Lipid compounds and lipid nanoparticle compositions
By combining lipid compounds with other lipid components to form lipid nanoparticles, the problem of low intracellular and extracellular delivery efficiency of nucleic acid therapeutic agents has been solved, achieving efficient and stable delivery of nucleic acid molecules and enhancing their therapeutic and preventive effects.
Patent Information
- Application Number
- CN202211671561.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-12-23
- Filing Date
- 2022-12-22
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2042-12-22
AI Technical Summary
Existing nucleic acid therapeutics face challenges such as low intracellular and extracellular delivery efficiency and sensitivity to degradation of nucleic acid molecules such as RNA, which affect their application in treatment and prevention.
Lipid compounds are combined with other lipid components to form lipid nanoparticles to deliver therapeutic agents such as nucleic acid molecules, including LNA, PNA and morpholine cyclic oligonucleotides, achieving intracellular and extracellular delivery via lipid nanoparticles.
It improves the delivery efficiency of nucleic acid molecules, reduces the risk of degradation of nucleic acid molecules, and enhances their effectiveness in treatment and prevention.
Smart Images

Figure QLYQS_1 
Figure QLYQS_5 
Figure QLYQS_6
Abstract
Description
Technical Field
[0001] This invention generally relates to a lipid compound that can be used to bind with other lipid components (e.g., neutral lipids, cholesterol, and polymer-conjugated lipids) to form lipid nanoparticles for intracellular and extracellular delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimics such as lock (LNA), peptide nucleic acid (PNA), and morpholine ring oligonucleotides), and thereby for therapeutic or preventive purposes, including vaccination. Background Technology
[0002] Therapeutic nucleic acids hold the potential to revolutionize vaccination, gene therapy, protein replacement therapy, and other treatments for genetic diseases. Significant progress has been made since the first clinical studies of therapeutic nucleic acids began in the 2000s, through improvements in the design of nucleic acid molecules and their delivery methods. However, nucleic acid therapeutics still face several challenges, including low cell permeability and high sensitivity to degradation by certain nucleic acid molecules, including RNA. Therefore, there is a need to develop novel nucleic acid molecules, along with related methods and compositions, to facilitate their extracellular or intracellular delivery for therapeutic and / or preventative purposes. Summary of the Invention
[0003] In one embodiment, this document provides lipid compounds, including pharmaceutically acceptable salts or stereoisomers thereof, which can be used alone or in combination with other lipid components such as neutral lipids, charged lipids, steroids (including, for example, all steroids) and / or analogs thereof, and / or lipids conjugated with polymers, and / or polymers, to form lipid nanoparticles for the delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimics such as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholine ring oligonucleotides). In some cases, lipid nanoparticles are used to deliver nucleic acids, such as antisense and / or messenger RNA. Methods for using such lipid nanoparticles to treat various diseases or conditions, such as those caused by infectious entities and / or protein deficiency, are also provided.
[0004] In one embodiment, the compound represented by formula (I) is provided herein:
[0005]
[0006] Or its drug salts or stereoisomers, wherein G, L 1 L 2 L3, R1, R 2 R3 is as defined herein or elsewhere.
[0007] In one embodiment, the present invention provides a nanoparticle composition comprising the compounds provided by the present invention and a therapeutic or preventative agent. In one embodiment, the therapeutic or preventative agent comprises at least one mRNA encoding an antigen or a fragment thereof or an epitope.
[0008] It will be apparent to those skilled in the art that the present invention provides a detailed description of specific embodiments; however, it should be understood that it is given in an illustrative manner only and not in a restrictive manner, and various variations and modifications within the scope of the present invention will be apparent to those skilled in the art. Detailed Implementation
[0009] General technology
[0010] The techniques and methods described or referenced in this invention include conventional methods that are generally readily understood or commonly used by those skilled in the art, such as those described in Molecular Cloning: A Laboratory Manual (3d ed. 2001); Current Protocols in Molecular Biology (Ausubel et al. eds., 2003), etc.
[0011] Ben language
[0012] Unless otherwise described, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of this specification, the following terminology will be used, and where appropriate, terms used in the singular will also include the plural, and vice versa. All patents and other publications disclosed herein are incorporated herein by reference in their entirety. In the event of any conflict between any description or interpretation of terminology herein and any document incorporated herein by reference, the description and interpretation of terminology below shall prevail.
[0013] Unless otherwise stated herein, the term “lipid” refers to a group of organic compounds, including, but not limited to, esters of fatty acids, and characterized by generally poor solubility in water but soluble in many nonpolar organic compounds. Although lipids generally have poor solubility in water, certain classes of lipids (e.g., lipids modified with polar groups such as DMG-PEG2000) have limited water solubility and can be dissolved in water under certain conditions. Known types of lipids include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids are generally classified into at least three categories: (1) “simple lipids,” including fats and oils as well as waxes; (2) “compound lipids,” including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) “derived lipids,” such as steroids. In addition, as used herein, lipids also include lipid-like compounds. The term “lipid-like compounds,” also simply “lipids,” refers to lipid-like compounds such as amphiphilic compounds that have lipid-like physical properties.
[0014] The term "lipid nanoparticle" or "LNP" refers to a particle having a nanometer scale (nm) (e.g., 1 nm to 1,000 nm) that contains one or more types of lipid molecules. The LNPs provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP contains a non-lipid payload molecule partially or completely encapsulated within a lipid shell. Specifically, in some embodiments, the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid component of the LNP contains at least one cationic lipid. It is contemplated that the cationic lipid can interact with the negatively charged payload molecule and promote payload incorporation and / or encapsulation into the LNP during LNP formation. Other lipids that can form part of an LNP, as provided herein, include, but are not limited to, neutral lipids and charged lipids, such as steroids, polymer-conjugated lipids, and various zwitterionic lipids. In some embodiments, the LNP according to the invention comprises one or more lipids of formula (I) (and its subformulas) described herein.
[0015] The term "cationic lipid" refers to a lipid that carries a positive charge at any pH or hydrogen ion activity in its environment, or a lipid capable of carrying a positive charge in response to the pH or hydrogen ion activity of its environment (e.g., its intended use environment). Therefore, the term "cationic" encompasses the range of "permanent cation" and "cationizable." In some embodiments, the positive charge in the cationic lipid originates from the presence of a quaternary nitrogen atom. In some embodiments, the cationic lipid includes zwitterionic lipids that carry a positive charge in the environment in which they are intended to be applied (e.g., at physiological pH). In some embodiments, the cationic lipid is a lipid of one or more of formulas (I) (and their subformulas) described herein.
[0016] The term "polymer-conjugated lipid" or "polymer-conjugated lipid" refers to a molecule that contains both a lipid moiety and a polymer moiety. An example of a polymer-conjugated lipid is a polyethylene glycol-modified lipid (PEG-lipid), in which the polymer moiety comprises polyethylene glycol.
[0017] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged form or a neutral zwitterionic form at a selected pH. In some embodiments, the selected useful pH value or range corresponds to the pH conditions of the environment in which the lipid is intended to be used, such as physiological pH. As a non-limiting example, neutral lipids that may be used in conjunction with the disclosure herein include, but are not limited to, phosphatidylcholines such as 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-dimyristoyl-sn-glycerol-3-phosphate choline (DMPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate choline (POPC), 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC), phosphatidylethanolamines such as 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 2-(((2,3-bis(oleoyloxy)propyl))dimethylammonium phosphate)ethylhydrogen (DOCP), sphingomyelin (SM), ceramides, steroids such as sterols and their derivatives. Neutral lipids can be synthetic or derived (isolated or modified) from natural sources or compounds.
[0018] The term "charged lipid" encompasses any lipid molecule present in a positively or negatively charged form within a selected pH value or range. In some embodiments, the selected pH value or range corresponds to the pH conditions of the intended use environment of the lipid, such as physiological pH. As a non-limiting example, charged lipids that may be used in conjunction with the disclosure herein include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethane carbamoyl sterol (e.g., DC-Chol), sodium 1,2-dioleoyl-sn-glycerol-3-phosphate-L-serine (DOPS-Na), sodium 1,2-dioleoyl-sn-glycerol-3-phosphate-(1′-rac-glycerol) (DOPG-Na), and sodium 1,2-dioleoyl-sn-glycerol-3-phosphate (DOPA-Na). The charged lipids provided in this article may be synthetic or derived (isolated or modified) from natural sources or compounds.
[0019] As described herein, unless otherwise stated, the term "alkyl" refers to a straight-chain or branched hydrocarbon chain group consisting only of saturated carbon and hydrogen atoms. In one embodiment, the alkyl group has, for example, 1 to 24 carbon atoms (C1-C2). 24 Alkyl groups, 4 to 20 carbon atoms (C4-C5) 20 Alkyl groups, 10 to 20 carbon atoms (C 10 -C 20 Alkyl groups, 6 to 16 carbon atoms (C6-C5) 16 Alkyl groups, six to nine carbon atoms (C6-C9 alkyl groups), one to fifteen carbon atoms (C1-C9 alkyl groups) 15 Alkyl groups, with one to twelve carbon atoms (C1-C2). 12 Alkyl groups are composed of one to eight carbon atoms (C1-C8 alkyl) or one to six carbon atoms (C1-C6 alkyl) and are attached to the rest of the molecule by single bonds. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, etc. Unless otherwise stated, alkyl groups are optionally substituted.
[0020] As described herein, unless otherwise stated, the term "alkenyl" refers to a straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon double bonds. As understood by those skilled in the art, the term "alkenyl" also includes groups having "cis" and "trans" configurations, or "E" and "Z" configurations. In one embodiment, the alkenyl group has, for example, 2 to 24 carbon atoms (C2-C4). 24 alkenyl), 4 to 20 carbon atoms (C4-C) 20alkenyl), 6 to 16 carbon atoms (C6-C) 16 alkenyl), six to nine carbon atoms (C6-C9 alkenyl), two to fifteen carbon atoms (C2-C9 alkenyl) 15 alkenyl), two to twelve carbon atoms (C2-C) 12 Alkenes are composed of two to eight carbon atoms (C2-C8 alkenes) or two to six carbon atoms (C2-C6 alkenes), and are attached to the rest of the molecule by single bonds. Examples of alkenes include, but are not limited to, vinyl, propenyl, butenyl, pentenyl, pent-1,4-dienyl, etc. Unless otherwise stated, alkenes are optionally substituted.
[0021] As described herein, unless otherwise stated, the term "alkynyl" refers to a straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group has, for example, 2 to 24 carbon atoms (C2-C4). 24 alkynyl group), 4 to 20 carbon atoms (C4-C) 20 alkynyl group), 6 to 16 carbon atoms (C6-C) 16 Alkyne group, six to nine carbon atoms (C6-C9 alkynyl), two to fifteen carbon atoms (C2-C9 alkynyl) 15 Alkyne group, two to twelve carbon atoms (C2-C) 12 The alkynyl group consists of two to eight carbon atoms (C2-C8 alkynyl) or two to six carbon atoms (C2-C6 alkynyl), and is attached to the rest of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, and pentyynyl. Unless otherwise stated, the alkynyl group is optionally substituted.
[0022] As described herein, unless otherwise stated, the terms "alkylene" or "alkylene chain" refer to a straight-chain or branched divalent hydrocarbon chain in which the remainder of a molecule is attached to a group consisting only of saturated carbon and hydrogen. In one embodiment, the alkylene has, for example, 1 to 24 carbon atoms (C1-C2). 24 Alkylene), 1 to 15 carbon atoms (C1-C5) 15 Alkylene), 1 to 12 carbon atoms (C1-C2) 12 Alkylenes, with 1 to 8 carbon atoms (C1-C8 alkylenes), 1 to 6 carbon atoms (C1-C6 alkylenes), 2 to 4 carbon atoms (C2-C4 alkylenes), and 1 to 2 carbon atoms (C1-C2 alkylenes). Examples of alkylenes include, but are not limited to, methylene, ethylene, propylene, n-butene, etc. The alkylene chain is attached to the rest of the molecule by a single bond and to a free radical group by a single bond. The connection of the alkylene chain to the rest of the molecule and to the free radical group can be via one carbon or any two carbons in the chain. Unless otherwise stated, the alkylene chain is optionally substituted.
[0023] As described herein, unless otherwise stated, the term "alkenyl" refers to a straight-chain or branched divalent hydrocarbon chain in which the remainder of a molecule is attached to a radical group consisting only of carbon and hydrogen, the radical group containing one or more carbon-carbon double bonds. In one embodiment, the alkenyl group has, for example, 2 to 24 carbon atoms (C2-C4). 24 (alkenyl), 2 to 15 carbon atoms (C2-C) 15 (alkenyl), 2 to 12 carbon atoms (C2-C) 12 The alkenyl group consists of 2 to 8 carbon atoms (C2-C8 alkenyl), 2 to 6 carbon atoms (C2-C6 alkenyl), or 2 to 4 carbon atoms (C2-C4 alkenyl). Examples of alkenyl groups include, but are not limited to, vinylene, propenyl, n-butenyl, etc. The alkenyl group is attached to the rest of the molecule by a single or double bond and to a free radical group by a single or double bond. The connection of the alkenyl group to the rest of the molecule and to the free radical group can be via one or any two carbons in the chain. Unless otherwise stated, the alkenyl group is optionally substituted.
[0024] As described herein, unless otherwise stated, the term "cycloalkyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon group consisting only of carbon and hydrogen atoms and being saturated. Cycloalkyl groups can include fused ring or bridged ring systems. In one embodiment, the cycloalkyl group has, for example, 3 to 15 ring carbon atoms (C3-C15 cycloalkyl), 3 to 10 ring carbon atoms (C3-C15 cycloalkyl), etc. 10 Cycloalkyl groups (3 to 8 ring carbon atoms, C3-C8 cycloalkyl groups) are attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl groups include, but are not limited to, adamantyl, norbornyl, decahydroalkyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, etc. Unless otherwise stated, cycloalkyl groups are optionally substituted.
[0025] As stated herein, unless otherwise specified, the term "cycloalkylene" refers to a divalent cycloalkyl group. Unless otherwise specified, cycloalkylene groups may optionally be substituted.
[0026] As described herein, unless otherwise stated, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon group consisting only of carbon and hydrogen atoms and including one or more carbon-carbon double bonds. Cycloalkenyl groups may include fused ring or bridged ring systems. In one embodiment, the cycloalkenyl group has, for example, 3 to 15 cyclic carbon atoms (C3-C4). 15 Cycloalkenyl), 3 to 10 cyclic carbon atoms (C3-C 10The cycloalkenyl group consists of a cycloalkenyl group (3 to 8 ring carbon atoms, C3-C8 cycloalkenyl). The cycloalkenyl group is attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, etc. Unless otherwise stated, the cycloalkenyl group is optionally substituted.
[0027] As stated herein, unless otherwise specified, the term "cycloene-olefin" refers to a divalent cycloene group. Unless otherwise specified, the cycloene-olefin group is optionally substituted.
[0028] As described herein, unless otherwise stated, the term "heterocyclic group" refers to a monocyclic or polycyclic moiety comprising one or more (e.g., one, one or two, one to three, or one to four) non-aromatic groups independently selected from nitrogen, oxygen, phosphorus, and sulfur heteroatoms. A heterocyclic group can be attached to the host structure at any heteroatom or carbon atom. A heterocyclic group can be a monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic system, wherein the polycyclic system can be a fused ring, bridged ring, or spirocyclic system. A heterocyclic polycyclic system can include one or more heteroatoms in one or more rings. A heterocyclic group can be saturated or partially unsaturated. A saturated heterocyclic alkyl group can be referred to as a "heterocyclic alkyl group." A partially unsaturated heterocyclic alkyl group can be referred to as a "heterocyclic alkenyl group" if it contains at least one double bond; and a heterocyclic group can be referred to as a "heterocyclic alkynyl group" if it contains at least one triple bond. In one embodiment, the heterocyclic group has, for example, 3 to 18 ring atoms (3 to 18-membered heterocyclic group), 4 to 18 ring atoms (4 to 18-membered heterocyclic group), 5 to 18 ring atoms (5 to 18-membered heterocyclic group), 4 to 8 ring atoms (4 to 8-membered heterocyclic group), or 5 to 8 ring atoms (5 to 8-membered heterocyclic group). Throughout this document, whenever a numerical range such as “3 to 18” appears, it refers to each integer within the given range. For example, “3 to 18-membered heterocyclic group” means that the heterocyclic group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, up to 18 ring atoms, etc. Examples of heterocyclic groups include, but are not limited to, imidazolyl, imidazoalkyl, oxazolyl, oxazolalkyl, thiazolyl, thiazoalkyl, pyrazolalkyl, pyrazolyl, isoxazolalkyl, isoxazolyl, isothiazolylpyrrole, isothiazolyl, furanyl, furanyl, furanyl, piperidinyl, quinolinyl, and isoquinolinyl. Unless otherwise stated, heterocyclic groups are optionally substituted.
[0029] As stated herein, unless otherwise specified, the term "hypoheterocyclic group" refers to a divalent heterocyclic group. Unless otherwise specified, hypoheterocyclic groups are optionally substituted.
[0030] As described herein, unless otherwise stated, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group comprising at least one aromatic hydrocarbon ring. In some embodiments, the aryl group has 6 to 18 ring carbon atoms (C6-C18 aryl), 6 to 14 ring carbon atoms (C6-C14 aryl), or 6 to 10 ring carbon atoms (C6-C10 aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthracene, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term "aryl" also refers to a bicyclic, tricyclic, or other polycyclic hydrocarbon ring, wherein at least one ring is aromatic, and the other rings may be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, indenyl, or tetrahydronaphthyl (tetrahydronaphthyl). Unless otherwise stated, the aryl group is optionally substituted.
[0031] As used herein, unless otherwise stated, the term "arylene" refers to a divalent aryl group. Unless otherwise stated, arylene groups are optionally substituted.
[0032] As described herein, unless otherwise stated, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein the at least one aromatic ring contains one to three or one to four heteroatoms independently selected from O, S, and N. The heteroatoms in the heteroaryl group can be attached to the host structure at any carbon atom. In some embodiments, the heteroaryl group has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic, or other polycyclic groups, wherein at least one ring is aromatic, and the other rings can be saturated, partially unsaturated, or aromatic, wherein examples of at least one aromatic ring containing one or more monocyclic heteroaryl groups include, but are not limited to, pyrrole, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thiophene, oxadiazolyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothiophene, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolazinyl, benzofuranyl, isobenzofuranyl, oxonaphthyl, furanpyridyl, thienopyridyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzoindolyl, phenanthrolinel, acridinel, phenanthidinel, and xanthine. Unless otherwise stated, heteroaryl groups are optionally substituted.
[0033] As stated herein, unless otherwise specified, the term "hybrid aryl" refers to a divalent heteroaryl group. Unless otherwise specified, the heteroaryl group is optionally substituted.
[0034] When the groups described herein are “substituted,” they can be replaced by any suitable one or more substituents. Illustrative examples of substituents include, but are not limited to, those shown in the exemplary compounds and embodiments provided herein, as well as: halogen atoms such as F, Cl, Br, or I; cyano groups; oxo groups (=O); hydroxyl groups (-OH); alkyl groups; alkenylynylcycloalkylaryl groups -(C=O)OR'; -O(C=O)R'; -C(=O)R'; -S(O) x R';-S-SR';-C(=O)SR';-SC(=O)R';-NR'R';-NR'C(=O)R';-C(=O)NR'R';-NR'C(=O)NR'R';-OC(=O)NR'R';-NR'C(=O)OR';-NR'S(O) x NR'R';-NR'S(O) x R'; and -S(O) x NR′R′, where R′ is independently H, C1-C each time it appears. 15 Alkyl or cycloalkyl, and x is 0, 1, or 2. In some embodiments, the substituent is C. 1- C 12 Alkyl group. In other embodiments, the substituent is cycloalkyl. In other embodiments, the substituent is a halogen group, such as fluorinated. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR'R').
[0035] As described herein, unless otherwise stated, the terms “optional” or “optionally” (e.g., optionally substituted) mean that the event described below may or may not occur, and the description includes instances of the event or condition occurring as well as instances of the event or condition not occurring. For example, “optionally substituted alkyl” means that an alkyl group may or may not be substituted, and the description includes substituted alkyl groups and unsubstituted alkyl groups.
