR-1249-5p are as follows:

[0055] hsa-mir-1249(40168-1)-P1:

[0056] TGTGGAAAGGACGCGGGATCCAGGACTTTGGTGGATGTCGG (SEQ ID NO. 2);

[0057] hsa-mir-1249(40168-1)-P2:

[0058] CAGCGGTTTAAACTTAAGCTAAAAAAGAGGCAAAAGGGATCCAC AG (SEQ ID NO. 3).

[0059] The protein detection agent can be any reagent known to those skilled in the art, such as a biological macromolecule that can react with the protein and is labeled with a fluorescent marker.

[0060] In some preferred embodiments, the biomacromolecule includes an antibody or a functional fragment of an antibody.

[0061] In a fourth aspect, the present invention provides use of a STRA6 inhibitor in the preparation of a medicament for treating adenomyosis, wherein the inhibitor inhibits the expression of the STRA6 gene.

[0062] The inventors have found through research that inhibiting the expression of the STRA6 gene is helpful in promoting the treatment of adenomyosis.

[0063] In some preferred embodiments, the inhibitor comprises at least one of the following I)-II):

[0064] Ⅰ)miR-1249-5p;

[0065] II) a recombinant vector containing the gene encoding miR-1249-5p;

[0066] The nucleic acid sequence of miR-1249-5p is shown in SEQ ID NO.1.

[0067] The inventors have found through research that the expression of STRA6 is mediated by miR-1249-5p, and miR-1249-5p is an inhibitor of STRA6.

[0068] It should be noted that, in the present invention, the inhibitor of STRA6 may include one or two or more of miR-1249-5p, a recombinant virus containing a gene encoding miR-1249-5p, or a recombinant vector containing a gene encoding miR-1249-5p.

[0069] In a fifth aspect, the present invention provides a drug for treating adenomyosis, wherein the drug comprises an inhibitor that inhibits the expression of the STRA6 gene.

[0070] The inventors have found that inhibiting the expression of the STRA6 gene helps promote the treatment of adenomyosis. The drug provided by the present invention includes an inhibitor that inhibits the expression of the STRA6 gene, which can inhibit the expression of the STRA6 gene and can therefore be used to treat adenomyosis.

[0071] In some preferred embodiments, the inhibitor comprises at least one of the following I)-II):

[0072] Ⅰ)miR-1249-5p;

[0073] II) a recombinant vector containing the gene encoding miR-1249-5p;

[0074] The nucleic acid sequence of miR-1249-5p is shown in SEQ ID NO.1.

[0075] It should be noted that the drug for treating adenomyosis provided by the present invention may include one or two or more of miR-1249-5p, a recombinant virus containing the gene encoding miR-1249-5p, or a recombinant vector containing the gene encoding miR-1249-5p.

[0076] The present invention is further described below by means of specific examples and comparative examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0077] Example 1

[0078] Materials and Methods

[0079] 1. Data Sources

[0080] Uterine tissue was collected from patients who underwent hysterectomy at Peking Union Medical College Hospital between October 2019 and November 2020. Eight patients with amyotrophic lateral sclerosis (AM) were included in the study group, and seven patients were included in the control group. Inclusion criteria for AM patients included: ① Women of childbearing age with regular menstruation; ② Patients with adenomyosis confirmed by total hysterectomy and pathology; ③ No history of hormone therapy within 3 months before surgery; ④ Signed informed consent. Exclusion criteria included: ① Postmenopausal women; ② Patients with malignant diseases that could not be excluded; ③ Concurrent comorbidities with other hormone-related diseases. Inclusion criteria for the control group included: ① Married women of childbearing age with regular menstruation; ② No symptoms such as dysmenorrhea, dyspareunia, and chronic pelvic pain; ③ Patients of childbearing age with CIN III and cervical carcinoma in situ who required total hysterectomy; ④ No use of hormonal medication within 3 months before surgery. Exclusion criteria included: ① Postmenopausal women; ② Preoperative pelvic pain symptoms; ③ Other hormone-related diseases that could not be excluded.

[0081] All patients enrolled in this study signed informed consent, and the experimental procedures were approved by the Academic and Ethics Committee of Peking Union Medical College Hospital.

[0082] 2. Research Methods

[0083] 1. Cell Culture: Thoracic aortic smooth muscle cell line (HA-VSMC) was purchased from ATCC (USA). HA-VSMC were seeded in DNEM medium supplemented with 10% fetal bovine serum, 100 mg / L streptomycin, and 100 kU / L penicillin. Estrogen treatment groups (0 nmol / L and 250 nmol / L) were established, with 0 nmol / L estrogen serving as the control group. Cells were incubated in a cell culture incubator at 37°C and 5% CO₂ for 24 hours, after which they were collected for experiments.