[0036] "Prodrug" refers to a compound that can be converted into a biologically active compound under physiological conditions or by solvent degradation. Therefore, the term "prodrug" refers to a metabolic precursor of a pharmaceutically acceptable biologically active compound. When administered to a subject in need, a prodrug may be inactive but is converted in vivo into the biologically active compound of the present invention. Prodrugs are typically rapidly converted in vivo to the parent biologically active compound of the present invention, for example, by hydrolysis in the blood. Prodrug compounds generally offer advantages such as solubility, tissue compatibility, or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam)). A discussion of prodrugs is provided in Higuchi, T., et al., ACSSymposium Series, Vol. 14, and Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
[0037] In some embodiments, the term "prodrug" also means including any covalently bonded carrier that, when administered to a mammalian subject, releases the active compound of the present invention in vivo. Prodrugs of the compounds of the present invention can be prepared by modifying the functional groups present in the compound, in such a way that the modification is performed by conventional means or by in vivo cleavage to form the parent compound of the present invention. Prodrugs include the following compounds of the present invention: wherein a hydroxyl, amino, or thiol group is bonded to any of the following groups, which, when administered to a mammalian subject, cleave to form a free hydroxyl, free amino, or free thiol group, respectively.
[0038] Examples of “prodrugs” include, but are not limited to, acetates, formates and benzoates of amide derivatives with alcohol or amine functional groups provided herein.
[0039] As stated herein, unless otherwise noted, the term "pharmaceutically acceptable salt" includes acid addition salts and base addition salts.
[0040] Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and organic acids, such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetaminobenzoic acid, camphoric acid, camphor-10-sulfonic acid, decanoic acid, hexanoic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cycloamidoic acid, dodecyl sulfate, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactobionic acid, gentianic acid, and glucohepanoic acid. Glucuronic acid, glucuronic acid, glutamic acid, glutamate, 2-oxoglutamate, glycerophosphate, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucoic acid, naphthalene-1,5-dicarboxylic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, palmitic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanate, p-toluenesulfonic acid, trifluoroacetic acid, undecenoic acid, etc.
[0041] Examples of "pharmaceutically acceptable base addition salts" include, but are not limited to, salts prepared by adding an inorganic or organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. Preferably, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, the following primary, secondary, and tertiary amines, substituted amines (including naturally occurring substituted amines), cyclic amines, and salts of basic ion exchange resins: for example, ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, dealcohol, 2-dimethylaminoethanol, 2-diethylaminoethanol, lysine, arginine, histidine, caffeine, procaine, hydrazine, choline, betaine, benethamine, benzathine penicillin, ethylenediamine, glucosamine, methylglucosamine, theobromine, triethanolamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. Preferably, the organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
[0042] The compounds described herein may contain one or more asymmetric centers and thus may produce enantiomers, diastereomers, and other stereoisomers, which, for amino acids, may be defined in an absolutely stereochemical manner as (R)- or (S)-, or as (D)- or (L)-. Unless otherwise stated, the compounds described herein are intended to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)- or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as chromatography and stepwise crystallization. Conventional techniques for the preparation / separation of individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high-performance liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other geometrically asymmetric centers, unless otherwise stated, the compound is intended to include E and Z-type geometric isomers. Similarly, it is intended to include all tautomer forms.
[0043] As described herein, unless otherwise stated, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the spatial arrangement of their atoms. "Rotated isomers" are stereoisomers whose atoms are hindered from rotating around a single bond. "Enantiomers" are a pair of non-overlapping mirror images of each other. A mixture of any proportion of a pair of enantiomers can be called a "racemic" mixture. "Diadiaomers" are stereoisomers having at least two asymmetric atoms, but which are not mirror images of each other.
[0044] "Stereoisomers" may also include E and Z isomers or mixtures thereof, and cis and trans isomers or mixtures thereof. In some embodiments, the compound described herein is isolated as either an E or Z isomer. In other embodiments, the compound described herein is a mixture of E and Z isomers.
[0045] "Tautomers" refer to the isomers of a compound that are in equilibrium with each other. The concentration of the isomers will vary depending on the environment in which the compound exists, and can also depend on whether the compound is a solid or exists in an organic solution or an aqueous solution.
[0046] The compounds described herein may contain atomic isotopes of non-natural portions on one or more atoms. For example, the compounds may be radiolabeled with radioactive isotopes, such as tritium-3 ( 3 H), Iodine-125 12 5I), sulfur 35 ( 35 S) or carbon-14 ( 14 C), or it could be deuterium ( 2 H), carbon-13 (H), carbon-1313 C) or nitrogen 15 ( 15 N) Isotope enriched. As used herein, “isotope” is an isotope-enriched compound. The term “isotope enriched” means an atom having an isotopic composition different from that of its natural atom. “Isotope enriched” can also mean a compound containing at least one atom whose isotopic composition differs from that of its natural atom. The term “isotopic composition” refers to the amount of each isotope present in a given atom. Radiolabeled and isotope-enriched compounds can be used as therapeutic agents, such as cancer therapeutic agents, research reagents (e.g., binding assay reagents), and diagnostic agents (e.g., in vivo imaging agents). All isotopic variants of the compounds described herein, whether or not radioactive, are intended to be included within the scope of the embodiments provided herein. In some embodiments, isotopes of the compounds described herein are provided, for example, isotopes enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, “deuterated” refers to a compound in which at least one hydrogen (H) is replaced by deuterium (represented by D or 2H), that is, the compound is rich in deuterium at at least one position.
[0047] It should be noted that if there is a difference between the structure described in this article and the name of the structure, the described structure should have greater weight.
[0048] As described herein, unless otherwise stated, the term "pharmaceutically acceptable carrier, diluent, or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, gliding agent, sweetener, diluent, preservative, dye / coloring agent, flavoring agent, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier that has been approved by the U.S. Food and Drug Administration for use in humans or livestock.
[0049] The term "composition" is intended to cover products containing a specified ingredient (e.g., mRNA molecules) optionally in a specified amount.
[0050] The terms “polynucleotide” or “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length, including, for example, DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogues, or any substrate incorporated into the polymer by DNA polymerase or RNA polymerase or by a synthetic reaction. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and their analogues. Nucleic acids can be single-stranded or double-stranded. As described herein and unless otherwise stated, “nucleic acid” also includes nucleic acid mimics such as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholine-cyclic oligonucleotides. As used herein, “oligonucleotide” refers to a short synthetic polynucleotide whose length is typically, but not necessarily, less than about 200 nucleotides. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The above description of polynucleotides applies equally and fully to oligonucleotides. Unless otherwise stated, the left end of any single-stranded polynucleotide sequence disclosed herein is referred to as the 5′ end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5′ direction. The direction of addition of newborn RNA transcripts from 5′ to 3′ is called the transcription direction; the sequence region on the DNA strand that has the same sequence as the RNA transcript and is located at the 5′ to 5′ end of the RNA transcript is called the “upstream sequence”; the sequence region on the DNA strand that has the same sequence as the RNA transcript and is located at the 3′ to 3′ end is called the “downstream sequence”.
[0051] "Isolated nucleic acid" refers to nucleic acids, such as RNA, DNA, or a mixture of nucleic acids, that are substantially naturally separated from other genomic DNA sequences and proteins or complexes (such as ribosomes and polymerases), containing native sequences. An "isolated" nucleic acid molecule is a nucleic acid molecule isolated from other nucleic acid molecules in natural sources. Furthermore, when produced via recombinant technology, "isolated" nucleic acid molecules (e.g., mRNA molecules) may be substantially free of other cellular material or culture media, or when chemically synthesized, may be substantially free of chemical precursors or other chemicals. In one specific embodiment, one or more nucleic acid molecules encoding the antigens described herein are isolated or purified. The term includes nucleic acid sequences that have been removed from their natural environment and includes recombinant or cloned DNA or RNA isolates, as well as chemically synthesized analogs or analogs biosynthesized via heterologous systems. A substantially pure molecule can include an isolated form of the molecule.
[0052] The term “coding nucleic acid” or its grammatical equivalents include: (a) a nucleic acid molecule that, when in its natural state or manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA capable of being translated into peptides and / or polypeptides, and (b) the mRNA molecule itself. The antisense strand is the complementary sequence of the nucleic acid molecule, and the coding sequence can be inferred from it. The term “coding region” refers to the portion of a nucleic acid sequence that is translatable into a peptide or polypeptide. The term “untranslated region” or “UTR” refers to the portion of a nucleic acid that is not translated into a peptide or polypeptide. This depends on the orientation of the UTR relative to the coding region of the nucleic acid molecule; if the UTR is located at the 5′ end of the coding region, it is called a 5′-UTR; if it is located at the 3′ end of the coding region, it is called a 3′-UTR.
[0053] As described herein, the term "mRNA" refers to a messenger RNA molecule containing one or more open reading frames (ORFs), which can be translated by a cell or organism to produce one or more peptide or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In some embodiments, the mRNA molecule also contains one or more untranslated regions (UTRs).
[0054] In some embodiments, the mRNA is a monocistronic mRNA containing only one ORF. In some embodiments, the monocistronic mRNA encodes a peptide or protein containing at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a polycistronic mRNA containing two or more ORFs. In some embodiments, the polycistronic mRNA encodes two or more peptides or proteins that are the same as or different from each other. In some embodiments, each peptide or protein encoded by the polycistronic mRNA contains at least one epitope of a selected antigen. In some embodiments, the different peptides or proteins encoded by the polycistronic mRNA each contain at least one epitope of a different antigen. In any of the embodiments described herein, at least one epitope can be at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten epitopes of an antigen.
[0055] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and their natural or synthetic analogues or derivatives.
[0056] As used herein, the term "functional nucleotide analog" refers to a modified form of a canonical nucleotide A, G, C, U, or T that (a) retains the base-pairing property of the corresponding canonical nucleotide and (b) contains at least one chemical modification of (i) a nucleotide, (ii) a glycosyl group, (iii) a phosphate group, or (iv) any combination of (i) to (iii) of the corresponding native nucleotide. As described herein, base pairs encompass not only standard Watson-Crick AT, AU, or CG base pairs but also base pairs formed between a canonical nucleotide and a functional nucleotide analog or between a pair of functional nucleotide analogs, wherein the arrangement of the hydrogen bond donor and hydrogen bond acceptor allows hydrogen bonds to form between the modified nucleotide and a standard nucleotide or between two complementary modified nucleotide structures. For example, functional analogs of guanosine (G) retain the ability to pair with functional analogs of cytosine (C). An example of such non-canonical base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-natural. Therefore, nucleic acid molecules containing functional nucleotide analogs may have at least one modified nucleobase, glycosyl group, or nucleoside bond. This document provides exemplary chemical modifications to the nucleobase, glycosyl group, or nucleoside bond of nucleic acid molecules.
[0057] As described herein, the terms “translation enhancing element,” “TEE,” and “translation enhancer” refer to a region in a nucleic acid molecule that functions to promote the translation of the coding sequence of the nucleic acid into a protein or peptide product, for example, through cap-dependent or cap-independent translation. TEEs are typically located in the UTR region of nucleic acid molecules (such as mRNA) and can enhance the translation level of upstream or downstream coding sequences. For example, a TEE in the 5′-UTR of a nucleic acid molecule may be located between the promoter and start codon. Various TEE sequences are known in this field (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10 (8β: 747-750; Chappell et al. PNAS June 29. 2004 101 (26β 9590-9594). Some TEEs are known to be conserved in multiple species (Pánek et al. Nucleic Acids Research, Volume 41, Issue 16, 1 September 2013, Pages 7625-7634).
[0058] As described herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions to form at least one double helix and a non-complementary loop. The resulting loop structure is called a stem-loop structure, hairpin, or hairpin loop, which is also a secondary structure present in many RNA molecules.
[0059] As described herein, the term "peptide" refers to a polymer containing 2 to 50 amino acid residues linked by one or more covalent peptide bonds. This term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).
[0060] The terms “peptide” and “protein” are used interchangeably herein and refer to polymers having more than fifty amino acid residues linked by covalent peptide bonds. That is, the description of a peptide is equally applicable to the description of a protein, and vice versa. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the term covers amino acid chains of any length, including full-length proteins (e.g., antigens).
[0061] The term "antigen" refers to a substance that can be recognized by a subject's immune system (including the adaptive immune system) and can generate an immune response (including an antigen-specific immune response) upon contact with the antigen within the subject's body. In some embodiments, the antigen is a protein (e.g., a tumor-associated antigen (TAA)) associated with diseased cells (e.g., cells infected by pathogens or neoplastic cells).
[0062] In the context of peptides or polypeptides, the term "fragment" refers to a peptide or polypeptide that contains less than its full-length amino acid sequence. Such fragments can result from N-terminal truncation, C-terminal truncation, and / or deletion of residues within the amino acid sequence. Fragments can be generated by alternative RNA splicing or by in vivo proteases. In some embodiments, a fragment refers to a polypeptide comprising at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid sequences, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 consecutive amino acid residue sequences. In one specific implementation, the fragment of the polypeptide retains at least one, at least two, at least three or more functions of the polypeptide.
[0063] An epitope is a specific site on the surface of an antigen molecule where an antibody molecule binds. For example, it is a localized region on the surface of an antigen capable of binding to one or more antigen-binding regions of an antibody, possessing antigenic or immunogenic activity in animals such as mammals (e.g., humans), and capable of inducing an immune response. An epitope with immunogenic activity is part of a polypeptide that elicits an antibody response in an animal. An epitope with antigenic activity is part of an antibody-binding polypeptide, as determined by any method known in the art, including, for example, by immunoassay. An antigenic epitope does not necessarily have to be immunogenic. Epitopes typically consist of a collection of chemically active surface groups of a molecule, such as amino acids or sugar side chains, and typically have specific three-dimensional structural features and specific charge features. Antibody epitopes can be linear epitopes or conformational epitopes. Linear epitopes are formed from a continuous sequence of amino acids in a protein. Conformational epitopes are formed from discontinuous amino acids in a protein sequence that bind together when the protein folds into its three-dimensional structure. Induced epitopes are formed when the three-dimensional structure of a protein is in a modified conformation, such as after activation or binding of another protein or ligand. In some embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, epitopes are linear features of a polypeptide. Typically, antigens have several or many different epitopes and can react with many different antibodies.
[0064] As used herein, the term "genetic vaccine" refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (such as an infectious or neoplastic disease). Vaccination (vaccination) encodes the production of peptides or proteins, thereby evoking an immune response against the target disease in the subject. In some embodiments, the immune response includes adaptive immune responses, such as the production of antibodies against the encoded antigen, and / or the activation and proliferation of immune cells capable of specifically eliminating diseased cells expressing the antigen. In some embodiments, the immune response also includes an innate immune response. According to the invention, the vaccine can be administered to the subject before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of healthy or asymptomatic subjects renders the vaccinated subject immune to or less susceptible to the progression of the target disease. In some embodiments, vaccination of subjects with disease symptoms can improve the disease status of the vaccinated subject or treat the disease.
[0065] The terms "innate immune response" and "innate immunity" are well known in the art and refer to the non-specific defense mechanisms initiated by the human immune system when recognizing pathogen-associated molecules. These mechanisms involve various forms of cellular activity, including cytokine production and cell death through various pathways. As described in this invention, the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production). Activation of the innate immune pathway leads to increased proliferation, maturation, differentiation, and / or survival of immune cells, and in some cases, induces apoptosis. The activation of innate immunity can be detected using methods known in the art, such as by measuring... Activation.
[0066] The terms "adaptive immune response" and "adaptive immunity" are well known in the art and refer to antigen-specific defense mechanisms initiated by the human immune system upon recognition of a specific antigen, including humoral and cell-mediated responses. As described in this invention, an adaptive immune response includes a cellular response triggered and / or enhanced by a vaccine composition (such as the genetic composition described herein). In some embodiments, the vaccine composition contains an antigen that is a target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition allows the production of an antigen in an immunized subject after administration, which is a target of an antigen-specific adaptive immune response. Activation of the adaptive immune response can be detected using methods known in the art, such as by monitoring the production of antigen-specific antibodies or monitoring the level of antigen-specific cell-mediated cytotoxicity.
[0067] The term "antibody" is intended to include polypeptide products secreted by effector B cells, consisting of two pairs of identical polypeptide chains, each pair having a heavy chain (approximately 50-70 kDa) and a light chain (approximately 25 kDa), the N-terminal portion of each chain containing a variable region of approximately 100 to approximately 130 or more amino acids, and the C-terminal portion of each chain containing a constant region capable of binding to a specific molecular antigen. Immunoglobulins are not limited to antibodies. See, for example, Antibody Engineering (Borrebaeck ed., 2d ed. 1995) and Kuby, Immunology (3d ed. 1997). In specific embodiments, the specific molecular antigen includes polypeptides, fragments of them, or epitopes that can bind to the antibodies described herein. Antibodies also include, but are not limited to, synthetic antibodies, antibodies produced through recombinant synthesis, camel-derived antibodies, intracellular antibodies, anti-Id antibodies, and functional fragments of these antibodies. A functional fragment of an antibody refers to a functional polypeptide fragment isolated from the aforementioned heavy or light chain of the antibody that retains some or all of its binding activity. Some non-limiting examples of functional fragments include single-chain antibodies (scFv) (including monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide-stabilized antibodies (dsFv), Fd fragments, Fv fragments, bispecific antibodies, trispecific antibodies, tetraspecific antibodies, and microantibodies. In particular, antibodies described herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as molecules containing antigen-binding domains or antigen-binding sites (e.g., one or more CDRs of an antibody). Such antibody fragments can be those described in Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995); Huston et al., 1993, Cell Biophysics 22: 189-224; Plickthun and Skerra, 1989, Meth. Enzym. 178: 497-515; and Day, Advanced Immunochemistry (2nd ed., 1990). The antibodies provided by this invention can be any type of immunoglobulin molecule (such as IgG, IgE, IgM, IgD, and IgA types, etc.) or any subclass (such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2 types, etc.).
[0068] The term "application" refers to the act of delivering an in vitro substance (such as the lipid nanoparticle composition described herein) to a patient, for example, via mucous membranes, intramuscular / subcutaneous injection, intravenous injection, or other physical means known in the art. When used to treat a disease, condition, symptom, or symptom, the substance is typically administered after the onset of the disease, condition, symptom, or symptom. When used to prevent a disease, condition, symptom, or symptom, the substance is typically administered before the onset of the disease, condition, symptom, or symptom.
[0069] "Chronic" dosing refers to the opposite of acute dosing, administered in a continuous manner (e.g., for a period of time, such as days, weeks, months, or years) to maintain the initial therapeutic effect (activity) over an extended period. "Intermittent" dosing is not continuous but periodic, and does not interrupt treatment.
[0070] The term “targeted delivery” or the verb form “target” refers to a process that facilitates the delivery of an agent (e.g., a therapeutic payload molecule in a lipid nanoparticle composition described herein) to a specific organ, tissue, cell, and / or intracellular compartment (referred to as a target site), such that the target site receives more delivery than any other organ, tissue, cell, or intracellular compartment (referred to as a non-target site). Targeted delivery can be detected by methods known in the art, for example by comparing the concentration of the delivered agent in a target cell population with the concentration of the delivered agent in a non-target cell population after systemic administration. In some embodiments, targeted delivery results in a concentration at the target site that is at least 2-fold higher than that at a non-target site.
[0071] An "effective dose" is generally an amount sufficient to reduce the severity and / or frequency of symptoms, eliminate symptoms and / or underlying causes, prevent the occurrence of symptoms and / or their causes, and / or improve or remedy damage. Diseases caused by or related to illnesses, conditions, or symptoms include infections and tumor formation. In some implementations, the effective dose is a therapeutic effective dose or a preventive effective dose.
[0072] As described herein, the term "therapeuticly effective amount" refers to an amount of agent (such as a vaccine composition) sufficient to reduce and / or improve the severity and / or duration of symptoms associated with a given disease, condition, or symptom (such as an infectious disease caused by a viral infection, or a neoplastic disease of cancer, etc.). The "therapeuticly effective amount" of the substances / molecules / agents of this disclosure (such as the lipid nanoparticle compositions described herein) can vary depending on factors such as an individual's disease state, age, sex, and weight, and the ability of the substance / molecule / agent to elicit a desired response in an individual. A therapeutically effective amount includes the amount in which any toxic or adverse effects of the substance / molecule / agent are offset by the beneficial effects of treatment. In some embodiments, the term "therapeuticly effective amount" refers to the amount of a lipid nanoparticle composition or a therapeutic or preventative agent (such as therapeutic mRNA) contained therein that is capable of effectively "treating" a disease, condition, or symptom in a subject or mammal.
[0073] "Prophylactic effective dose" is the amount that, when administered to a subject, will have the expected preventive effect, such as the amount of a pharmaceutical composition that prevents, delays, or reduces the likelihood of the onset (or recurrence) of a disease, condition, or related symptoms (e.g., infectious diseases caused by viral infections or neoplastic diseases such as cancer). It is usually, but not always, effective preventive doses may be less than therapeutically effective doses because a preventive dose is used in the subject before or at an earlier stage of the disease, condition, or symptom. A complete therapeutic or preventive effect does not necessarily occur with the administration of a single dose but may occur only after a series of doses. Therefore, a therapeutic or preventive effective dose can be administered once or multiple times.
[0074] The term "prevention" refers to reducing the likelihood of developing a disease, condition, symptom, or related symptoms (such as infectious diseases, such as those caused by viruses, or neoplastic diseases, such as cancer).
[0075] The term "management" refers to a beneficial effect obtained by a subject from treatment (e.g., a preventative or therapeutic agent) that does not lead to a cure of the disease. In some embodiments, administering one or more therapies (e.g., preventative or therapeutic agents, such as the lipid nanoparticle compositions described herein) to a subject to "manage" one or more symptoms of an infectious or neoplastic disease, thereby preventing the progression or worsening of the disease.
[0076] The term "preventive agent" refers to any medicine that can completely or partially suppress the development, recurrence, onset, or spread of a disease and / or its associated symptoms in a subject.
[0077] The term "therapeutic agent" means any medicine that can be used to treat, prevent or alleviate a disease, condition or symptom, including any medicine used to treat, prevent or alleviate one or more symptoms of a disease, condition or symptom and related symptoms.
[0078] The term "therapy" means any regimen, method, and / or agent that can be used to prevent, manage, treat, and / or improve a disease, condition, or symptom. In some embodiments, the term "therapy" means biological therapies, supportive therapies, and / or other therapies known to those skilled in the art, such as medical personnel, that can be used to prevent, control, treat, and / or improve a known disease, condition, or symptom.
[0079] "Prophylactic effective serum titer" is the serum titer of an antibody in a subject (e.g., a human) that completely or partially inhibits the development, recurrence, onset, or spread of a disease, condition, or symptom and related symptoms.
[0080] In some implementations, "therapeutic effective serum titer" is the serum titer of an antibody in a subject (e.g., a human) that reduces the severity, duration, and / or symptoms associated with a disease, condition, or symptom.
[0081] The term “serum titer” refers to the average serum titer from multiple samples (e.g., at multiple time points) or from a population of at least 10, at least 20, at least 40, or at most about 100, 1000, or more subjects.
[0082] The term "side effect" encompasses undesirable and / or adverse effects of a therapy (such as a prophylactic or therapeutic agent). Harmful effects are not necessarily adverse. Adverse effects of a therapy (such as a prophylactic or therapeutic agent) may be harmful, uncomfortable, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, difficulty breathing, insomnia, dizziness, mucositis, neuromuscular effects, fatigue, dry mouth, loss of appetite, rash or swelling at the administration site, flu-like symptoms such as fever, chills, fatigue, digestive problems, and allergic reactions. Other undesirable effects experienced by patients are known in the art and are described in Physician's Desk Reference (68th ed. 2014).
[0083] The terms "subject" and "patient" are used interchangeably. As described herein, in some embodiments, the subject is a mammal, such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In a particular embodiment, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious or neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious or neoplastic disease.
[0084] The term "detectable probe" refers to a composition that provides a detectable signal. This term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody, or antibody fragment that provides a detectable signal through its activity.
[0085] The term "detectable agent" refers to a substance that can be used to determine the presence of a desired molecule in a sample or subject, such as an antigen encoded by an mRNA molecule as described herein. A detectable agent can be a substance that can be visualized or that can be identified and / or measured (e.g., by quantification).
[0086] "Substantially all" means at least approximately 60%, at least approximately 65%, at least approximately 70%, at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95%, at least approximately 98%, at least approximately 99%, or approximately 100%.
[0087] As described herein, unless otherwise stated, the terms "approximately" or "approximately" refer to an acceptable error for a particular value as determined by one of ordinary skill in the art, depending in part on how the value was measured or determined. In some embodiments, the terms "approximately" or "approximately" mean within 1, 2, 3, or 4 standard deviations. In some embodiments, the terms "approximately" or "approximately" mean within or less 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.05% of a given value or range.
[0088] Unless the context clearly indicates otherwise, the singular terms “a,” “an,” and “the” used herein include their plural forms.
[0089] All publications, patent applications, registry numbers, and other references cited in this specification are incorporated herein by reference in their entirety, and each individual publication or patent application is expressly and individually incorporated by reference. The published publications discussed herein are those published prior to the filing date of this application. Nothing herein shall be construed as an admission that the invention is not entitled to precedence over such publications by virtue of a prior invention. Furthermore, the publication dates provided herein may differ from the actual publication dates, which may require independent verification.
[0090] Several embodiments of the present invention have been described. However, it will be understood that various modifications can be made without departing from the spirit and scope of the invention. Therefore, the descriptions in the experimental section and embodiments are intended to illustrate, and not limit, the scope of the invention as described in the claims.
[0091] lipid compounds
[0092] In one embodiment, the compound represented by formula (I) is provided herein:
[0093]
[0094] Or its drug salts or stereoisomers, wherein:
[0095] G is either N or CH;
[0096] L 1 L 2 and L 3 Each is independently selected from a bond or a C1-C8 alkylene group;
[0097] R 1 Selected from -C(O)OR 4 or -OC(O)R 9 ;
[0098] R 2 Selected from -C(O)OR 5 C3-C8 cycloalkyl, C1-C8 alkyl, -OC(O)R 10 -C(O)NHC 10 -C 20 Alkyl or -NHC(O)C 10 -C 20 alkyl;
[0099] R 3 Selected from
[0100] R 4 C 10 -C 20 alkyl;
[0101] R 5 C 10 -C 20 alkyl;
[0102] R 6 Selected from -C(O)(CH2) 1-8 N(C 1- C8 alkyl)C1-C8 alkyl, C1-C8 alkyl or -(CH2) 1.8 C(O)OR 11 ;
[0103] R 7 It is -(CH2)1-8N(C1-C8 alkyl)C1-C8 alkyl;
[0104] R 8 It is -(CH2)1-8N(C1-C8 alkyl)C1-C8 alkyl;
[0105] R 9 C 10 -C20 alkyl;
[0106] R 10 C 10 -C 20 alkyl;
[0107] R 11 C 10 -C 20 Alkyl; and
[0108] * indicates a connection point.
[0109] In one implementation, in equation (I),
[0110] G is N;
[0111] L1, L2, and L3 are each independently C 1- C8 alkylene;
[0112] R1 is -C(O)OR4;
[0113] R2 is -C(O)OR5;
[0114] R 3 for
[0115] R 4 C 10 -C 20 alkyl;
[0116] R 5 C 10 -C 20 alkyl;
[0117] R 6 Selected from -C(O)(CH2) 1-8 N(C1-C8 alkyl)C l -C8 alkyl or C1-C8 alkyl; and
[0118] * indicates a connection point.
[0119] In one implementation, in equation (I),
[0120] G is N;
[0121] L 1 L 2 and L 3 Each is independently a C1-C8 alkylene group;
[0122] R 1 -C(O)OR 4 ;
[0123] R 2-C(O)OR 5 ;
[0124] R 3 Selected from
[0125] R 4 C 10 -C 20 alkyl;
[0126] R 5 C 10 -C 20 alkyl;
[0127] R 7 -(CH2) 1-8 N(C1-C8 alkyl)C1-C8 alkyl;
[0128] R 8 It is -(CH2)1-8N(C1-C8 alkyl)C1-C8 alkyl; and
[0129] * indicates a connection point.
[0130] In one implementation, in equation (I),
[0131] G is N;
[0132] L 1 and L 3 Each is independently a C1-C8 alkylene group;
[0133] L 2 For key;
[0134] R 1 -C(O)OR 4 ;
[0135] R 2 Selected from C3-C8 cycloalkyl or C1-C8 alkyl;
[0136] R 3 for
[0137] R 4 C 10 -C 20 alkyl;
[0138] R 6 -(CH2) 1-8 C(O)OR 11 ;
[0139] R 11 C 10 -C 20 Alkyl; and
[0140] * indicates a connection point.
[0141] In one implementation, in equation (I),
[0142] G stands for CH:
[0143] L 1 L 2 and L 3 Each is independently a C1-C8 alkylene group;
[0144] R 1 -OC(O)R 9 ;
[0145] R 2 -OC(O)R 10 :
[0146] R 3 for
[0147] R 8 -(CH2) 1-8 N(C1-C8 alkyl)C1-C8 alkyl;
[0148] R 9 C 10 -C 20 alkyl:
[0149] R 10 C 10 -C 20 Alkyl; and
[0150] * indicates a connection point.
[0151] In one implementation, in equation (I), R 4 R 5 R 9 R 10 and R 11 Each is independently selected from: -(CH2) 1-3 -CH(C5-C 1o Alkyl) (C5-C 10 alkyl).
[0152] In one embodiment, the compound is one of the compounds listed in Table 1:
[0153] Table 1
[0154]
[0155]
[0156]
[0157] It should be understood that any embodiment of the compounds provided herein as described above, and any specific substituents and / or variables of the compounds provided herein as described above, can be independently combined with other embodiments and / or various variables of substituents and / or compounds to form embodiments not specifically elaborated. Furthermore, in cases where a list of substituents and / or variables is provided for any particular group or variable, it should be understood that each individual substituent and / or variable can be removed from a particular embodiment and / or claim, and the remaining list of substituents and / or variables will be considered to be within the scope of the embodiments provided herein.
[0158] It should be understood that, in this specification, the use of substituents and / or variables in the described chemical formula is permitted only if such a combination makes the compound stable.
[0159] Nanoparticle Composition
[0160] On one hand, this document describes nanoparticle compositions comprising the lipid compounds described herein. In certain embodiments, the nanoparticle compositions comprise compounds according to formula (I) (and its sub-formulas) as described herein.
[0161] In some embodiments, the maximum size of the nanoparticle compositions provided herein is 1 μm or shorter (e.g., ≤1 μm, ≤900 nm, ≤800 nm, ≤700 nm, ≤600 nm, ≤500 nm, ≤400 nm, ≤300 nm, ≤200 nm, ≤175 nm, ≤150 nm, ≤125 nm, ≤100 nm, ≤75 nm, ≤50 nm or shorter), when measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy or other methods. In one embodiment, the lipid nanoparticles provided herein have at least one dimension in the range of about 40 to about 200 nm. In one embodiment, at least one dimension is in the range of about 40 to about 100 nm.
[0162] Nanoparticle compositions that can be used in conjunction with this invention include lipid nanoparticles (LNPs), lipoprotein nanoparticles, liposomes, lipid vesicles, and lipid complexes. In some embodiments, the nanoparticle composition comprises vesicles of one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments. The lipid bilayers may be functionalized and / or cross-linked with each other. The lipid bilayers may include one or more ligands, proteins, or channels.
[0163] The properties of a nanoparticle composition can depend on its components. For example, a nanoparticle composition containing cholesterol as a structural lipid can have different properties than a nanoparticle composition containing different structural lipids. Similarly, the properties of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition containing a higher molar fraction of phospholipids can have different properties than a nanoparticle composition containing a lower molar fraction of phospholipids. These properties can also vary depending on the preparation method and conditions of the nanoparticle composition.
[0164] Nanoparticle compositions can be characterized using a variety of methods. For example, microscopy (such as transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, and Worcestershire, UK) can also be used to measure multiple characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.
[0165] Dh (size): The average size of the nanoparticle composition can be between 10s nm and 100s nm. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm. In some embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 70 nm 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.
[0166] PDI: The composition of the nanoparticles can be relatively uniform. The polydispersity index (PDI) can be used to indicate the uniformity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. Small PDIs (e.g., less than 0.3) typically indicate a narrow particle size distribution. Nanoparticle compositions can have a PDI of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the PDI of the nanoparticle composition can be about 0.10 to about 0.20.
[0167] Encapsulation efficiency: Encapsulation efficiency of the therapeutic and / or preventative agents represents the proportion of the amount of therapeutic and / or preventative agents encapsulated or bound to the nanoparticle composition after preparation, relative to the initial amount provided. High encapsulation efficiency (e.g., close to 100%) is desired. Encapsulation efficiency can be measured by comparing the amount of therapeutic and / or preventative agents containing the nanoparticle composition before and after decomposition in solution with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or preventative agents (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or preventative agents can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%.
[0168] Apparent pKa: The zeta potential of a nanoparticle composition can be used to indicate the electromotive force of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. It is generally desirable for nanoparticle compositions to have relatively low positive or negative charges, as substances with higher charges may interact undesirably with human cells, tissues, and other elements. In some embodiments, the zeta potential of the nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, or about -10 mV. From to approximately +5mV, from approximately -10mV to approximately 0mV, from approximately -10mV to approximately -5mV, from approximately -5mV to approximately +20mV, from approximately -5mV to approximately +15mV, from approximately -5mV to approximately +10mV, from approximately -5mV to approximately +5mV, from approximately -5mV to approximately 0mV, from approximately 0mV to approximately +20mV, from approximately 0mV to approximately +15mV, from approximately 0mV to approximately +10mV, from approximately 0mV to approximately +5mV, from approximately +5mV to approximately +20mV, from approximately +5mV to approximately +15mV, or from approximately +5mV to approximately +10mV.
[0169] In another embodiment, self-replicating RNA can be formulated in liposomes. As a non-limiting example, self-replicating RNA can be formulated in liposomes as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety. On the one hand, liposomes can contain lipids with pKa values favorable for mRNA delivery. On the other hand, liposomes can have a substantially neutral surface charge at physiological pH, thus making them effective for immunization (see, for example, the liposomes described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).
[0170] In some embodiments, the nanoparticle composition comprises a lipid component, which includes at least one lipid, such as a compound according to formula (I) (and its subformulas) described herein. For example, in some embodiments, the nanoparticle composition may include a lipid component comprising one of the compounds provided herein. The nanoparticle composition may also include one or more other lipid or non-lipid components as described below.
[0171] Cationic / ionizable lipids
[0172] As described herein, in some embodiments, the nanoparticle compositions provided herein, in addition to comprising lipids according to formula (I) (and its subformulas), comprise one or more charged or ionizable lipids. It is contemplated that certain charged or zwitterionic lipid components of the nanoparticle compositions are analogous to lipid components in cell membranes, thereby improving cellular uptake of the nanoparticles. Exemplary charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention include, but are not limited to, 3-(docoacylamino)-N1,N1,4-tridodecyl-1-piperazinethylamine (KL10), N1-[2-(docoacylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazindieneamide (KL22), 14,25-docodecyl-15,18,21,24-tetraazaoctaporane (KL25), and 1,2-dilinoleyloxy-N,N-dimethylamino. Propane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptadecyl alcohol ester (heptatriaconta)-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioloxy-N,N-dimethylamino 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propyl-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propyl-1-amine (octyl-CLinDMA) DMA(2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethylethyl-3-[((9Z-,12Z)-octadec-9,12-dien-1-yloxy]prop-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonyldocodecyl-12,15-den-1-amine,N,N-dimethyl-1-{((1S,2R)-2-octylcyclopropyl}heptadecane-8-amine.Other exemplary charged or ionizable lipids (such as lipid 5) that may form part of the nanoparticle compositions of the present invention include those described in Sabnis et al., “A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates”, Molecular Therapy V01.26 No 6, 2018, the entire contents of which are incorporated herein by reference.
[0173] In some embodiments, suitable cationic lipids include N-[1-(2,3-diolenoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-diolenoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylcholine phosphate (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylcholine phosphate (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylcholine phosphate (DMEPC); 1,2-dimyristoyl-sn-glycero-3-ethylcholine phosphate (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]- 4-[di(3-aminopropyl)amino]butylcarbamoyl]ethyl]-3,4-di[oleylyloxy]-benzamide (MVL5); bis(octadecylamino-glycyl)spermine (DOGS); 3b-[N-(N′,N′-dimethylaminoethyl)carbamoyl]cholesterol (DC-Cho1); bis(octadecyl)dimethylammonium bromide (DDAB); SAINT-2,N-methyl-4-(dioleylyl)methylpyridine; 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-dioleoyl-3-dimethylhydroxyethylammonium bromide (DORIE); 1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI); di-alkylated amino acids (DILA) 2(e.g., C18: 1-norArg-C16); diolenoyl dimethylammonium chloride (DODAC); 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylcholine phosphate (POEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylcholine phosphate (MOEPC); (R)-5-(dimethylamino)pentane-1,2-diyldioleoyl ester hydrochloride (DODAPen-C1); (R)-5-guanidinopentane-1,2-diyldioleoyl ester hydrochloride (DOPen-G); and (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentane-1-ammonium chloride (DOTAPen). These have head groups that are charged at physiological pH, such as primary amines (e.g., DODAGN). ′ N ′ Cationic lipids with bis(octadecyl-N-4,8-diaza-10-aminodecanoylglycine amide) and guanidine salt head groups (e.g., bis-guanidine-spermine-cholesterol (BGSC), bis-guanidine-triaminoethylamine-cholesterol (BGTC), PONA, and (R)-5-guanidinylpentane-1,2-dimethyldioleoyl ester hydrochloride (DOPen-G)) are also suitable. Another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-dimethyldioleoyl ester hydrochloride (DODAPen-C1). In some embodiments, the cationic lipid is a specific enantiomer or racemic form and includes multiple salt forms (e.g., chlorides or sulfates) of the cationic lipids described above. For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate). In some embodiments, the cationic lipids are ionizable cationic lipids, such as (e.g.) bis(octadecyl)dimethylammonium bromide (DDAB); 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); hepta-trianediane-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleenyloxy-3-dimethylaminopropane (DODMA); and morpholinocholesterol (Mo-CHOL). In some embodiments, the lipid nanoparticles comprise a combination of two or more cationic lipids (e.g., the two or more cationic lipids described above).
[0174] Additionally, in some embodiments, the charged or ionizable lipids that may form part of the nanoparticle composition are lipids comprising cyclic amine groups. Other cationic lipids suitable for the formulations and methods disclosed herein include those described in WO201 5199952, WO2016176330 and WO2015011633, the entire contents of which are incorporated herein by reference.
[0175] Polymer-conjugated lipids
[0176] In some embodiments, the lipid component of the nanoparticle composition may include one or more polymer-conjugated lipids (polymer-conjugated lipids), such as PEGylated lipids (PEG lipids). It is contemplated that the polymer-conjugated lipid component in the nanoparticle composition can improve colloidal stability and / or reduce protein uptake by the nanoparticles. Exemplary cationic lipids that may be incorporated into this disclosure include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, PEG lipids may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000, or Chol-PEG2000.
[0177] In one embodiment, the polymer-conjugated lipid is a polyethylene glycol-modified lipid. Some embodiments include polyethylene glycol-modified diacylglycerols (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristylglycerol (PEG-DMG), polyethylene glycol-modified phosphatidylethanolamine (PEG-PE), PEG-S-DAG, such as 4-O-(2′,3′-di(tetradecyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG), polyethylene glycol-modified ceramide (PEG-cer), or PEG-dialkoxypropylcarbamates, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecyloxy)propyl)carbamate or 2,3-di(tetradecyloxy)propyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.
[0178] In one embodiment, the polymer-conjugated lipid is present at a molar concentration of 1.0 to 2.5%. In another embodiment, the polymer-conjugated lipid is present at a molar concentration of about 1.7%. In yet another embodiment, the molar concentration of the polymer-conjugated lipid is about 1.5%.
[0179] In one embodiment, the molar ratio of the cationic lipid to the polymer-conjugated lipid is from about 35:1 to about 25:1. In another embodiment, the molar ratio of the cationic lipid to the polymer-conjugated lipid is from about 100:1 to about 20:1.
[0180] In one embodiment, the polyethylene glycol-modified lipid has the following formula:
[0181]
[0182] Or its pharmaceutically acceptable salt, tautomer or stereoisomer, wherein:
[0183] R 12 and R 13 Each is independently a straight-chain or branched saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and
[0184] The average value of w is between 30 and 60.
[0185] In one implementation, R 12 and R 13 Each is independently a straight-chain saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, w averages in the range of 42 to 55, for example, w averages 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In a particular embodiment, the average w is approximately 49.
[0186] In one embodiment, the polyethylene glycol-modified lipid has the following formula:
[0187]
[0188] The average value of w is approximately 49.