[0084] 2. Uterine Tissue Collection: Wash the tissue with phosphate buffer to remove surface blood. Isolate the uterine spiral arteries from the uterine tissue, and remove all connective and adipose tissue. Fix the tissue in 10% neutral formalin for 4-6 hours. Dehydrate with conventional graded ethanol, clear with xylene, dip into wax, and embed.

[0085] 3. Immunohistochemistry: Paraffin-embedded uterine tissue was sectioned at 4 μm thickness and dewaxed as usual. Endogenous peroxidase was blocked with 3% hydrogen peroxide for 15 minutes, followed by 10% goat serum for 30 minutes to block nonspecific staining. Microwave-heated EDTA antigen retrieval solution was used. Anti-STRA6 polyclonal antibody (Abcam, 1:200) was added, and the sections were incubated at 37°C for 1 hour. Horseradish peroxidase-conjugated anti-rabbit secondary antibody was added, and the sections were incubated at 37°C for 30 minutes. DAB working solution was added, and the sections were developed under a microscope. The sections were counterstained with hematoxylin, blued with ammonia, dehydrated with graded alcohols, mounted with neutral gum, and observed and photographed under a microscope. Two experienced pathologists performed double-blind review of the slides, observing five high-power fields (X200) on each section and scoring the percentage of positive cells and staining intensity.

[0086] 4. miRNA-seq library construction: Total RNA was extracted from HA-VSMC cells and quantified by Qubit. RNA purity was analyzed by Nanodrop assay using OD260 / 280 and OD260 / 230 ratios. The RNA concentration for each group was ≥200 ng / μL, the total amount ≥2 μg, the OD260 / 280 value was between 1.8 and 2.2, the OD260 / 230 value was ≥2.0, and the RIN value as determined by Agilent 2100 Bioanalyzer was ≥7 to ensure high-quality downstream small RNA-seq library construction. 3' and 5' adapters were ligated, single-strand cDNA was synthesized by reverse transcription, PCR amplified, and specific tags were introduced. The miRNA library was separated and purified by polyacrylamide gel electrophoresis (PAGE). High-resolution polyacrylamide gel electrophoresis (PAGE) was used to separate the miRNA library with inserts between 22 and 24 nt. The PAGE gel was excised and the library products were recovered. Library concentration was accurately quantified using a Qubit assay, and fragment size distribution was determined using an Agilent 2100 Bioanalyzer. The library was sequenced using an Illumina high-throughput sequencing platform using a paired-end sequencing strategy. Raw sequencing reads were filtered and used for subsequent analysis.

[0087] 5. mRNA-seq library construction: An appropriate amount of total RNA was collected, rRNA removed, purified, and fragmented. First-strand cDNA was synthesized by reverse transcription. A second-strand synthesis premix was added to the first-strand cDNA synthesis system for 3'-end "A" addition. Sequencing adapters were ligated. The cDNA library was screened and PCR amplified, followed by magnetic bead purification. Library concentration was accurately quantified using a Qubit assay, and fragment size distribution was determined using an Agilent 2100 Bioanalyzer before sequencing. The library was sequenced using an Illumina high-throughput sequencing platform using a 2×150 bp paired-end sequencing strategy. The resulting raw sequence contained some low-quality reads with adapters. To ensure high-quality information analysis, the raw reads were filtered using the TrimGalore method (http: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ) to obtain clean reads for subsequent analysis.

[0088] 6. Co-transfection: Use the co-transfection reagent lipo3000 to transfect miR-1249-5p overexpression plasmid or miR-1249-5p empty plasmid, target gene wild type (STRA6 wild type) or mutant (STRA6 mutant) and Renin fluorescent vector into 293T cells. Observe the transfection efficiency under a fluorescence microscope after 24-28 hours.

[0089] Cell inoculation: Cells in logarithmic growth phase (in good growth condition) were evenly inoculated into 24-well plates. The plates were placed in a cell culture incubator (37°C, 5% CO2) and cultured for 24 hours to allow the cells to adhere well and reach a density of about 50% during transfection.

[0090] Dilute Lipo3000: Dilute 1.5ul Lipo3000 with 25ul Opti per well and mix thoroughly.

[0091] Dilute the plasmid: Use 25ul Opti-MEM to dilute the plasmid (1ug of miR-1249-5p overexpression plasmid or miR-1249-5p empty plasmid, 0.2ug of target gene wild type or mutant type, 0.04ug of Renilla fluorescent vector) in each well, and then add 2ul Lipo3000.

[0092] Prepare the mixture: add the diluted plasmid to the diluted Lipo3000, pipette gently to mix, and incubate at room temperature for 15 minutes.