[0189] Structural lipids
[0190] In some embodiments, the lipid component of the nanoparticle composition may include one or more structural lipids. It is contemplated that structural lipids can stabilize the amphiphilic structure of the nanoparticles, such as, but not limited to, the lipid bilayer structure of the nanoparticles. Exemplary structural lipids that may be incorporated into this disclosure include, but are not limited to, cholesterol, nonsteroidal anti-steroids, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (e.g., prednisolone, dexamethasone, prednisolone, and hydrocortisone) or combinations thereof.
[0191] In one embodiment, the lipid nanoparticles provided herein comprise a steroid or a steroid analogue. In one embodiment, the steroid or steroid analogue is cholesterol. In one embodiment, the molar concentration of the steroid is in the range of 39-49%, 40-46%, 40-44%, 40-42%, 42-44%, or 44-46%. In one embodiment, the steroid is present at a molar concentration of 40, 41, 42, 43, 44, 45, or 46%.
[0192] In one embodiment, the molar ratio of cationic lipids to steroids is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipids to cholesterol is about 5:1 to 1:1. In one embodiment, the steroids are present at a molar concentration of 32-40% of the total steroid content.
[0193] Phospholipids
[0194] In some embodiments, the lipid component of the nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. It is anticipated that the phospholipids can assemble into one or more lipid bilayer structures. Exemplary phospholipids that can form part of this nanoparticle composition include, but are not limited to, 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerol-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DPPC), 1,2-eicosanoyl-sn-glycerol-3-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), and 1,2-di-O-octadecenyl-sn-glycerol-3-phosphocholine (18:0Diether). 1,2-Oleyl-2-cholestyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycerol-3-phosphate choline, 1,2-disarachidonicoyl-sn-glycerol-3-phosphate choline, 1,2-docosahexaenooyl-sn-glycerol-3-phosphate choline, 1,2-diphydanoyl-sn-glycerol-3-phosphate ethanolamine (ME) The nanoparticle composition comprises 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-1-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-disarachidanoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-docosahexaenoyl-sn-glycerol-3-phosphate ethanolamine, sodium 1,2-dioleoyl-sn-glycerol-3-phosphate-rac-(1-glycerol) (DOPG), and sphingomyelin. In some embodiments, the nanoparticle composition includes DSPC. In some embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition includes both DSPC and DOPE.
[0195] Other exemplary neutral lipids include dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), and dioleoylphosphatidylethanolamine 4-(N-maleiminomethyl)-cyclohexane-1-carboxylic acid ester (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), distearate-phosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), and 1,2-divalloyl-sn-glycerol-3-phosphate ethanolamine (transDOPE). In one embodiment, the neutral lipid is 1,2-distearate-sn-glycerol-3-phosphate choline (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE, and SM.
[0196] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).
[0197] Additional phospholipids that can form part of the nanoparticle compositions of the present invention also include those described in WO2017 / 112865, the entire contents of which are incorporated herein by reference.
[0198] Effective load of treatment
[0199] The nanoparticle compositions described herein may further comprise one or more therapeutic and / or preventative agents. These therapeutic and / or preventative agents are sometimes referred to herein as “therapeutic payload” or “payload.” In some embodiments, the nanoparticles may be used as a delivery carrier to administer the therapeutic payload in vivo or in vitro.
[0200] In some embodiments, the nanoparticle composition comprises a small molecule compound (such as a small molecule drug) as a therapeutic payload, such as antitumor drugs (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antitumor drugs (e.g., actinomycin D, vincristine, vinblastine, cytarabine, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs such as methotrexate, purine, and pyrimidine analogs), anti-infectives, local anesthetics (e.g., debucaine and chlorpromazine), and β-adrenergic blockers (e.g., propranolol, etc.). Timolol and labetalol), antihypertensive drugs (such as clonidine and hydralazine), antidepressants (such as imipramine, amitriptyline and doxepin), anticonvulsants (such as phenytoin sodium), antihistamines (such as diphenhydramine, chlorpheniramine and promethazine), antibiotics / antibacterial agents (gentamicin, ciprofloxacin and cefoxitin, etc.), antifungal agents (such as miconazole, teconazole, econazole, isoconazole, butanazole, clotrimazole, itraconazole, nystatin, naftifine and amphotericin B), antiparasitic drugs, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, anesthetics and imaging agents.
[0201] In some implementations, the therapeutic payload includes cytotoxins, radioactive ions, chemotherapeutic agents, vaccines, compounds that elicit an immune response, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic agents include any substance that may be harmful to cells. Examples include, but are not limited to, paclitaxel, cytochalasin B, bacitracin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthraquinone, ketomethasone, 1-nortestosterone, aspergillosis, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansine alkaloids, maytanol, resveratrol (CC-1065), and their analogues or homologues. Radioactive ions include, but are not limited to, iodine (such as iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium.
[0202] In other embodiments, the therapeutic payload of the nanoparticle composition may include, but is not limited to, therapeutic and / or prophylactic agents such as antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., methylethylamine, thiamethoxam chlorambucil, resveratrol (CC-1065), guanfalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamineplatin(II)(DDP)cisplatin), anthracyclines (e.g., daunorubicin (formerly donomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, photomycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, paclitaxel, and maytansine alkaloids).
[0203] In some embodiments, the nanoparticle composition comprises biomolecules, such as peptides and polypeptides, as a therapeutic payload. The biomolecules forming part of the nanoparticle composition may be of natural or synthetic origin. For example, in some embodiments, the therapeutic payload of the nanoparticle composition may include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.
[0204] Nucleic acid
[0205] In some embodiments, the nanoparticle composition comprises one or more nucleic acid molecules (such as DNA or RNA molecules) as a therapeutic payload. Exemplary forms of nucleic acid molecules that may be included as a therapeutic payload in this nanoparticle composition include, but are not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), hybrid forms thereof, RNAi inducers, RNAi reagents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, etc. In some embodiments, the therapeutic payload comprises RNA. RNA molecules that may be included as a therapeutic payload in the nanoparticle compositions of the present invention include, but are not limited to: short isomers, agonists (agomir), antagomir, antisense molecules, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms of RNA molecules known in the art. In a particular implementation, the RNA is mRNA.
[0206] In other embodiments, the nanoparticle composition comprises siRNA molecules as a therapeutic payload. Specifically, in some embodiments, the siRNA molecules are capable of selectively interfering with and downregulating the expression of a target gene. In some embodiments, when the siRNA-containing nanoparticle composition is administered to a subject, the siRNA payload selectively silences genes associated with a specific disease, condition, or symptom. In some embodiments, the siRNA molecule comprises a sequence complementary to the mRNA sequence encoding a target protein product. In some embodiments, the siRNA molecule is an immunomodulatory siRNA.
[0207] In some embodiments, the nanoparticle composition comprises an shRNA molecule or a carrier encoding an shRNA molecule as a therapeutic payload. Specifically, in some embodiments, the therapeutic payload generates shRNA within the target cells after application. Constructions and mechanisms related to shRNA are known in the art.
[0208] In some embodiments, the nanoparticle composition comprises an mRNA molecule as a therapeutic payload. Specifically, in some embodiments, the mRNA molecule encodes a target polypeptide, including any naturally occurring or non-naturally occurring or modified polypeptide. The polypeptide encoded by the mRNA can have any size and can have any secondary structure or activity. In some embodiments, when expressed in cells, the polypeptide encoded by the mRNA payload can have a therapeutic effect.
[0209] In some embodiments, the nucleic acid molecule of this disclosure comprises an mRNA molecule. In particular embodiments, the nucleic acid molecule comprises at least one coding region (e.g., an open reading frame (ORF)) encoding a target peptide or polypeptide. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In particular embodiments, the untranslated region (UTR) is located upstream (5′ end) of the coding region and is referred to herein as the 5′-UTR. In particular embodiments, the untranslated region (UTR) is located downstream (3′ end) of the coding region and is referred herein as the 3′-UTR. In particular embodiments, the nucleic acid molecule comprises both a 5′-UTR and a 3′-UTR. In some embodiments, the 5′-UTR includes a 5′-cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5′-UTR). In some embodiments, the nucleic acid molecule comprises a poly-A region (e.g., in the 3′-UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylate signal (e.g., in the 3′-UTR). In some embodiments, the nucleic acid molecule comprises a conserved region (e.g., in the 3′-UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule contains a stem-loop sequence (e.g., in the 5'-UTR and / or 3'-UTR). In some embodiments, the nucleic acid molecule contains one or more intron regions that can be cleaved during splicing. In one specific embodiment, the nucleic acid molecule contains one or more regions selected from the 5'-UTR and the coding region. In one specific embodiment, the nucleic acid molecule contains one or more regions selected from the coding region and the 3'-UTR. In one specific embodiment, the nucleic acid molecule contains one or more regions selected from the 5'-UTR, the coding region, and the 3'-UTR.
[0210] Encoding area
[0211] In some embodiments, the nucleic acid molecule of this disclosure comprises at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each encoding a peptide or protein. In embodiments where the coding region comprises more than one ORF, the peptides and / or proteins encoded by the ORFs may be the same as or different from each other. In some embodiments, multiple ORFs in the coding region are separated by non-coding sequences. In a particular embodiment, the non-coding sequence separating two ORFs comprises an internal ribosome entry site (IRES).
[0212] It is anticipated that the internal ribosome entry site (IRES) may serve as a single ribosome binding site or as one of multiple ribosome binding sites for mRNA. mRNA molecules containing more than one functional ribosome binding site may encode several peptides or polypeptides (such as polycistronic mRNA) that are independently translated by ribosomes. Therefore, in some embodiments, the nucleic acid molecules (such as mRNA) of this disclosure contain one or more internal ribosome entry sites (IRES). Examples of IRES sequences that may be incorporated into this disclosure include, but are not limited to, sequences from microonomaviruses (such as FMDV), insect pest virus (CFFV), poliovirus (PV), encephalomyocarditis virus (ECMV), hand-foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or paralytic virus (CrPV).
[0213] In various embodiments, the nucleic acid molecules of the present invention encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of this disclosure encode dipeptides (such as carnosine and anserine). In some embodiments, the nucleic acid molecules encode tripeptides. In some embodiments, the nucleic acid molecules encode tetrapeptides. In some embodiments, the nucleic acid molecules encode pentapeptides. In some embodiments, the nucleic acid molecules encode hexapeptides. In some embodiments, the nucleic acid molecules encode heptapeptides. In some embodiments, the nucleic acid molecules encode octapeptides. In some embodiments, the nucleic acid molecules encode nonapeptides. In some embodiments, the nucleic acid molecules encode decapeptides. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 100 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.
[0214] In some embodiments, the nucleic acid molecule of this disclosure is at least about 30 nucleotides (nt) long. In some embodiments, the nucleic acid molecule is at least about 35 nt long. In some embodiments, the nucleic acid molecule is at least about 40 nt long. In some embodiments, the nucleic acid molecule is at least about 45 nt long. In some embodiments, the nucleic acid molecule is at least about 50 nt long. In some embodiments, the nucleic acid molecule is at least about 55 nt long. In some embodiments, the nucleic acid molecule is at least about 60 nt long. In some embodiments, the nucleic acid molecule is at least about 65 nt long. In some embodiments, the nucleic acid molecule is at least about 70 nt long. In some embodiments, the nucleic acid molecule is at least about 75 nt long. In some embodiments, the nucleic acid molecule is at least about 80 nt long. In some embodiments, the nucleic acid molecule is at least about 85 nt long. In some embodiments, the nucleic acid molecule is at least about 90 nt long. In some embodiments, the nucleic acid molecule is at least about 95 nt long. In some embodiments, the nucleic acid molecule is at least about 100 nt long. In some embodiments, the nucleic acid molecule is at least about 120 nt long. In some embodiments, the length of the nucleic acid molecule is at least about 140 nt. In some embodiments, the length of the nucleic acid molecule is at least about 160 nt. In some embodiments, the length of the nucleic acid molecule is at least about 180 nt. In some embodiments, the length of the nucleic acid molecule is at least about 200 nt. In some embodiments, the length of the nucleic acid molecule is at least about 250 nt. In some embodiments, the length of the nucleic acid molecule is at least about 300 nt. In some embodiments, the length of the nucleic acid molecule is at least about 400 nt. In some embodiments, the length of the nucleic acid molecule is at least about 500 nt. In some embodiments, the length of the nucleic acid molecule is at least about 600 nt. In some embodiments, the length of the nucleic acid molecule is at least about 700 nt. In some embodiments, the length of the nucleic acid molecule is at least about 800 nt. In some embodiments, the length of the nucleic acid molecule is at least about 900 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1000 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1100 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1200 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1300 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1400 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1500 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1600 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1700 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1800 nt. In some embodiments, the length of the nucleic acid molecule is at least about 1900 nt.In some embodiments, the length of the nucleic acid molecule is at least about 2000 nt. In some embodiments, the length of the nucleic acid molecule is at least about 2500 nt. In some embodiments, the length of the nucleic acid molecule is at least about 3000 nt. In some embodiments, the length of the nucleic acid molecule is at least about 3500 nt. In some embodiments, the length of the nucleic acid molecule is at least about 4000 nt. In some embodiments, the length of the nucleic acid molecule is at least about 4500 nt. In some embodiments, the length of the nucleic acid molecule is at least about 5000 nt.
[0215] In certain embodiments, the therapeutic payload includes the vaccine composition described herein (such as a gene vaccine). In some embodiments, the therapeutic payload comprises a compound capable of inducing immunity against one or more target symptoms or diseases. In some embodiments, the target symptoms are associated with pathogens or infections they cause, such as coronaviruses (e.g., 2019-nCoV), influenza, measles, human papillomavirus (HPV), rabies, meningitis, pertussis, tetanus, plague, hepatitis, and tuberculosis. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (such as mRNA) encoding a characteristic pathogenic protein or an antigenic fragment or epitope thereof. Upon administration to a subject, the vaccine expresses the encoded pathogenic protein (or an antigenic fragment or epitope thereof), thereby inducing immunity against the pathogen in the subject.
[0216] In some implementations, the target condition is associated with or caused by the proliferation of cells, such as cancer. In some implementations, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a cancer-characteristic tumor-associated antigen (TAA) or an antigenic fragment or epitope thereof. Upon administration to a vaccinated subject, the vaccine expresses the encoded TAA (or an antigenic fragment or epitope thereof), thereby inducing immunity against tumor cells expressing the TAA in the subject.
[0217] 5'-cap structure
[0218] It is anticipated that the 5′-cap structure of the polynucleotide will participate in nuclear export and enhance polynucleotide stability, and bind to the mRNA cap-binding protein (CBP) responsible for polynucleotide stability in the cell. Through the binding of the CBP to the poly-A binding protein, a mature circular mRNA is formed, thereby gaining translational capability. The 5′-cap structure further assists in the removal of 5′ introns during mRNA splicing. Therefore, in some embodiments, the nucleic acid molecule of this disclosure includes a 5′-cap.
[0219] Nucleic acid molecules may be 5′ capped by the cell’s endogenous transcriptional mechanisms, resulting in a 5′-ppp-5′-triphosphate bond between the guanine cap terminal residue and the 5′-transcribed sense nucleotide of the polynucleotide. This 5′-guanylate cap is then methylated to generate an N7-methyl-guanylate residue. The ribose of the nucleotide transcribed from the terminal and / or proximal ends of the polynucleotide 5′ can also optionally be 2′-O-methylated. 5′-uncapping via hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.
[0220] In some embodiments, the nucleic acid molecules of this disclosure include one or more modifications to the native 5′-cap structure resulting from endogenous processes. Modification of the 5′-cap can increase the stability of the polynucleotide, increase its half-life, and improve its translation efficiency.
[0221] Exemplary modifications to the native 5'-Cap structure include the creation of a non-hydrolyzable cap structure, thereby preventing cap removal and increasing the half-life of the polynucleotide. In some embodiments, since cap structure hydrolysis requires cleavage of the 5'-ppp-5' phosphodiester bond, modified nucleotides may be used during the capping reaction. For example, in some embodiments, a capping enzyme from New England Biolabs, derived from *Vaccinium bacillus*, may be used with α-thioguanosine nucleotides to generate thiophosphate bonds in the 5'-ppp-5' region, according to the manufacturer's instructions. Other modified guanosine nucleotides, such as α-methylphosphonates and selenophosphate nucleotides, may also be used.
[0222] Other exemplary modifications to the natural 5′-Cap structure include modifications at the 2′- and / or 3′- positions of the capped guanosine triphosphate (GTP), replacement of the sugar epoxide (oxygen involved in the carbide ring) with a methylene moiety (CH2), modifications to the triphosphate bridge portion of the cap structure, or modifications to the nucleobase (G) portion.
[0223] Other exemplary modifications to the natural 5′-cap structure include, but are not limited to, 2′-O-methylation of the 5′-terminus of a polynucleotide and / or 2′-O-methylation of the 5′-terminal nucleic acid at the 2′-hydroxyl group of the ribose, which can generate several different 5′-cap structures for polynucleotides (e.g., mRNA molecules). Additional exemplary 5′-cap structures that may be used in conjunction with this disclosure include those described in International Patent Publications WO2008127688, WO 2008016473 and WO 2011015347, the entire contents of which are incorporated herein by reference.
[0224] In various embodiments, the 5'-cap may include a cap analogue. A cap analogue, also referred herein as a synthetic cap analogue, chemical cap, chemical cap resemblance, or structural or functional cap analogue, is chemically distinct from the natural (i.e., endogenous, wild-type, or physiological) 5'-cap structure while retaining the function of the cap. Cap analogues may be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to polynucleotides.
[0225] For example, the reverse-cap analogue (ARCA) cap contains two guanosines linked by 5′-5′-triphosphate groups, one of which contains an N7-methyl group and a 3′-O-methyl group (i.e., N7,3′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, m7G-3′mppp-G, which can be equivalently referred to as 3′O-Me-m7G(5′)ppp(5′)G). The 3′-O atom of the other unchanged guanosine is linked to the 5′-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3′-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2′-O-methyl group on the guanosine (i.e., N7,2′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, m7Gm-ppp-G).
[0226] In some embodiments, the cap analog may be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog may be modified with borate phosphate groups or phosphate selenate groups at different phosphate positions, such as the dinucleotide cap analog described in U.S. Patent No. 8,519,110, the entire contents of which are incorporated herein by reference.
[0227] In some embodiments, the cap analog may be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5′)ppp(5′)G and N7-(4-chlorophenoxyethyl)-m3′-OG(5′)ppp(5′)G cap analogs (see, for example, the various cap analogs and methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 201 321:4570-4574, which are incorporated herein by reference). In other embodiments, the cap analog for nucleic acid molecules that can be used in this disclosure is a 4-chloro / bromophenoxyethyl analog.
[0228] In various embodiments, the cap analogue may include guanosine analogues. Available guanosine analogues include, but are not limited to, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-denitro-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
[0229] It is expected that, although cap analogs allow for the simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of the transcripts remain uncapped. This structural difference between cap analogs and the native 5′-cap structure of polynucleotides produced from endogenous cellular transcription mechanisms may lead to reduced translational capacity and decreased cellular stability.
[0230] Therefore, in some embodiments, the nucleic acid molecules of this disclosure can also be capped post-transcriptionally using an enzyme to produce a more realistic 5′-cap structure. As used herein, the phrase “more realistic” means a feature that structurally or functionally closely reflects or mimics an endogenous or wild-type characteristic. That is, a “more realistic” feature represents better endogenous, wild-type, natural, or physiological cellular function and / or structure compared to prior art synthetic or analogous features, or that outperforms one or more aspects of the corresponding endogenous, wild-type, natural, or physiological characteristics. Non-limiting examples of more realistic 5′-cap structures used in conjunction with the nucleic acid molecules of this disclosure are those with enhanced binding to cap-binding proteins, increased half-life, and reduced sensitivity to 5′. β-endonucleases reduce 5′-uncapping compared to synthetic 5′-cap structures known in the art (or compared to wild-type, natural, or physiological 5′-cap structures). For example, in some embodiments, the recombinant vaccinia virus capping enzyme and recombinant 2′-O-methyltransferase can form a canonical 5′-5′-triphosphate bond between the 5′-terminal nucleotide of the polynucleotide and the guanosine cap nucleotide. The cap guanine contains N7-methylation, while the 5′-terminal nucleotide of the polynucleotide contains 2′-O-methyl. This structure is called the Cap1 structure. Compared to other 5′ cap analog structures known in the art, such as those mentioned above, this cap results in higher translational efficiency, cell stability, and reduced activation of pro-inflammatory cytokines. Other exemplary cap structures include 7mG(5′)ppp(5′)N,pN2p(Cap0), 7mG(5′)ppp(5′)NlmpNp(Cap 1), 7mG(5′)-PPP(5′)NlmpN2mp(Cap 2), and m(7)Gpppm(3)(6,6,2′)Apm(2′)Apm(2′)Cpm(2′)Up(3,2′)(Cap4).
[0231] It is expected that the nucleic acid molecules of this disclosure can be capped post-transcriptionally, and because the process is more efficient, nearly 100% of the nucleic acid molecules can be capped.
[0232] Untranslated regions (UTRs)
[0233] In some embodiments, the nucleic acid molecule of this disclosure contains one or more untranslated regions (UTRs). In some embodiments, the UTR is located upstream of the coding region of the nucleic acid molecule and is referred to as the 5′-UTR. In some embodiments, the UTR is located downstream of the coding region of the nucleic acid molecule and is referred to as the 3′-UTR. The sequence of the UTR can be homologous or heterologous to the sequence of the coding region in the nucleic acid molecule. The nucleic acid molecule may contain multiple UTRs, which may have the same or different sequences and / or genetic origins. According to this disclosure, any portion of the UTR in the nucleic acid molecule (including the absence of such a portion) can be codon-optimized and may independently contain one or more different structural or chemical modifications, before and / or after codon optimization.
[0234] In some embodiments, the nucleic acid molecules (such as mRNA) of this disclosure contain UTRs and coding regions that are homologous to each other. In other embodiments, the nucleic acid molecules (such as mRNA) of this disclosure contain UTRs and coding regions that are heterologous to each other. In some embodiments, to detect the activity of the UTR sequence, the nucleic acid molecule containing the UTR and the coding sequence of the detectable probe can be administered in vitro (e.g., in cell or tissue cultures) or in vivo (e.g., to a subject). The effects of the UTR sequence (such as regulation of expression levels, cellular localization of the coding product, or half-life of the coding product) can be detected using methods known in the art.
[0235] In some embodiments, the UTR of the nucleic acid molecule (such as mRNA) of this disclosure contains at least one translation enhancer element (TEE), which serves to increase the yield of polypeptides or proteins produced from the nucleic acid molecule. In some embodiments, the TEE is located in the 5′-UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3′-UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located in the 5′-UTR and 3′-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecule (such as mRNA) of this disclosure may contain one or more copies of a TEE sequence or contain more than one different TEE sequence. In some embodiments, the different TEE sequences in the nucleic acid molecule may be homologous or heterologous to each other.
[0236] Various TEE sequences that can be used in conjunction with this disclosure are known in the art. For example, in some embodiments, the TEE may be an internal ribosome entry site (IRES), an HCV-IRES, or an IRES element such as Chappell et al., Proc. Natl. Acad. Sci. USA 101: 9590-9594, 2004; Zhou et al., Proc. Natl. Acad. Sci. 102: 6273-6278, 2005. Other internal ribosome entry sites (IRES) that can be used in conjunction with this disclosure include, but are not limited to, those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776 and U.S. Patent Publication No. 2011 / 0124100, and International Patent Publication No. WO2007 / 025008 and International Patent Publication No. WO2001 / 055369, the entire contents of which are incorporated herein by reference. In some implementations, the TEE may be those described in Supplement Tables 1 and 2 of Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10(8): 747-750, the contents of which are incorporated herein by reference in their entirety.
[0237] Other exemplary TEEs that may be used in conjunction with this disclosure include, but are not limited to, those described in U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, 2009 / 0226470, 2013 / 0177581, 2007 / 0048776, 2011 / 0124100, and other U.S. patents. The entire contents of the TEE sequences disclosed in Patent Publication No. 2009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644 and International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, and European Patent No. 2610340 are incorporated herein by reference.
[0238] In various embodiments, the nucleic acid molecule (such as mRNA) of this disclosure comprises at least one UTR containing at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 67, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In some embodiments, the TEE sequences in the UTR of the nucleic acid molecule are copies of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of the nucleic acid molecule have different sequences. In some embodiments, multiple different TEE sequences are arranged in one or more repeat patterns in the UTR region of the nucleic acid molecule. For illustrative purposes only, the repeat pattern may be, for example, ABABAB, ABABBAABBAABB, ABCABCABC, etc., where each uppercase letter (A, B, or C) represents a different TEE sequence in these exemplary patterns. In some embodiments, at least two TEE sequences are consecutive to each other in the UTR of the nucleic acid molecule (i.e., there is no spacer sequence between them). In other embodiments, at least two TEE sequences are separated by spacer subsequences. In some embodiments, the UTR may contain a TEE sequence-spacer subsequence module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or more than nine times. In any embodiment described in this paragraph, the UTR may be a 5' UTR, a 3' UTR, or both a 5'-UTR and a 3'-UTR of the nucleic acid molecule.
[0239] In some embodiments, the UTR of a nucleic acid molecule (such as mRNA) of this disclosure contains at least one translation repressive element that functions to reduce the amount of polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the UTR of a nucleic acid molecule contains one or more miR sequences or fragments thereof (such as miR seed sequences) recognized by one or more microRNAs. In some embodiments, the UTR of a nucleic acid molecule contains one or more stem-loop structures that downregulate the translational activity of the nucleic acid molecule. Other mechanisms for inhibiting translational activity associated with nucleic acid molecules are known in the art. In any embodiment described in this paragraph, the UTR may be the 5'UTR, 3'UTR, or both 5'-UTR and 3'-UTR of the nucleic acid molecule.
[0240] Poly-A region
[0241] In natural RNA processing, a long-chain adenosine nucleotide (poly-A) region is typically added to messenger RNA (mRNA) molecules to increase molecular stability. Immediately after transcription, the 3′ end of the transcript is cleaved to release the 3′-hydroxyl group. Then, a poly-A polymerase adds an adenosine nucleotide chain to the RNA. This process, called polyadenylation, adds a poly-A region of 100 to 250 residues in length. It is anticipated that the poly-A region can confer several advantages to the nucleic acid molecules of this invention.
[0242] Therefore, in some embodiments, the nucleic acid molecules (such as mRNA) of this disclosure contain a polyadenylation signal. In some embodiments, the nucleic acid molecules (such as mRNA) of this disclosure contain one or more polyadenylated (poly-A) regions. In some embodiments, the poly-A region consists entirely of adenine nucleotides or their functional analogs. In some embodiments, the nucleic acid molecule contains at least one poly-A region at its 3' end. In some embodiments, the nucleic acid molecule contains at least one poly-A region at its 5' end. In some embodiments, the nucleic acid molecule contains at least one poly-A region at its 5' end and at least one poly-A region at its 3' end.
[0243] According to this disclosure, the poly-A region can have varying lengths in different embodiments. Specifically, in some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 30 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 35 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 40 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 45 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 50 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 55 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 60 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 65 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 70 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 75 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 80 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 85 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 90 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 95 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 100 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 110 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 120 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 130 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 140 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 150 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 160 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 170 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 180 nucleotides long.In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 190 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 200 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 225 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 250 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 275 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 300 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 350 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 400 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 450 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 5500 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 600 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 700 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 800 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 900 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1000 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1100 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1200 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1300 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1400 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1500 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1600 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1700 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1800 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 1900 nucleotides long.In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2000 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2250 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2500 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 2750 nucleotides long. In some embodiments, the poly-A region of the nucleic acid molecule of this disclosure is at least 3000 nucleotides long.
[0244] In some embodiments, the length of the poly-A region in a nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof (such as the length of a coding region or the length of an open reading frame). For example, in some embodiments, the poly-A region accounts for approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of the total length of a nucleic acid molecule containing multiple poly-A regions.
[0245] It is anticipated that certain RNA-binding proteins can bind to the poly-A region located at the 3′ end of mRNA molecules. These poly-A binding proteins (PABPs) can regulate mRNA expression, for example, by interacting with translation initiation mechanisms in cells and / or protecting the 3′-poly-A tail from degradation. Therefore, in some embodiments, the nucleic acid molecules (such as mRNA) of this disclosure contain at least one binding site of a poly-A binding protein (PABP). In other embodiments, the nucleic acid molecules are conjugated or complexed with PABPs before being loaded into a delivery vector (e.g., lipid nanoparticles).
[0246] In some embodiments, the nucleic acid molecules (such as mRNA) disclosed herein comprise a po1y-AG tetramer. The G tetramer is a cyclic hydrogen-bonded array of four guanosine nucleotides, which can be formed from G-rich sequences in DNA and RNA. In this embodiment, the G tetramer is bound to the end of a poly-A region. The stability, protein production, and other parameters of the resulting polynucleotide (such as mRNA), including half-life at different time points, can be determined. Studies have shown that the protein yield produced by the po1yA-G tetramer structure is at least 75% equal to the protein yield produced by using a 120-nucleotide poly-A region alone.
[0247] In some embodiments, the nucleic acid molecules (such as mRNA) disclosed herein may include a poly-A region and may be stabilized by adding a 3′ stabilizing region. In some embodiments, the 3′ stabilizing region that can be used to stabilize the nucleic acid molecule (such as mRNA) includes a poly-A or poly-AG tetramer structure, described in International Patent Publication No. WO2013 / 103659, which is incorporated herein by reference in its entirety.
[0248] In other embodiments, the 3′ stable region that can be used in conjunction with the nucleic acid molecules of this disclosure includes chain-terminating nucleosides, such as, but not limited to, 3′-deoxyadenosine, 3′-deoxyuridine, 3′-deoxycytosine, 3′-deoxyguanosine, 3′-deoxythymidine, 2′,3′-dideoxynucleoside, 2′,3′-dideoxyadenosine, 2′,3′-dideoxyuridine, 2′,3′-dideoxycytosine, 2′,3′-dideoxyguanosine, 2′,3′-dideoxythymidine, 2′-deoxynucleoside or O-methylnucleoside, 3′-deoxynucleoside, 2′,3′-dideoxynucleoside, 3′-O-methylnucleoside, 3′-O-ethylnucleoside, 3′-arabinoside, and other alternative nucleosides described herein or known in the art.
[0249] Secondary structure
[0250] Stem-loop structures can guide RNA folding, protect the structural stability of nucleic acid molecules (such as mRNA), provide recognition sites for RNA-binding proteins, and serve as substrates for enzymatic reactions. For example, the integration of miR sequences and / or TEE sequences can alter the shape of stem-loop regions, which may increase and / or decrease translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct; 12(10): 1014-20, the contents of which are incorporated herein by reference in their entirety).
[0251] Therefore, in some embodiments, the nucleic acid molecule (such as mRNA) or a portion thereof described herein may take the form of a stem-loop structure, such as, but not limited to, histone stem-loops. In some embodiments, the stem-loop structure is formed by a stem-loop sequence of about 25 or about 26 nucleotides in length, which may be, but is not limited to, those described in International Patent Publication No. WO2013 / 103659, the entire contents of which are incorporated herein by reference. Other examples of stem-loop sequences include those described in International Patent Publication Nos. WO2012 / 019780 and WO201502667, the contents of which are incorporated herein by reference. In some embodiments, the stem-loop sequence includes a TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In a particular embodiment, the stem-loop sequence may comprise a miR-122 seed sequence. In a particular embodiment, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule contains the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).
[0252] In some embodiments, the nucleic acid molecules (such as mRNA) of this disclosure include a stem-loop sequence located upstream (5′ end) of the coding region of the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5′-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecules (such as mRNA) of this disclosure include a stem-loop sequence located downstream (3′ end) of the coding region of the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3′-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule contains at least one stem-loop sequence in the 5′-UTR and at least one stem-loop sequence in the 3′-UTR.
[0253] In some embodiments, the nucleic acid molecule containing the stem-loop structure further includes a stabilizing region. In some embodiments, the stabilizing region contains at least one chain-terminating nucleoside, which slows down degradation and thus increases the half-life of the nucleic acid molecule. Exemplary chain-terminating nucleosides used in this disclosure may be incorporated, including but not limited to, 3′-deoxyadenosine, 3′-deoxyuridine, 3′-deoxycytosine, 3′-deoxyguanosine, 3′-deoxythymidine, 2′,3′-dideoxynucleoside, 2′,3′-dideoxyadenosine, 2′,3′-dideoxyuridine, 2′,3′-dideoxycytosine, 2′,3′-dideoxyguanosine, 2′,3′-dideoxythymidine, 2′-deoxynucleoside or O-methylnucleoside, 3′-deoxynucleoside, 2′,3′-dideoxynucleoside, 3′-O-methylnucleoside, 3′-O-ethylnucleoside, 3′-arabinoside, and other alternative nucleosides described herein or known in the art. In other embodiments, the stem-loop structure can be stabilized by altering the 3′ region of the polynucleotide, which can prevent and / or inhibit the addition of oligio(U) (International Patent Publication No. WO2013 / 103659, the entire contents of which are incorporated herein by reference).
[0254] In some embodiments, the nucleic acid molecules of this disclosure comprise at least one stem-loop sequence and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-A region or polyadenylation signal are included in International Patent Publications WO2013 / 120497, WO2013 / 120629, WO2013 / 120500, WO2013 / 120627, WO2013 / 120498, WO2013 / 120626, WO2013 / 120499 and WO2013 / 120628, the entire contents of which are incorporated herein by reference.
[0255] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode pathogen antigens or fragments thereof, as described in International Patent Publication Nos. WO2013 / 120499 and WO2013 / 120628, the contents of which are incorporated herein by reference in their entirety.
[0256] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode therapeutic proteins, as described in International Patent Publication No. WO2013 / 120497 and International Patent Publication No. WO2013 / 120629, the contents of which are incorporated herein by reference in their entirety.
[0257] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode tumor antigens or fragments thereof, as described in International Patent Publication Nos. WO2013 / 120500 and WO2013 / 120627, the contents of which are incorporated herein by reference in their entirety.
[0258] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode allergenic antigens or autoimmune autoantigens, as described in International Patent Publication Nos. WO2013 / 120498 and WO2013 / 120626, the contents of which are incorporated herein by reference in their entirety.
[0259] Functional nucleotide analogs
[0260] In some embodiments, nucleic acid molecules containing stem-loop sequences and poly-A regions or polyadenylation signals may encode allergenic antigens or autoimmune autoantigens, as described in International Patent Publication Nos. WO2013 / 120498 and WO2013 / 120626, the contents of which are incorporated herein by reference in their entirety.
[0261] Therefore, in some embodiments, the payload nucleic acid molecule comprises at least one functional nucleotide analog described herein. In some embodiments, the functional nucleotide analog comprises at least one chemical modification of a nucleotide base, glycosyl group, and / or phosphate group. Thus, a payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification of a nucleotide base, glycosyl group, and / or nucleoside bond. Exemplary chemical modifications of the nucleotide base, glycosyl group, or nucleoside bond of a nucleic acid molecule are provided herein.
[0262] As described herein, all nucleotides in the payload nucleic acid molecule may be functional nucleotide analogs ranging from 0% to 100%. For example, in various embodiments, percentages range from about 1% to about 20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to about 60%, from about 1% to about 70%, from about 1% to about 80%, from about 1% to about 90%, from about 1% to about 95%, from about 10% to about 20%, from about 10% to about 25%, from about 10% to about 50%, from about 10% to about 60%, from about 10% to about 70%, from about 10% to about 80%, from about 10% to about 90%, from about 10% to about 95%, from about 10% to about 100%, from about 20% to about 25%, from about 20% to about 50%, from about 20% to about 60%, and from about 20% to about 70%. Approximately 20% to 80%, approximately 20% to 90%, approximately 20% to 95%, approximately 20% to 100%, approximately 50% to 60%, approximately 50% to 70%, approximately 50% to 80%, approximately 50% to 90%, approximately 50% to 95%, approximately 50% to 100%, approximately 70% to 80%, approximately 70% to 90%, approximately 70% to 95%, approximately 70% to 100%, approximately 80% to 90%, approximately 80% to 95%, approximately 80% to 100%, approximately 90% to 95%, approximately 90% to 100%, or approximately 95% to 100% are the functional nucleotide analogs described herein. In any of these embodiments, the functional nucleotide analog can be present at any position in the nucleic acid molecule, including the 5'-terminus, 3'-terminus, and / or one or more internal positions. In some embodiments, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and / or different types of nucleoside bonds (such as backbone structures).
[0263] As described herein, 0% to 100% of all nucleotides of a type (e.g., all purine-containing nucleotides of a type, or all pyrimidine-containing nucleotides of a type, or all A, G, C, T, or U in a range of 0% to 100% in a payload nucleic acid molecule “as one”) may be the functional nucleotide analogs described herein. For example, in various embodiments, from about 1% to about 20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to about 60%, from about 1% to about 70%, from about 1% to about 80%, from about 1% to about 90%, from about 1% to about 95%, from about 10% to about 20%, from about 10% to about 25%, from about 10% to about 50%, from about 10% to about 60%, from about 10% to about 70%, from about 10% to about 80%, from about 10% to about 90%, from about 10% to about 95%, from about 10% to about 100%, from about 20% to about 25%, from about 20% to about 50%, from about 20% to about 60%, from about 20% to about 70%. About 20% to about 80%, about 20% to about 90%, about 20% to about 95%, about 20% to about 100%, about 50% to about 60%, about 50% to about 70%, about 50% to about 80%, about 50% to about 90%, about 50% to about 95%, about 50% to about 100%, about 70% to about 80%, about 70% to about 90%, about 70% to about 95%, about 70% to about 100%, about 80% to about 90%, about 80% to about 95%, about 80% to about 100%, about 90% to about 95%, about 90% to about 100%, or about 95% to about 100% are the functional nucleotide analogs described herein. In any of these embodiments, the functional nucleotide analog can be present at any position in the nucleic acid molecule, including the 5'-terminus, 3'-terminus, and / or one or more internal positions. In some embodiments, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and / or different types of nucleoside bonds (such as backbone structures).
[0264] Base modification
[0265] In some embodiments, the functional nucleotide analogue comprises a non-standard nucleobase. In some embodiments, the standard nucleobase in the nucleotide (e.g., adenine, guanine, uracil, thymine, and cytosine) may be modified or replaced to provide one or more functional analogues of the nucleotide. Exemplary modifications of the nucleobase include, but are not limited to, one or more substitutions or modifications, including but not limited to alkyl, aryl, halogen, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused or open rings; oxidation and / or reduction.
[0266] In some embodiments, the non-standard nucleobase is a modified uracil. Exemplary nucleobases and nucleosides with modified uracil include pseudouridine (ψ), pyridine-4-ketoribonucleotide, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s2U), and 4-thiouracil (s...). 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho) 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromouracil), 3-methyluracil (m 3 U), 5-methoxyuracil (mo) 5 U), uracil-5-oxyacetic acid (cmo) 5 U), methyl uridine 5-oxyacetate (mcmo) 5 U), 5-carboxymethyl-uracil (cm) 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm) 5 U), 5-carboxymethyl-uracil methyl ester (mchm) 5 U), 5-methoxycarbonylmethyluracil (mcm) 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm) 5 s 2 U), 5-aminomethyl-2-thiouracil (nm) 5 s 2 U), 5-methylaminomethyl-2-uracil (mnm) 5 U), 5-methylaminomethyl-2-thiouracil (mnm) 5 s 2 U), 5-methylaminomethyl-2-selenouracil (mnm) 5 se 2 U), 5-carbamoyl methyluracil (ncm5U), 5-carboxymethylaminomethyluracil (cmnm) 5 U), 5-Carboxymethylaminomethyl-2-thiouracil (cmnm) 5 s 2 U), 5-propynyluracil, 1-propynyl-pseudouracil, 5-tauric acid methyluracil (τm) 5 U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thiouracil (τm) 5 s 2 U), 1-taurylmethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having nucleobase deoxythymidine), 1-methyl-pseudoneuridine (m 1 ψ), 1-ethyl-pseudoneuroside (Et) 1ψ), 5-methyl-2-thiouracil (m) 5 s 2 U), 1-methyl-4-thio-gutuldin (m 1 s 4 ψ), 4-thio-1-methyl-guduridine, 3-methyl-guduridine (m 3 ψ), 2-thio-1-methyl-duduridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m) 5 D) 2-Thio-dihydrouracil, 2-Thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thiouracil, 4-methoxy-pseudouridine, 4-methoxy-2-thiopseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp) 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp) 3 ψ), 5-(isopentenylaminomethyl)uracil (m) 5 U), 5-(isopentenyl)aminomethyl)-2-thiouracil (m) 5 s 2 U), 5,2 ′ -O-dimethyluridine (m 5 Um), 2-thio-2 ′ -O-methyluridine (s 2 Um), 5-methoxycarbonylmethyl-2′-O-methyluridine (mcm) 5 Um), 5-carbamoylmethyl-2′-O-methyluridine (ncm) 5 Um), 5-carboxymethylaminomethyl-2′-O-methyluridine (cmnm) 5 Um), 3,2′-O-dimethyluridine (m) 3 Um) and 5-(isopentenylaminomethyl)-2′-O-methyl-uridine (inm) 5 Umm), 1-thiouracil, deoxythymidine, 5-(2-carbonylmethoxyvinyl)uracil, 5-(carbamoylhydroxymethyl)uracil, 5-carbamoylmethyl-2-thiouracil, 5-carboxymethyl-2-thiouracil, 5-cyanomethyluracil, 5-methoxy-2-thiouracil, and 5-3-(1-E-propenylamino)uracil.