[0093] The liquid in the 24-well plate was aspirated, and the plate was washed twice with PBS. The liquid in the 24-well plate was aspirated, and serum-free culture medium without double antibody was added.

[0094] Add the transfection complexes sequentially to a 24-well plate pre-seeded with cells, with a final reaction volume of 500ul per well, and mix gently. Change the medium every 6-8 hours with complete culture medium containing double antibody and serum.

[0095] The 24-well plate was placed in a cell culture incubator (37° C., 5% CO 2 ) for culture.

[0096] 7.Luciferase detection

[0097] Formulated Dual- Luciferase Assay Reagent C: Dual- Luciferase Buffer + Dual- Luciferase substrate.

[0098] Formulated Dual- Stop& Detection Reagent D: Before the experiment, calculate the required Dual- Stop& The amount of test reagents. Stop& Buffer was diluted 1:100 with Dual- Stop& Dilute the substrate into a new container.

[0099] The 24-well plate containing cells was taken out of the incubator and allowed to stand for a few minutes to allow the plate to equilibrate to room temperature.

[0100] To detect firefly luciferase activity: Use a pipette to add a volume of C detection reagent equal to the volume of culture medium to each well (for a 24-well plate, add 300 μl of C detection reagent to cells grown in 300 μl of culture medium) and mix thoroughly. After cells are fully lysed, transfer all samples to a light-tight 96-well white plate for detection.

[0101] To detect Renilla luciferase activity: Add 75 μl of Detection Reagent D (the same volume as the initial medium) to each well. Add Detection Reagent D within 4 hours of adding Detection Reagent C. Wait at least 10 minutes before detecting Renilla luciferase signal.

[0102] Calculate the ratio of the primary reporter gene to the internal reference reporter gene signal in each well. Normalize the ratio of each experimental group using the ratio of the control group.

[0103] 3. Statistical Methods

[0104] The results were analyzed using SPSS 24.0 statistical software. The groups were compared using one-way analysis of variance. P ≤ 0.05 was considered statistically significant.

[0105] result

[0106] 1. miRNA-seq differential expression analysis

[0107] 1. Based on the expression levels of known and newly predicted miRNAs, differentially expressed miRNAs were screened using the R software package DESeq2. P < 0.05 and log2 (fold change) ≠ 0 were defined as differentially expressed miRNAs between the two groups. A log2 (fold change) > 0 was labeled as upregulated miRNA (Up); a log2 (fold change) < 0 was labeled as downregulated miRNA (Down). The number of significantly differentially expressed miRNAs is shown in the following table (see Table 1).

[0108] Table 1 Statistics of the number of significantly different miRNAs among HA-VSMC groups

[0109]

[0110] Compared with the control group, the 250nM estrogen treatment group showed significant changes in 56 miRNAs, of which 32 were upregulated and 24 were downregulated; the upregulated ones included ocu-miR-660-3p, ocu-miR-328-3p, ocu-miR-29c-3p, etc.; the downregulated ones included ocu-miR-1249-5p, ocu-miR-671-5p, ocu-miR-365-5p, ocu-miR-152-5p, etc. Figure 1 what Figure 2 As shown. Figure 1 The volcano plot of differential miRNAs shows that the red dots represent the upregulated miRNAs in the treatment group relative to the control sample, and the green dots represent the downregulated miRNAs. Figure 2 This is a heat map of differential miRNA clustering. Red indicates that the gene is highly expressed in the sample, and green indicates that the gene is lowly expressed in the sample.

[0111] 2. mRNA-seq differential expression analysis

[0112] Deseq2 software was used to analyze differentially expressed genes between the treatment group and the control group. Type represents the screening result. Genes with a P < 0.05 and a |log2(fold change)| > 1 were considered differentially expressed. Genes with a log2(fold change) > 1 were marked as upregulated (Up), and genes with a log2(fold change) < -1 were marked as downregulated (Down). The number of significantly differentially expressed genes is shown in Table 2.

[0113] Table 2. Statistics of the number of genes with significant differences

[0114]

[0115] Compared with the control group, the 250nM estrogen treatment group showed significant changes in 89 mRNAs, of which 47 were upregulated and 42 were downregulated; upregulated mRNAs included LGALS2, ETV3L, WDR17, STRA6, etc.; downregulated mRNAs included NRXN2, SRL, PTPRO, etc. Figure 3 and Figure 4 As shown. Figure 3 The volcano plot of differential RNA is shown in Figure 2. Red dots represent mRNAs whose expression levels in the treatment group are upregulated relative to those in the control sample, and green dots represent mRNAs that are downregulated. Figure 4 Schematic diagram of the differentially expressed mRNA gene pathway. Red indicates genes with significant differences between the treatment group and the control sample, and the vertical axis indicates the pathway where the differentially expressed genes are located.