[0267] In some embodiments, the non-standard nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides with modified cytosine include 5-azacytosine, 6-azacytosine, pseudocytosine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methylcytosine (m4C), 5-methylcytosine (m5C), 5-halocytosine (e.g., 5-iodocytosine), 5-hydroxymethylcytosine (hm5C), 1-methyl-pseudocytosine, pyrazine, etc. Pyrrolocytosine, pyrrolopseudocytosine nucleoside, 2-thiocytosine nucleoside (s2C), 2-thio-5-methylcytosine nucleoside, 4-thio-pseudocytosine nucleoside, 4-thio-1-methyl-pseudocytosine nucleoside, 4-thio-1-methyl-1-deazo-pseudocytosine, 1-methyl-1-deazo-pseudocytosine, zebularine, 5-aza-zebularine, 5-methyl 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methylcytosine, 4-methoxy-pseudoisocytosine nucleoside, 4-methoxy-1-methyl-pseudoisocytosine nucleoside, lysine (k2C) 5,2′-O-dimethylcytosine nucleoside (m5Cm), N4-acetyl-2′-O-methylcytidine (ac4Cm), N4,2′-O-dimethylcytidine (m4Cm), 5-formyl-2′-O-methylcytidine (fSCm), N4,N4,2′-O-trimethylcytidine (m42Cm), 1-thiocytosine, 5-hydroxycytosine, 5-(3-azidopropyl)cytosine, and 5-(2-azidoethyl)cytosine.
[0268] In some embodiments, the non-standard nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having alternative adenine include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halopurine (e.g., 2-amino-6-chloropurine), 6-halopurine (e.g., 6-chloropurine), 2-amino-6-methylpurine, 8-azidoadenine, 7-deadenine, 7-deadenine-8-azaadenine, 7-deadenine-2-aminopurine, 7-deadenine-8-aza-2-aminopurine, 7-deadenine-2,6-diaminopurine, and 7-deadenine-8-aza-2,6-diaminopurine. -Diaminopurine, 1-methyladenine (m1A), 2-methyladenine (m2A), N6-methyladenine (m6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-isopentenyladenine (i6A), 2-methylthio-N6-isopentenyladenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (i06A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2i06A), N6-glycylcarbamoyl -Adenine (g6A), N6-threomethylcarbamoyl-adenine (t6A), N6-methyl-N6-threomethylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threomethylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxy-n-pentylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxy-n-pentylcarbamoyl-adenine (ms2hn6A), N6-acetyladenine ( ac6A), 7-methyladenine, 2-methylthioadenine, 2-methoxyadenine, N6,2′-O-dimethyladenine (m6Am), N6,N6,2′-O-trimethyladenine (m62Am), 1,2′-O-dimethyladenine (m1Am), 2-amino-N6-methylpurine, l-thioadenine, 8-azidoadenine, N6-(19-amino-pentadodecane)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine
[0269] In some embodiments, the non-standard nucleobase is a modified guanine. Exemplary nucleobases and nucleosides with modified guanine include inosine (I), 1-methylinosine (m1I), inosine (imG), methylinosine (mimG), 4-demethylinosine (imG-14), isotyrosine (imG2), wybutosine (yW), peroxytyrosine (o2yW), hydroxytyrosine (OHyW), undermodified hydroxytyrosine (OHyW*), 7-denitroguanine, quinone (... Q), cyclooxyquinone (oQ), galactosylquinone (galQ), mannosylquinone, 7-cyano-7-denitroguanine (preQO), 7-aminomethyl-7-denitroguanine (preQ1), archaeal alkaloids (G+), 7-denitro-8-azaguanine, 6-thioguanine, 6-thio-7-denitro-guanine, 6-thio-7-denitro-8-azaguanine, 7-methylguanine (m7G), 6-thio-7-methylguanine Purines, 7-methyl-inosine, 6-methoxy-guanine, 1-methylguanine (m1G), N2-methylguanine (m2G), N2,N2-dimethylguanine (m22G), N2,7-dimethylguanine (m2,7G), N2,N2,7-dimethylguanine (m2,2,7G), 8-oxoguanine, 7-methyl-8-oxoguanine, 1-methyl-6-thioguanine, N2-methyl-6-thioguanine, N2,N2 -Dimethyl-6-thioguanine, N2-methyl-2′-O-methyl-guanine (m2Gm), N2,N2-dimethyl-2′-O-methylguanosine (m22Gm), 1-methyl-2′-O-methylguanosine (mlGm), N2,7-dimethyl-2′-O-methylguanosine (m2,7Gm), 2′-O-methylinosine (Im), 1,2′-O-dimethylinosine (mIm), 1-thioguanine and O-6-methylguanine.
[0270] In some embodiments, the non-standard nucleobase of the functional nucleotide analog can be independently a purine, pyrimidine, or a purine or pyrimidine analog. For example, in some embodiments, the non-canonical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, the non-canonical nucleobase may also include, for example, naturally occurring and synthetic derivatives of the base, including pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated (e.g., 8-bromo), 8-amino, 8-thiol 8-Thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deadenine, 7-deadenine, 3-deadenine, deadenidine, 7-deadenidine, 3-deadenidine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5-triazinone, 9-deadenine, imidazo[4,5-d]pyrazine, thiazo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine, or 1,3,5-triazine.
[0271] Sugar modification
[0272] In some embodiments, the functional nucleotide analog comprises a non-standard glycosyl group. In various embodiments, the non-standard glycosyl group can be a 5-carbon or 6-carbon sugar (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxygenated derivative thereof) having one or more substituents, said substituents being halogens, hydroxyl groups, thiols, alkyl groups, alkoxy groups, alkenyloxy groups, alkynyloxy groups, cycloalkyl groups, aminoalkoxy groups, alkoxyalkoxy groups, hydroxyalkoxy groups, amino groups, azide groups, aryl groups, aminoalkyl groups, aminoalkenyl groups, aminoalkynyl groups, etc.
[0273] Typically, RNA molecules contain a ribose group, which is a five-membered ring with oxygen. Exemplary non-restrictive nucleotide substitutions include oxygen substitution in the ribose (e.g., with S, Se, or alkylene groups such as methylene or ethylene); addition to the double bond (e.g., with cyclopentenyl or cyclohexenyl substitution); ring closing of the ribose (e.g., forming a four-membered ring of cyclobutane or oxetane); and ring expansion of the ribose (e.g., forming a 6- or 7-membered ring with an additional carbon atom or heteroatom, such as anhydride hexitol, araitol, mannitol, cyclohexyl, cyclohexenyl, and morpholinoyl). (Also has an aminophosphate backbone); polycyclic forms (e.g., tricyclic and “unlocked” forms, such as glycol nucleic acids (GNA) (e.g., R-GNA or S-GNA, in which the ribose is replaced by glycol units attached to the phosphodiester bond), threononucleotides (TNA, in which the ribose is replaced by α-L-threonuranofuranose-(3′→2′)) and peptide nucleic acids (PNA, in which the 2-amino-ethyl-glycine bond replaces the ribose and the phosphodiester backbone).
[0274] In some embodiments, the sugar group comprises one or more carbons having a stereochemical configuration opposite to that of the corresponding carbon in ribose. Therefore, nucleic acid molecules may include nucleotides containing, for example, arabinose or L-ribose as sugars. In some embodiments, nucleic acid molecules include at least one nucleoside, wherein the sugar is L-ribose, 2′-O-methylribose, 2′-fluororibose, arabinose, hexitol, LNA, or PNA.
[0275] Nucleoside bond modification
[0276] In some embodiments, the payload nucleic acid molecule of this disclosure may contain one or more modified nucleoside bonds (such as a phosphate backbone). The phosphate groups of the backbone can be modified by replacing one or more oxygen atoms with different substituents.
[0277] In some embodiments, the functional nucleotide analog may include another nucleoside bond replacing the unchanged phosphate moiety. Examples of alternative phosphate groups include, but are not limited to, thiophosphates, selenophosphite, borate phosphates, phosphate borate, hydrogen phosphonate, aminophosphates, diaminophosphates, alkyl or aryl phosphonates, and triphosphates. In dithiophosphates, both non-linked oxygen atoms are replaced by sulfur. The modified phosphate bond can also be linked by replacing oxygen atoms with nitrogen (bridged aminophosphate), sulfur (bridged thiophosphate), and carbon (bridged methylene phosphonate).
[0278] Alternative nucleosides and nucleotides include borane moieties (BH3), thio, methyl, ethyl, and / or methoxy groups replacing one or more non-bridging oxygen atoms. As a non-limiting example, two non-bridging oxygen atoms at the same position (e.g., α, β, or γ positions) can be replaced by thio and methoxy groups. The stability of RNA and DNA is enhanced (e.g., against exonucleases and endonucleases) by substituting one or more oxygen atoms at the position of the phosphate moieties (e.g., α-thiophosphates) with non-natural thiophosphate backbone linkages. Phosphophosphate DNA and RNA exhibit enhanced nuclease resistance, thus having a longer half-life in the cellular environment.
[0279] Other nucleoside bonds used in this disclosure include nucleoside bonds that do not contain a phosphorus atom.
[0280] Other examples that may be combined with the nucleic acid molecules (such as mRNA), compositions, formulations, and / or related methods used in this disclosure are further included in WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, and WO2010088927. WO2010 / 037539, WO2004 / 0()4743, WO2005 / 016376, WO2006 / 024518, WO2007 / 095976, W O2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, WO2011069586, WO201 1026641, WO2011 / 144358, W02012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO201211681 0, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO2013 / 120626, WO20 The contents of each of the following documents are incorporated into this document: WO2013120627, WO2013120628, WO2013120629, WO2013174409 / WO2015127917, WO2015024667, WO2015 / 024665, W02015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, W02015024667, WO2015062738, and WO2015101416.
[0281] Dosage form
[0282] According to this disclosure, the nanoparticle compositions described herein may comprise at least one lipid component and one or more other components, such as therapeutic and / or preventative agents. The nanoparticle compositions may be designed for one or more specific applications or objectives. The elements of the nanoparticle composition may be selected based on a specific application or objective and / or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more elements. Similarly, specific formulations of the nanoparticle composition may be selected for a specific application or objective based on the efficacy and toxicity of a specific combination of elements.
[0283] The lipid component of the nanoparticle composition may include lipids of formula (I) (and its sub-formulas) as described herein, phospholipids (e.g., unsaturated lipids such as DOPE or DSPC), PEG lipids, and structural lipids. The elements of the lipid component may be provided in specific proportions.
[0284] In one embodiment, this document provides a nanoparticle composition comprising a cationic or ionizable lipid compound, a therapeutic agent, and one or more excipients as provided herein. In one embodiment, the cationic or ionizable lipid compound comprises a compound of formula (I) (and its subformulas) as described herein, and optionally one or more other ionizable lipid compounds. In one embodiment, one or more excipients are selected from neutral lipids, steroids, and polymer-conjugated lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with lipid nanoparticles.
[0285] In one embodiment, this document provides a nanoparticle composition (lipid nanoparticles) comprising:
[0286] i) 40 to 50 mole percent cationic lipids;
[0287] ii) Neutral lipids;
[0288] iii) Steroids;
[0289] iv) Polymer conjugated lipids; and
[0290] v) Therapeutic agents.
[0291] As described in this article, “molar percentage” refers to the molar percentage of a component relative to the total number of moles of all lipid components in the LNP (i.e., the total number of moles of cationic lipids, neutral lipids, steroids, and polymer conjugated lipids).
[0292] In one embodiment, the lipid nanoparticles comprise 41 to 49 mole percentages, 41 to 48 mole percentages, 42 to 48 mole percentages, 43 to 48 mole percentages, 44 to 48 mole percentages, and 45 to 48 mole percentages of cationic lipids, and the cationic lipid content is 46 to 48 mole percentages, or 47.2 to 47.8 mole percentages. In another embodiment, the lipid nanoparticles comprise about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9, or 48.0 mole percentages of the cationic lipids.
[0293] In one embodiment, the neutral lipid is present at a concentration of 5 to 15 mole percentage, 7 to 13 mole percentage, or 9 to 11 mole percentage. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 mole percentage. In one embodiment, the molar ratio of cationic lipid to neutral lipid is about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
[0294] In one embodiment, the concentration range of the steroid is 39-49 mol%, 40-46 mol%, 40-44 mol%, 40-42 mol%, 42-44 mol%, or 44-46 mol%. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mol%. In one embodiment, the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.
[0295] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the molar amount of cationic lipid and P represents the molar amount of phosphate present as part of the nucleic acid backbone) is 2:1 to 2.30:1, for example, 3:1 to 22:1. In one embodiment, the N / P ratio is 6:1 to 20:1 or 2:1 to 12:1. Exemplary N / P ranges include approximately 3:1, approximately 6:1, approximately 12:1, and approximately 22:1.
[0296] In one embodiment, this document provides a lipid nanoparticle comprising:
[0297] i) Cationic lipids with an effective pKa greater than 6.0;
[0298] ii) 5 to 15 mole percentage of neutral lipids;
[0299] iv) 30 to 45 molar percentage of steroids;
[0300] v) Polymer conjugated lipids; and
[0301] vi) Therapeutic agents or their pharmaceutically acceptable salts or prodrugs.
[0302] The molar percentage is determined based on the total molar amount of lipids present in the lipid nanoparticles.
[0303] In one embodiment, the cationic lipid can be any of a variety of lipids carrying a net positive charge at a selected pH (such as physiological pH). Exemplary cationic lipids are described below. In one embodiment, the cationic lipid has a pKa greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.
[0304] In one embodiment, the lipid nanoparticles comprise 40 to 45 molar percentages of the cationic lipids. In another embodiment, the lipid nanoparticles comprise 45 to 50 molar percentages of the cationic lipids.
[0305] In one embodiment, the molar ratio of cationic lipids to neutral lipids is about 2:1 to about 8:1. In another embodiment, the neutral lipids account for 5 to 10 molar percentages of the lipids in the lipid nanoparticles.
[0306] Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), or 1,2-distearate-sn-glycerol-3-phosphate-(1′-rac-glycerol) (DSPG).
[0307] In one embodiment, the lipid nanoparticles contain 1 to 10 mol% anionic lipids. In one embodiment, the lipid nanoparticles contain 1 to 5 mol% anionic lipids. In one embodiment, the lipid nanoparticles contain 1 to 9 mol%, 1 to 8 mol%, 1 to 7 mol%, or 1 to 6 mol% anionic lipids. In one embodiment, the molar ratio of anionic lipids to neutral lipids is 1:1 to 1:10.
[0308] In one embodiment, steroid cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol is about 5:1 to 1:1. In one embodiment, the lipid nanoparticles contain 32 to 40 mol% steroids.
[0309] In one embodiment, the sum of the molar percentages of neutral lipids and anionic lipids is 5 to 15 molar percentages. In another embodiment, the sum of the molar percentages of neutral lipids and anionic lipids is 7 to 12 molar percentages.
[0310] In one embodiment, the molar ratio of anionic lipids to neutral lipids is 1:1 to 1:10. In another embodiment, the total molar percentage of neutral lipids and steroids is 35 to 45 molar percentages.
[0311] In one embodiment, the lipid nanoparticles comprise:
[0312] i) 45-55 molar percentage of cationic lipids;
[0313] ii) 5-10 mole percentage of neutral lipids;
[0314] iii) 1-5 molar percentage of anionic lipids; and
[0315] iv) 32-40 molar percentage of steroids.
[0316] In one embodiment, the lipid nanoparticles contain 1.0 to 2.5 mole percentages of polymer-conjugated lipids. In another embodiment, the polymer-conjugated lipids are present at a concentration of about 1.5 mole percentages.
[0317] In one embodiment, the neutral lipids are present at a concentration of 5 to 15 mole percentage, 7 to 13 mole percentage, or 9 to 11 mole percentage. In one embodiment, the neutral lipids are present at a concentration of about 9.5, 10, or 10.5 mole percentage. In another embodiment, the molar ratio of cationic lipids to neutral lipids is about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
[0318] In one embodiment, the steroid is cholesterol. In some embodiments, the concentration range of the steroid is 39 to 49 mol percent, 40 to 46 mol percent, 40 to 44 mol percent, 40 to 42 mol percent, 42 to 44 mol percent, or 44 to 46 mol percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45, or 46 mol percent. In some embodiments, the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2.
[0319] In one embodiment, the molar ratio of cationic lipid to steroid is 5:1 to 1:1.
[0320] In one embodiment, the lipid nanoparticles contain 1.0 to 2.5 mole percentages of polymer-conjugated lipids. In another embodiment, the polymer-conjugated lipids are present at a concentration of about 1.5 mole percentages.
[0321] In one embodiment, the molar ratio of the cationic lipid to the polymer-conjugated lipid is from about 100:1 to about 20:1. In another embodiment, the molar ratio of the cationic lipid to the polymer-conjugated lipid is from about 35:1 to about 25:1.
[0322] In one embodiment, the lipid nanoparticles have an average diameter of 50 nm to 100 nm, or 60 nm to 85 nm.
[0323] In one embodiment, the composition comprises the cationic lipids, DSPC, cholesterol, and PEG-lipids provided herein, as well as mRNA. In one embodiment, the molar ratio of the cationic lipids, DSPC, cholesterol, and PEG-lipids provided herein is about 50:10:38.5:1.5.
[0324] Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed to deliver therapeutics and / or preventatives (e.g., RNA) to specific cells, tissues, organs, or systems within a mammal. The physicochemical properties of the nanoparticle composition can be modified to increase selectivity for specific bodily targets. For example, particle size can be tuned based on the fenestration size of different organs. The therapeutics and / or preventatives contained in the nanoparticle composition can also be selected based on one or more desired delivery targets. For example, therapeutics and / or preventatives can be selected for a specific indication, condition, disease, or symptom and / or delivered to specific cells, tissues, organs, or systems (e.g., local or specific delivery). In some embodiments, the nanoparticle composition may contain mRNA encoding mRNA capable of being translated into a target polypeptide within cells. Such compositions can be specifically designed for delivery to a specific organ. In some embodiments, the composition can be designed for specific delivery to the mammalian liver.
[0325] The amount of therapeutic and / or preventative agents in the nanoparticle composition can depend on the size, composition, desired target and / or other properties of the nanoparticle composition, as well as the nature of the therapeutic and / or preventative agents. For example, the amount of RNA that can be used in the nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and / or preventative agents and other elements (e.g., lipids) in the nanoparticle composition can also be adjusted. In some embodiments, the wt / wt ratio of the lipid component to the therapeutic and / or preventative agent in the nanoparticle composition can be from about 5:1 to about 60:1, for example, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. The wt / wt ratio of the lipid component to the therapeutic and / or preventive agent can be from about 10:1 to about 40:1. In some embodiments, the wt / wt ratio is about 20:1. The amount of the therapeutic and / or preventive agent in the nanoparticle composition can be measured by absorption spectroscopy (such as ultraviolet-visible spectroscopy).
[0326] In some embodiments, the nanoparticle composition comprises one or more RNAs, and the amount of one or more RNAs, lipids, and their dosages can be selected to provide a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected. One or more RNAs, lipids, and their dosages can be selected to give an N:P ratio of about 2:1 to about 30:1, for example, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In some embodiments, the N:P ratio may be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio can be approximately 5.0:1, approximately 5.5:1, approximately 5.67:1, approximately 6.0:1, approximately 6.5:1, or approximately 7.0:1. For example, the N:P ratio can be approximately 5.67:1.
[0327] The physical properties of nanoparticle compositions can depend on their components. For example, a nanoparticle composition containing cholesterol as a structural lipid can have different properties compared to a nanoparticle composition containing different structural lipids. Similarly, the properties of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition containing a higher molar fraction of phospholipids has different properties than a nanoparticle composition containing a lower molar fraction of phospholipids. Properties can also vary depending on the preparation method and conditions of the nanoparticle composition.