[0116] 3. Prediction of regulatory interactions between differential miRNAs and differential RNAs

[0117] As the concentration of estrogen increases, the expression level of ocu-miR-1249-5p decreases, and the expression level of its target gene STRA6 mRNA increases with the increase of estrogen concentration. The software predicts the binding position and binding strength of miR-1249-5p and STRA6. Figure 5 As shown, it was shown that there was a target regulatory relationship between miR-1249-5p and STRA6.

[0118] 4. miR-1249-5p has a targeting effect on STRA6

[0119] The dual luciferase reporter gene assay was used to detect the targeting relationship between miR-1249-5p and STRA6 3'-UTR. The results showed that the normalized fluorescence intensity of the wild-type target gene control group and the wild-type target gene miR-1249-5p plasmid group was significantly different (P<0.05), while the normalized fluorescence intensity of the mutant target gene control group and the mutant target gene miR-1249-5p plasmid group was not significantly different (P>0.05), indicating that miR-1249-5p and STRA6 have a targeting effect. Figure 6 shown.

[0120] 5. Expression of ocu-miR-1249-5p targeting STRA6 gene in endometrial arteries of AM patients

[0121] Immunohistochemical staining showed that compared with the control group, the expression of STRA6 in the vascular smooth muscle cells of the endometrial spiral arteries of AM patients was significantly increased, with a statistically significant difference (P < 0.05). Figure 7 shown.

[0122] 6. Construction of animal model of adenomyosis

[0123] After delivery of pregnant ICR mice (gestational age, approximately 15-16 days), each mother and her pups were housed in the same cage. From postnatal day 1 to day 4 (PNDs), female neonates were given 1 μg / g body weight of tamoxifen (TAM) via oral gavage daily, suspended in a peanut oil / lecithin / condensed milk mixture (2:0.2:3 v / v / v) or an equal volume of solvent. From postnatal week 5 to 7, 10 μl of siRNA1 (designated the adenomyosis + stra6 siRNA1 group, siRNA1 interference adenomyosis model) and 10 μl of siRNA2 (designated the adenomyosis + stra6 siRNA2 group, siRNA2 interference adenomyosis model) were injected into both uterine horns of mice twice weekly for 3 weeks to observe whether STRA6 interference could improve the development of adenomyosis. All mice were killed at 8 weeks after birth, and the results showed that the uterine thickening in the siRNA interference group was significantly improved. Compared with the uterus of the control group, the uterine cavity of mice with adenomyosis was enlarged, the mucosal layer was relatively thickened, the inner ring and outer longitudinal smooth muscle layers were thinned, and uterine glands were visible in the muscle layer. After treatment with the small RNA interference group, the uterine cavity was reduced, the integrity of the myometrium was increased, and the number of intermuscular glands was reduced, indicating that inhibiting STRA6 through small RNA has a certain therapeutic effect on adenomyosis. The results are as follows Figure 8 , as shown in 9 and 10. Figure 8 This is the anatomical diagram of the mouse experimental uterus. From left to right, they are the control group, adenomyosis model group, siRNA1 interference adenomyosis model group, and siRNA2 interference adenomyosis model group (blue arrows point to uterine tissue).

[0124] Figure 9 Figure 2 shows HE staining of mouse uterine tissue from the control, adenomyosis model, adenomyosis model group treated with siRNA1, and adenomyosis model group treated with siRNA2. EM stands for endometrium, and MM stands for myometrium. The number of intramyogenic uterine glands and the depth of glandular invasion into the myometrium were observed.

[0125] Figure 10Immunohistochemical staining of mouse uteri, taken from the control group, adenomyosis model group, siRNA1 interference adenomyosis model group, and siRNA2 interference adenomyosis model group. CK8, α-SMA, and E-cadherin antibodies were used for hybridization, and the positive enrichment area and volume of each protein were observed.

[0126] The sequence of siRNA1 is: UAGGUUGCUGAAGAGGACC(dT)(dT) (SEQ ID NO. 4);

[0127] The sequence of siRNA2 is: UUGUACUGGAUACCAAAGG(dT)(dT) (SEQ ID NO. 5).

[0128] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a reagent for detecting the expression level of STRA6 gene mRNA or protein in a subject in the preparation of a product for diagnosing adenomyosis.

2. Use of a STRA6 inhibitor in the preparation of a drug for treating adenomyosis, characterized in that: The inhibitor inhibits the expression of the STRA6 gene; The inhibitor is SiRNA1 or SiRNA2; The nucleic acid sequence of the SiRNA1 is shown in SEQ ID NO.4; The nucleic acid sequence of the SiRNA2 is shown in SEQ ID NO.5.

Citation Information

Patent Citations

  • Colorectal cancer detection kit or device, and detection method

    CN112553334A