[0328] Nanoparticle compositions can be characterized using a variety of methods. For example, microscopy (such as transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (such as potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. The Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure multiple characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.
[0329] In various embodiments, the average size of the nanoparticle composition can be between 10 s nm and 100 s nm. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm. In some embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 70 nm 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In some embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.
[0330] The nanoparticle composition can be relatively homogeneous. A polydispersity index can be used to indicate the homogeneity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition. Small polydispersity indices (e.g., less than 0.3) generally indicate a narrow particle size distribution. The nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.
[0331] The zeta potential of a nanoparticle composition can be used to indicate the electromotive force of the composition. For example, the zeta potential can characterize the surface charge of the nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because substances with higher charges can interact undesirably with human cells, tissues, and other elements. In some embodiments, the zeta potential of the nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, or about -10 mV. mV to approximately +5mV, approximately -10mV to approximately 0mV, approximately -10mV to approximately -5mV, approximately -5mV to approximately +20mV, approximately -5mV to approximately +15mV, approximately -5mV to approximately +10mV, approximately -5mV to approximately +5mV, approximately -5mV to approximately +5mV, approximately -5mV to approximately 0mV, approximately 0mV to approximately +20mV, approximately 0mV to approximately +15mV, approximately 0mV to approximately +10mV, approximately 0mV to approximately +5mV, approximately +5mV to approximately +20mV, approximately +5mV to approximately +15mV, or approximately +5mV to approximately +10mV.
[0332] Encapsulation efficiency of therapeutic and / or preventative agents describes the amount of therapeutic and / or preventative agents encapsulated or associated with the nanoparticle composition after preparation, relative to the initial amount provided. High encapsulation efficiency is desired (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or preventative agents before decomposing the nanoparticle composition with one or more organic solvents or detergents and after treatment in a solution containing the nanoparticle composition. Fluorescence can be used to measure the amount of free therapeutic and / or preventative agents (e.g., RNA) in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or preventative agents can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%.
[0333] Nanoparticle compositions may optionally include one or more coatings. For example, nanoparticle compositions can be formulated into coated capsules, films, or tablets. The capsules, films, or tablets of the compositions described herein may have any useful size, tensile strength, hardness, or density.
[0334] Pharmaceutical Composition
[0335] According to this disclosure, nanoparticle compositions can be formulated as part or all of a pharmaceutical composition. A pharmaceutical composition may include one or more nanoparticle compositions. For example, a pharmaceutical composition may include one or more nanoparticle compositions and one or more different therapeutic and / or preventative agents. The pharmaceutical composition may further include one or more pharmaceutically acceptable excipients or adjuvants, such as those described herein. General guidelines for the formulation and production of pharmaceutical compositions and formulations are described, for example, in Remington's *The Science and Practice of Pharmacy*, 21st Edition, ARGennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006, etc. Conventional excipients and adjuvants can be used in any pharmaceutical composition unless they are incompatible with one or more components of the nanoparticle composition. If an excipient or adjuvant is incompatible with a component of the nanoparticle composition, their combination may result in adverse biological effects or harmful effects.
[0336] In some embodiments, one or more excipients or adjuvants may constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, typically one or more excipients or adjuvants may constitute 50%, 60%, 70%, 80%, 90%, or more pharmaceutically. In some embodiments, pharmaceutically acceptable excipients are at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipients are approved for human and veterinary use. In some embodiments, the excipients are approved by the U.S. Food and Drug Administration. In some embodiments, the excipients are pharmaceutical grade. In some embodiments, the excipients conform to the standards of the United States Pharmacopeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.
[0337] According to the pharmaceutical compositions disclosed herein, the relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any other ingredients may be varied, depending on their characteristics, size, and other relevant conditions, and further depending on the intended recipient and route of administration of the composition. For example, a pharmaceutical composition may comprise 0.1% to 100% (wt / wt) of one or more nanoparticle compositions.
[0338] In some embodiments, the nanoparticle compositions and / or pharmaceutical compositions of this disclosure are refrigerated or frozen for storage and transport. For example, they are stored at temperatures of 4°C or lower, between about -150°C and 0°C, or at temperatures from about -80°C to about -20°C, such as about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. Pharmaceutical compositions of compounds of formula (I) and its sub-formulas in solution form are refrigerated for storage or transport at conditions such as about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In some embodiments, this disclosure also relates to methods for improving the stability of nanoparticle compositions and / or pharmaceutical compositions of compounds of formula (I) (and its sub-formulas). By storing the nanoparticle compositions and / or pharmaceutical compositions at temperatures of 4°C or lower, such as between about -150°C and about 0°C or between about -80°C and about -20°C, such as about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. The nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable at temperatures of 4°C or lower (such as between about 4°C and -20°C) for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months. In one embodiment, the formulation is stable at about 4°C for at least 4 weeks. In some embodiments, the pharmaceutical compositions of this disclosure comprise the nanoparticle composition disclosed herein and one or more pharmaceutically acceptable carriers selected from Tris, acetates (e.g., acetic acid), citrates (e.g., sodium citrate), saline, PBS, and sucrose. In some embodiments, the pH of the pharmaceutical compositions of this disclosure is between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8 or 7 and 7.8). The pharmaceutical compositions of this disclosure comprise the nanoparticle composition disclosed herein, Tris, saline, and sucrose, and have a pH of about 7.5-8, suitable for storage or transport at about -20°C. For example, the pharmaceutical compositions of this disclosure comprise the nanoparticle composition disclosed herein and PBS, and have a pH of about 7-7.8, suitable for storage or transport at temperatures such as about 4°C or lower.In the context of this disclosure, “stable” and “stability” mean the resistance of the nanoparticle composition or pharmaceutical composition disclosed herein to chemical or physical changes (such as degradation, particle size change, aggregation change) under given conditions of manufacture, preparation, transport, storage and / or use (such as applied stress (shear force, freeze / thaw stress, etc.)).
[0339] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions may be administered to any patient or subject, including by delivering therapeutic and / or prophylactic agents to specific cells, tissues, organs, or systems of the patient or subject, such as the renal system, to provide a beneficial therapeutic effect. Although the description herein of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions is primarily directed toward compositions suitable for human administration, those skilled in the art will understand that such compositions are generally suitable for administration to any other mammal. It is well known that compositions suitable for human administration are modified to make them suitable for administration to a variety of animals, and veterinary pharmacists of ordinary skill can design and / or perform such modifications simply through routine experiments. Subjects intended to receive this composition include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and rats.
[0340] Pharmaceutical compositions comprising one or more nanoparticles can be prepared by any method known or subsequently developed in the field of pharmacology. Typically, such preparation methods involve combining the active ingredient with excipients and / or one or more other auxiliary ingredients, and, if necessary, shaping and / or packaging the product separately into single or mixed forms of the desired multi-dosage units.
[0341] The pharmaceutical compositions according to this disclosure can be prepared, packaged, and / or sold in bulk as a single unit dose and / or as multiple single unit doses. A “unit dose” is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of active ingredient is generally equal to the dose of the active ingredient to be administered to a subject and / or a convenient fraction of that dose, such as half or one-third of the dose.
[0342] Pharmaceutical compositions can be formulated in various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be formulated as liquid dosage forms (such as emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable dosage forms, solid dosage forms (such as capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (such as ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalers, and patches), suspensions, powders, and other forms.
[0343] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and / or elixirs. In addition to the active ingredient, liquid dosage forms may also contain inert diluents commonly used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol, dimethylformamide, oils (particularly cottonseed, peanut, corn, germ, olive oil, castor, and sesame oil), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitol and mixtures thereof. Besides inert diluents, oral compositions may contain other therapeutic and / or preventative agents, such as humectants, emulsifiers and suspending agents, sweeteners, flavoring agents, and / or fragrances, etc. In some embodiments for parenteral administration, the composition is mixed with a solubilizer such as Cremophor™, an alcohol, an oil, a modified oil, a glycol, a polysorbate, a cyclodextrin polymer, and / or a combination thereof.
[0344] Injectable formulations, such as sterile injectable aqueous or oily suspensions, can be formulated using suitable dispersants, wetting agents, and / or suspending agents according to known techniques. Sterile injectable formulations can be sterile injectable solutions, suspensions, and / or emulsions in non-toxic, parenteral-acceptable diluents and / or solvents, such as solutions in 1,3-butanediol. Acceptable media and solvents that can be used include water, American Ringer's solution, and isotonic sodium chloride solution. Sterile non-volatile oils are commonly used as solvents or suspension media. For this purpose, any mild non-volatile oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectable formulations.
[0345] Injectable formulations may be filtered through a bacterial retention filter and / or sterilized by a sterilizing agent incorporating a sterile solid composition, and dissolved or dispersed in sterile water or other sterile injectable media prior to use.
[0346] The present invention discloses methods for delivering therapeutic and / or preventive agents to mammalian cells or organs, generating target peptides in mammalian cells, and methods for treating diseases or conditions in mammals by contacting mammalian cells with a nanoparticle composition containing therapeutic and / or preventive agents.
[0347] Example
[0348] The embodiments in this section are provided as examples only and are not intended to be limiting.
[0349] General methods
[0350] Conventional preparative HPLC method: HPLC purification was performed on a Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, typically using water containing 0.1% TFA as solvent A and acetonitrile as solvent B.
[0351] General LCMS method: LCMS analysis was performed on a Shimadzu (LC-MS2020) system. Chromatography was performed on a SunFire C1 8, typically using water containing 0.1% formic acid as solvent A and acetonitrile containing 0.1% formic acid as solvent B.
[0352] Example 1: Synthesis of Compound 1.
[0353]
[0354] Synthesis of Compound 1
[0355] Compounds 3-4 (80 mg, 0.09 mmol, 1.0 eq.), compound SM1 (16 mg, 0.11 mmol, 1.2 eq.), HATU (42 mg, 0.11 mmol, 1.2 eq.), and DIEA (35 mg, 0.27 mmol, 3.0 eq.) were dissolved in dichloromethane (3 mL) and stirred at room temperature for 1 hour. The mixture was concentrated and purified by high-performance liquid chromatography to give compound 1 (32 mg, yield 34.2%), a colorless oil. (MC20-1207-108)
[0356] 1 H NMR (400MHz, CDCl3) δ: 0.81-0.94 (m, 12H), 1.16-1.35 (m, 54H), 1.36-1.49 (m, 5H), 1.50-1.69 (m, 20H), 1.76-1.86 (m, 2H), 2.17-2. 42 (m, 14H), 2.45-2.53 (m, 3H), 2.92-3.03 (m, 1H), 3.34-3.46 (m, 1H), 3.62-3.74 (m, 1H), 3.97 (d, J=5.6Hz, 3H), 4.36-4.48 (m, 1H).
[0357] LCMS: Rt: 1.270min; MS m / z(ESI): 976.9[M+H] + .
[0358] Example 2: Synthesis of compound 2.
[0359]
[0360] Synthesis of Compound 2
[0361] Compounds 3-4 (150 mg, 0.17 mmol, 1.0 eq.) were dissolved in methanol (4 mL), and 0.1 mL of 37% formaldehyde aqueous solution and 1 drop of acetic acid were added. The mixture was stirred at room temperature for 2 hours. Then, NaCNBH3 (21 mg, 0.34 mmol, 2.0 eq.) was added, and the resulting mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was concentrated and purified by high performance liquid chromatography to give compound 2 (41 mg, 27% yield), a colorless oil.
[0362] 1 H NMR (400MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.26-1.32 (m, 61H), 1.41-1.50 (m, 4H), 1.52-1.70 (m, 10H), 2.30 (t , J=7.4Hz, 4H), 2.37-2.47(m, 4H), 2.49-2.52(m, 6H), 2.69-2.77(m, 2H), 3.43-3.55(m, 1H), 3.96-3.97(m, 4H).
[0363] LCMS: Rt: 2.360min; MS m / z(ESI): 877.8[M+H] + .
[0364] Example 3: Synthesis of compound 3.
[0365]
[0366] Step 1: Synthesis of compound 3-2
[0367] Compound 3-2 (1 g, 3.85 mol, 1.0 eq.) and Pd / C were added to ethyl acetate (40 mL) under hydrogen protection and stirred overnight at 40 °C. The reaction solution was filtered through diatomaceous earth, and the filtrate was concentrated to give a colorless oily compound 3-2 (789 mg, yield 89.2%). (MC20-1207-092)
[0368] LCMS: Rt: 0.380min; MS m / z(ESI): 231.2[M+H] + .
[0369] Step 2: Synthesis of compound 3-3
[0370] Compound 3-2 (82 mg, 0.36 mmol, 1.0 eq.), compound SM2 (400 mg, 0.89 mmol, 2.5 eq.), K2CO3 (149 mg, 1.08 mmol, 3.0 eq.), and Cs2CO3 (3 mg, 0.01 mmol, 0.03 eq.) were added to acetonitrile (10 mL) and stirred overnight at 100 °C. The reaction mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM = 0%–3%) to give a yellow oily compound 3-3 (162 mg, yield 47.2%). (MC20-1207-094)
[0371] LCMS: Rt: 2.200min; MS m / z(ESI): 963.9[M+H] + .
[0372] Step 3: Synthesis of compounds 3-4
[0373] Compound 3-4 (162 mg, 0.17 mmol, 1.0 eq.) was dissolved in dichloromethane (3 mL), and TFA (1 mL, 13.5 mmol, 79.0 eq.) was added. The mixture was stirred at room temperature for 3 hours. The reaction solution was concentrated to give 177 mg of crude, yellow, oily compound 3-4. (MC20-1207-095)
[0374] LCMS: Rt: 1.950min; MS m / z (ESI): 863.8[M+H]+.
[0375] Step 4: Synthesis of Compound 3
[0376] Compounds 3-4 (84 mg, 0.10 mmol, 1.0 eq.), compound SM3 (15 mg, 0.15 mmol, 1.5 eq.), HATU (46 mg, 0.12 mmol, 1.2 eq.), and DIEA (65 mg, 0.5 mmol, 5.0 eq.) were added to dichloromethane (3 mL) and stirred at room temperature for 1 hour. The reaction solution was concentrated and purified by high performance liquid chromatography to give a colorless oily compound 3 (35 mg, yield 38.0%). (MC20-1207-099).
[0377] 1H NMR (400MHz, CDCl3) δ: 0.82-0.94 (m, 12H), 1.03-1.35 (m, 59H), 1.35-1.49 (m, 5H), 1.49-1.71 (m, 15H), 2.19-2.29 (m, 6H), 2.29-2.38 (m, 4 H), 2.43-2.54(m, 3H), 2.94-3.09(m, 2H), 3.12-3.20(m, 1H), 3.33-3.45(m, 1H), 3.84-3.93(m, 1H), 3.97(d, J=6.0Hz, 3H), 4.32-4.47(m, 1 H).
[0378] LCMS: Rt: 1.900min; MS m / z (ESI): 948.8[M+H]+.
[0379] Step 5: Synthesis of compound SM2
[0380] Compound SM2-1 (2.0 g, 7.394 mmol, 1.0 eq.), compound SM10 (2.2 g, 11.09 mmol, 1.5 eq.), and TsOH (500 mg) were added to toluene (20 mL) and stirred under reflux for 2 hours. TLC showed the reaction was complete. The mixture was concentrated and purified by column chromatography to give a yellow oily compound SM2 (3 g, 90.90% yield). (MC20-1195-029)
[0381] Example 4: Synthesis of compound 4.
[0382]
[0383] Synthesis of Compound 4
[0384] Compounds 3-4 (80 mg, 0.09 mmol, 1.0 eq.), compound SM4 (18 mg, 0.10 mmol, 1.1 eq.), HATU (42 mg, 0.11 mmol, 1.2 eq.), and DIEA (36 mg, 0.27 mmol, 3.0 eq.) were added to dichloromethane (3 mL) and stirred at room temperature for 1 hour. The mixture was concentrated and purified by high performance liquid chromatography to give compound 4 (26 mg, yield 28.3%) as a colorless oil. (MC20-1207-101)
[0385] 1H NMR (400MHz, CDCl3) δ: 0.81-0.93 (m, 12H), 1.08-1.35 (m, 60H), 1.35-1.74 (m, 23H), 2.18-2.40 (m, 14H), 2.44-2 .57 (m, 3H), 2.91-3.03 (m, 1H), 3.36-3.48 (m, 1H), 3.60-3.71 (m, 1H), 3.97 (d, J=6.0Hz, 3H), 4.36-4.48 (m, 1H).
[0386] LCMS: Rt: 1.900min; MS m / z(ESI): 990.9[M+H] + .
[0387] Example 5: Synthesis of compound 5.
[0388]
[0389] Synthesis of Compound 5
[0390] Compounds 3-4 (80 mg, 0.09 mmol, 1.0 eq.), compound SM5 (16 mg, 0.11 mmol, 1.2 eq.), HATU (42 mg, 0.11 mmol, 1.2 eq.), and DIEA (35 mg, 0.27 mmol, 3.0 eq.) were added to dichloromethane (3 mL) and stirred at room temperature for 1 hour. The mixture was concentrated and purified by high performance liquid chromatography to give compound 5 (37 mg, 40.0% yield) as a pale yellow oil (MC20-1207-110).
[0391] 1 H NMR (400MHz, CDCl3) δ: 0.80-0.94(m, 12H), 1.12-1.35(m, 57H), 1.36-1.49(m, 5H), 1.50-1.69(m, 17H), 1.91-2.06(m, 1H), 2.16-2.38(m, 1 0H), 2.43-2.57(m, 5H), 2.61-2.71(m, 1H), 2.92-3.03(m, 1H), 3.36-3.50(m, 1H), 3.60-3.73(m, 1H), 3.97(d, J=6.0Hz, 3H), 4.36-4.48(m, 1 H).
[0392] LCMS: Rt: 1.890min MS m / z (ESI): 962.9[M+H] + .
[0393] Example 6: Synthesis of compound 6.
[0394]
[0395] Step 1: Synthesis of compounds 3-4
[0396] Compound 3-3 (500 mg, 0.57 mmol, 1.0 eq.) was dissolved in dichloromethane (6 mL), and TFA (1 mL) was added. The mixture was stirred at room temperature for 1 hour, and TLC showed that the reaction was complete. The reaction solution was quenched with water, extracted with ethyl acetate, and concentrated to give a yellow oily compound 3-4 (412 mg, yield 84%). (MC21—151-055)
[0397] Step 2: Synthesis of Compound 6
[0398] Compounds 3-4 (200 mg, 0.23 mmol, 1.0 eq.) and SM6 (14 mg, 0.23 mmol, 1.0 eq.) were dissolved in methanol (10 mL), and 1 drop of acetic acid was added. The mixture was stirred at room temperature for 5 hours, and then NaCNBH3 (20 mg) was added and stirred for 1 hour. LCMS showed that the reaction was complete. After concentration, the mixture was purified by high performance liquid chromatography to give compound 6 (58 mg, yield 28%), which was a yellow oil.
[0399] 1 H NMR (400MHz, CDCl3): 0.81-0.91 (m, 12H), 0.92-1.00 (m, 3H), 1.15-1.35 (m, 62H), 1.36-1.51 (m, 5H), 1.52-1 .71(m, 11H), 1.73-1.91(m, 2H), 2.23-2.36(m, 4H), 2.37-2.43(m, 2H), 2.44-2.55(m, 7H), 3.91-4.02(m, 4H).
[0400] LCMS: Rt: 2.080min; MS m / z (ESI): 905.9[M+H] + .
[0401] Example 7: Synthesis of Compound 7
[0402]
[0403] Step 1: Synthesis of Compound 7-2
[0404] Compound 7-1 (1.0 g, 4.7 mmol, 1.0 eq.) and compound SM7 (11.7 mL, 23.5 mmol, 5.0 eq. 2 min THF) were dissolved in ACN (10.0 mL) and stirred at room temperature for 16 hours. LC-MS showed that the reaction was complete. The mixture was concentrated to give a yellow oily compound 7-2 (1.2 g, crude product). (MC20-1234-065)
[0405] LCMS: Rt: 0.733min; MS m / z(ESI): 259.2[M+H] + .
[0406] Step 2: Synthesis of Compound 7-3
[0407] Compound 7-2 (1.2 g, 40.65 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL), and dioxane hydrochloride (10.0 mL) was added at 0 °C. The mixture was stirred for 16 hours. LC-MS showed that the reaction was complete. The mixture was concentrated to give a brown solid compound 7-3 (1.0 g, crude). (MC20-1234-067)
[0408] LCMS: Rt: 0.278min; MS m / z(ESI): 159.2[M+H] + .
[0409] Step 3: Synthesis of Compound 7
[0410] Compound 7-3 (200.0 mg, 1.26 mmol, 1.0 eq.) and compound SM8 (1.0 g, 1.26 mmol, 1.0 eq.) were dissolved in dichloromethane (10.0 mL). DIEA (812.0 mg, 6.3 mmol, 5.0 eq.) and HATU (625.0 mg, 1.64 mmol, 1.3 eq.) were added at 0 °C, and the mixture was stirred at room temperature for 16 hours. LCMS showed the reaction was complete. The mixture was concentrated and purified by high performance liquid chromatography to give a yellow oily compound 7 (20.0 mg, 2% yield). (MC20-1234-079).
[0411] 1H NMR (400MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.14-1.36 (m, 63H), 1.56-1.68 (m, 13H), 2.28-2.38 (m, 6H), 2.47 (s, 6 H), 2.75(s, 5H), 3.00-3.06(m, 3H), 3.38-3.50(m, 1H), 3.65-3.71(m, 1H), 3.95-3.97(m, 4H), 4.34-4.44(m, 1H).
[0412] LCMS: Rt: 0.530min; MS m / z (ESI): 962.8[M+H]+.
[0413] Step 4: Synthesis of compound SM8-1
[0414] Compound SM2 (2 g, 4.469 mmol, 3.0 eq.) was dissolved in acetonitrile (30 mL), and PMBNH2 (200 mg, 1.490 mmol, 1.0 eq.), K2CO3 (0.62 g, 4.469 mmol, 3.0 eq.), Cs2CO3 (150 mg, 0.4469 mmol, 0.3 eq.), and NaI (22 mg, 0.1490 mmol, 0.1 eq.) were added. The reaction mixture was stirred at 85 °C for 16 hours. Thin-layer chromatography showed that the reaction was complete. After concentration and purification, a yellow oily compound SM8-1 (1.1 g, yield 84.84%) was given. (MC20-1144—082)
[0415] Step 5: Synthesis of compound SM8-2
[0416] Compound SM8-1 (1.1 g, 1.264 mmol) was dissolved in ethyl acetate (40 mL) under hydrogen protection, and Pd / C (200 mg) was added. The reaction mixture was stirred at 40 °C for 16 hours. Thin-layer chromatography showed that the reaction was complete. After filtration through a Celite pad, washing with ethyl acetate, and concentration and purification by silica gel column chromatography, a yellow oily compound SM8-2 (0.9 g, yield 94.91%) was given. (MC20-1195-083)
[0417] Step 6: Synthesis of compound SM8
[0418] SM8-2 (434 mg, 0.58 mmol, 1.0 eq.), 3-bromopropionic acid (266 mg, 1.74 mmol, 3.0 eq.), DIEA (374 mg, 2.90 mmol, 5.0 eq.), and NaI (44 mg, 0.29 mmol, 0.5 eq.) were added to tetrahydrofuran (20 mL), and the mixture was stirred overnight at 70 °C. The mixture was concentrated to give a white solid compound SM8 (821 mg, crude product). (MC20-1207-115)
[0419] LCMS: Rt: 1.547min; MS m / z(ESI): 822.7[M+H] + .
[0420] Example 8: Synthesis of compound 8.
[0421]
[0422] Step 1: Synthesis of Compound 8-1
[0423] Compound 8-1 (460.0 mg, 2.0 mmol, 1.0 eq.) and compound SM9 (168.0 mg, 2.4 mmol, 1.2 eq.) were dissolved in methanol (10.0 mL). Tetrapropyltitanate (804.0 mg, 3.0 mmol, 1.5 eq.) was added at room temperature, and the mixture was stirred at 50 °C for 2 hours. Then, NaCNBH3 (136.0 mg, 4.0 mmol, 2.0 eq.) was added, and the mixture was stirred at 50 °C for 16 hours. LC-MS showed the reaction was complete. Water (20.0 mL) was added, and the mixture was concentrated and purified by column chromatography (DCM / MeOH = 1 / 0-10 / 1) to give a yellow oily compound 8-1 (0.4 g, crude product). (MC20-1234-074)
[0424] LCMS: Rt: 0.703min; MS m / z(ESI): 285.2[M+H] + .
[0425] Step 2: Synthesis of Compound 8-2
[0426] Compound 8-1 (0.4 g, 1.4 mmol, 1.0 eq.) and compound SM2 (628.0 mg, 1.4 mmol, 1.0 eq.) were dissolved in tetrahydrofuran (10.0 mL). DIEA (903.0 mg, 7.0 mmol, 5.0 eq.) and NaI (20.0 mg, 0.04 mmol, 0.1 eq.) were added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LC-MS showed the reaction was complete. After concentration, the mixture was purified by column chromatography (DCM / MeOH = 1 / 0-20 / 1) to give a yellow oily compound 8-2 (0.2 g, 22% yield). (MC20-1234-077)
[0427] LCMS: Rt: 0.942min; MS m / z(ESI): 651.6[M+H] + .
[0428] Step 3: Synthesis of Compound 8-3
[0429] Compound 8-2 (0.2 g, 0.31 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL), and TFA (1.0 mL) was added at 0 °C. The mixture was stirred at room temperature for 16 hours, and LC-MS showed that the reaction was complete. The mixture was concentrated to give a brown oily compound 8-3 (0.19 g, crude product). (MC20-1234-078)
[0430] LCMS: Rt: 0.808min; MS m / z(ESI): 551.5[M+H] + .
[0431] Step 4: Synthesis of Compound 8
[0432] Compound 8-3 (190.0 mg, 0.345 mmol, 1.0 eq.) and compound SM2 (154.0 mg, 0.345 mmol, 1.0 eq.) were dissolved in tetrahydrofuran (10.0 mL), and DIEA (222.0 mg, 1.73 mmol, 5.0 eq.) and NaI (5.0 mg, 0.034 mmol, 0.1 eq.) were added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed that the reaction was complete, and the concentrate was purified by high performance liquid chromatography to give compound 8 (20.0 mg, 6% yield) as a yellow oil (MC20-1234-080).
[0433] 1H NMR (400MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.14-1.36 (m, 62H), 1.54-1.69 (m, 17H), 1.79- 1.98(m, 6H), 2.27-2.36(m, 7H), 2.50-2.54(m, 3H), 3.33-3.35(m, 1H), 3.95-3.97(m, 4H).
[0434] LCMS: Rt: 0.524min; MS m / z(ESI): 917.8[M+H] + .
[0435] Example 9: Synthesis of compound 9.
[0436]
[0437] Step 1: Synthesis of Compound 9-1
[0438] Compound 7-3 (200.0 mg, 1.0 mmol, 1.0 eq.) and compound SM10 (0.94 g, 1.0 mmol, 1.0 eq.) were dissolved in DMF (10.0 mL). DIEA (516.0 mg, 4.0 mmol, 4.0 eq.) and HATU (494.0 mg, 1.3 mmol, 1.3 eq.) were added at 0 °C. The mixture was stirred at room temperature for 16 hours. LC-MS showed the reaction was complete. The reaction solution was concentrated and purified by column chromatography (DCM / MeOH = 1 / 0-20 / 1) to give a yellow oily compound 9-1 (300.0 mg, crude product). (MC20-1234-094).
[0439] LCMS: Rt: 0.693min; MS m / z(ESI): 335.1[M+H] + .
[0440] Step 2: Synthesis of Compound 9
[0441] Compound 9-1 (300.0 mg, 0.89 mmol, 1.0 eq.) and compound SM11 (0.62 g, 0.89 mmol, 1.0 eq.) were dissolved in acetonitrile (10.0 mL). K2CO3 (368.0 mg, 2.67 mmol, 3.0 eq.), Cs2CO3 (86.0 mg, 0.267 mmol, 0.3 eq.), and NaI (13.0 mg, 0.089 mmol, 0.1 eq.) were added at 0 °C. The mixture was stirred at 85 °C for 16 hours. LCMS showed the reaction was complete. After concentration, the mixture was purified by high-performance liquid chromatography to give a yellow oily compound 9 (21.0 mg, yield 2.5%). (MC20-1234-096).
[0442] 1 H NMR (400MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.14-1.36 (m, 63H), 1.56-1.65 (m, 12H), 2.28-2.37 (m, 1 8H), 2.90-3.06(m, 1H), 3.36-3.46(m, 1H), 3.61-3.69(m, 1H), 3.95-3.97(m, 4H), 4.34-4.44(m, 1H).
[0443] LCMS: Rt: 1.470min; MS m / z(ESI): 948.8[M+H] + .
[0444] Step 3: Synthesis of compound SM11-1
[0445] Compound SM13 (10 g, 21.87 mmol, 1.0 eq.) was dissolved in acetonitrile (50 mL), and K2CO3 (3.02 g, 21.87 mmol, 1.0 eq.), Cs2CO3 (2.38 g, 7.29 mmol, 0.3 eq.), NaI (0.2 g, 1.46 mmol, 0.07 eq.), and PMBNH2 (1 g, 7.29 mmol, 0.3 eq.) were added. The reaction mixture was stirred at 80 °C for 10 hours. The reaction mixture was poured into water (100 mL) and extracted with dichloromethane (3 x 100 mL). The organic phase was washed with brine, dried over anhydrous Na2SO4, and concentrated under vacuum. The crude product was subjected to column chromatography (EtOAc:PE = 2:1) to give a yellow oily compound SM11-1 (5 g, yield: 84%).
[0446] (MC19—89—111)
[0447] LCMS: Rt: 1.445min MS m / z (ESI): 814.6[M+H]+ .
[0448] Step 4: Synthesis of compound SM11
[0449] Compound SM11-1 (5 g, 6.14 mmol, 1.0 eq.) was dissolved in ethyl acetate (100 mL), and Pd / C (1.0 g) was added. The mixture was stirred at room temperature for 10 hours under hydrogen protection. The reaction mixture was filtered and concentrated to give a yellow oily compound SM11 (4.0 g, 94% yield) (MC19-89-112).
[0450] LCMS: Rt: 1.535min; MS m / z(ESI): 694.6[M+H] + .
[0451] Example 10: Synthesis of compound 10.
[0452]
[0453] Step 1: Synthesis of Compound 10-1
[0454] Compound 7-1 (1.0 g, 4.7 mmol, 1.0 eq.) and compound SM12 (11.7 mL, 23.5 mmol, 5-0 eq, 2 min THF) were dissolved in methanol (10.0 mL) and stirred at room temperature for 16 hours. LC-MS showed that the reaction was complete. The mixture was concentrated to give a yellow oily compound 10-1 (1.2 g, crude product). (MC20-1234-106)
[0455] LCMS: Rt: 0.714min; MS m / z(ESI): 273.2[M+H] + .
[0456] Step 2: Synthesis of compound 10-2
[0457] Compound 10⁻¹ (1.2 g, 4.4 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL), and dioxane hydrochloride (10.0 mL) was added at 0 °C. The mixture was stirred for 16 hours. LC-MS showed that the reaction was complete. The mixture was concentrated to give a brown solid compound 10⁻² (1.0 g, crude product). (MC20-1234-110)
[0458] LCMS: Rt: 0.329min; MS m / z(ESI): 173.2[M+H] + .
[0459] Step 3: Synthesis of Compound 10
[0460] Compound 10-2 (100.0 mg, 0.57 mmol, 1.0 eq.) and compound 14-1 (0.43 g, 0.57 mmol, 1.0 eq.) were dissolved in tetrahydrofuran (10.0 mL), and DIEA (220.0 mg, 1.71 mmol, 5.0 eq.) and NaI (8.0 mg, 0.057 mmol, 0.1 eq.) were added at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed that the reaction was complete, and the concentrate was purified by high performance liquid chromatography to give compound 10 (70.0 mg, 14% yield) as a yellow oil (MC20-1234-111).
[0461] 1 H NMR (400MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.02-1.05 (m, 3H), 1.26-1.36 (m, 53H), 1.43-1.4 6(m, 4H), 1.56-1.65(m, 10H), 2.27-2.34(m, 9H), 2.40-2.69(m, 14H), 3.96(d, J=5.6Hz, 4H).
[0462] LCMS: Rt: 1.247min; MS m / z(ESI): 892.8[M+H] + .
[0463] Example 11: Synthesis of compound 11.
[0464]
[0465] Step 1: Synthesis of Compound 11-1
[0466] Compound 7-1 (885 mg, 4.56 mmol, 1.1 eq.) and CH3NH2 (1.0 g, 4.15 mmol, 1.0 eq.) were added to methanol (20 mL), and the mixture was stirred under sealed conditions at 60 °C for 16 h. LC-MS showed that the reaction was complete. The mixture was concentrated and purified by silica gel column chromatography (EA:PE = 0%–5%) to give a colorless oily compound 11-1 (1.2 g, yield 63%). (MC21-151-067)
[0467] LCMS: Rt: 0.710min; MS m / z(ESI): 245.2[M+H] + .
[0468] Step 2: Synthesis of compound 11-2
[0469] Compound 11-1 (500 mg, 2.05 mmol, 1.0 eq.), compound SM13 (1.03 g, 2.46 mmol, 1.1 eq.), K2CO3 (849 mg, 6.15 mmol, 3.0 eq.), Cs2CO3 (202 mg, 0.62 mmol, 0.3 eq.), and NaI (30 mg, 0.21 mmol, 0.1 eq.) were added to acetonitrile (20 mL) and stirred overnight at 85 °C. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM = 0%–10%) to give a yellow oily compound 11-2 (1.0 g, yield 83%). (MC21-151-068)
[0470] LCMS: Rt: 0.900min; MS m / z(ESI): 583.5[M+H] + .
[0471] Step 3: Synthesis of Compound 11-3
[0472] Compound 11-2 (500 mg, 0.86 mmol, 1.0 eq.) was dissolved in dichloromethane (10 mL), and TFA (2 mL) was added at room temperature. The mixture was stirred for 16 hours. LC-MS showed that the reaction was complete. The reaction solution was concentrated to give a yellow oily compound 11-3 (322 mg, yield 78%). (MC21-151-072)
[0473] LCMS: Rt: 0.760min; MS m / z(ESI): 483.4[M+H] + .
[0474] Step 4: Synthesis of Compound 11
[0475] Compound 11-3 (320 mg, 0.66 mmol, 1.0 eq.), compound SM13 (420 mg, 1.00 mmol, 1.5 eq.), K2CO3 (280 mg, 2.00 mmol, 3.0 eq.), Cs2CO3 (65 mg, 0.20 mmol, 0.3 eq.), and NaI (10 mg, 0.07 mmol, 0.1 eq.) were added to acetonitrile (10 mL) and stirred overnight. After purification by high performance liquid chromatography, a yellow oily compound 11 (83 mg, 15% yield) was obtained. (MC21-151-073)
[0476] 1H NMR (400MHz, CDCl3) δ: 0.82-0.94 (m, 12H), 1.14-1.39 (m, 53H), 1.40-1.50 (m, 3H), 1.51-1 .72(m, 13H), 2.22-2.39(m, 9H), 2.40-2.53(m, 5H), 2.65-2.84(m, 1H), 3.99-3.89(m, 4H).
[0477] LCMS: Rt: 1.190min; MS m / z(ESI): 821.8[M+H] + .
[0478] Step 5: Synthesis of compound SM13
[0479] Compound SM13-1 (20.2 g, 83.3 mmol, 1.0 eq.) and compound SM10 (19.5 g, 100 mol, 1.2 eq.) were dissolved in dichloromethane (300 mL), and EDCI (24.0 g, 125 mmol, 1.5 eq.), DMAP (2.0 g, 16.7 mmol, 0.2 eq.), and DIEA (27.0 g, 208 mmol, 2.5 eq.) were added. The mixture was stirred at room temperature for 16 hours. TLC showed that the reaction was complete. The mixture was concentrated and purified by silica gel column chromatography (EA / PE = 0-1%) to give a colorless oily compound SM13 (17 g, yield 49%). (MC20-71-001)
[0480] Example 12: Synthesis of compound 12.
[0481]
[0482] Step 1: Synthesis of Compound 12-1
[0483] Compound 3-2 (690 mg, 0.9 mmol, 1.0 eq.) was dissolved in methanol (10 mL), and compound SM14 (400 mg, 3.6 mmol, 1.2 eq.) and Ti(OPr)4 (1.2 g, 4.5 mmol, 1.5 eq.) were added. The mixture was stirred at room temperature for 5 hours. Then, NaCNBH3 (408 mg, 6.0 mmol, 2.0 eq.) was added. The mixture was stirred at room temperature for 10 hours. Thin-layer chromatography showed that the reaction was complete. The mixture was poured into water, extracted with ethyl acetate, and the organic phase was separated and dried over Na2SO4. After concentration, the solution was purified by high-performance liquid chromatography to give a yellow oily compound 12-1 (700 mg, 78% yield). (MC21-151-064)
[0484] Step 2: Synthesis of Compound 12-2
[0485] Compound 12-1 (300 mg, 1.00 mmol, 1.0 eq.), compound SM13 (420 mg, 1.00 mmol, 1.0 eq.), K2CO3 (414 mg, 3.00 mmol, 3.0 eq.), Cs2CO3 (98 mg, 0.30 mmol, 0.3 eq.), and NaI (14 mg, 0.10 mmol, 0.1 eq.) were added to acetonitrile (10 mL) and stirred overnight at 85 °C. The mixture was concentrated and purified by silica gel column chromatography (MeOH:DCM = 0%–10%) to give a yellow oily compound 12-2 (290 mg, yield 83%). (MC21-151-066)
[0486] LCMS: Rt: 0.890min; MS m / z(ESI): 637.5[M+H] + .
[0487] Step 3: Synthesis of Compound 12-3
[0488] Compound 12-2 (290 mg, 0.46 mmol, 1.0 eq.) was dissolved in dichloromethane (10 mL), and TFA (2 mL) was added at room temperature. The mixture was stirred for 16 hours. LC-MS showed that the reaction was complete. The reaction solution was concentrated to give a yellow oily compound 12-3 (290 mg, 80% yield). (MC21-151-072)
[0489] LCMS: Rt: 0.760min; MS m / z(ESI): 537.4[M+H] + .
[0490] Step 4: Synthesis of Compound 12
[0491] Compound 12-3 (290 mg, 0.54 mmol, 1.0 eq.), SM13 (273 mg, 0.65 mmol, 1.2 eq.), K2CO3 (222 mg, 1.59 mmol, 3.0 eq.), Cs2CO3 (52 mg, 0.16 mmol, 0.3 eq.), and NaI (7 mg, 0.05 mmol, 0.1 eq.) were added to acetonitrile (10 mL) and stirred overnight at 85 °C. The mixture was purified by high-performance liquid chromatography to give a yellow oily compound 12 (96 mg, 20% yield). (MC21-151-071)
[0492] 1H NMR (400MHz, CDCl3) δ: 0.78-0.93 (m, 12H), 1.17-1.40 (m, 54H), 1.41-1.81 (m, 22H), 2.22- 2.45(m, 9H), 2.46-2.58(m, 2H), 2.59-2.77(m, 2H), 3.08-3.28(m, 1H), 3.90-4.03(m, 4H).
[0493] LCMS: Rt: 1.240min; MS m / z(ESI): 875.8[M+H] + .
[0494] Example 13: Synthesis of compound 13.
[0495]
[0496] Step 1: Synthesis of Compound 13-1
[0497] Compound 3-2 (690.0 mg, 3.0 mmol, 1.0 eq.) and compound SM15 (353.0 mg, 3.6 mmol, 1.2 eq.) were dissolved in methanol (10.0 mL). Tetrapropyltitanate (1.2 g, 4.5 mmol, 1.5 eq.) was added at room temperature, and the mixture was stirred at 50 °C for 2 hours. Then, NaCNBH3 (408.0 mg, 6.0 mmol, 2.0 eq.) was added, and the mixture was stirred at 50 °C for 16 hours. LC-MS showed the reaction was complete. H2O (20.0 mL) was added, and the mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = I / O-10 / 1) to give a yellow oily compound 13-1 (0.9 g, crude product). (MC20-1234-081)
[0498] LCMS: Rt: 0.720min; MS m / z(ESI): 313.2[M+H] + .
[0499] Step 2: Synthesis of Compound 13-2
[0500] Compound 13-1 (0.9 g, 2.88 mmol, 1.0 eq.) and compound SM13 (1.2 g, 2.88 mmol, 1.0 eq.) were added to THF (10.0 mL), followed by the addition of DIEA (1.8 g, 14.4 mmol, 5.0 eq.) and NaI (42.0 mg, 0.29 mmol, 0.1 eq.) at 0 °C. The mixture was stirred at 70 °C for 16 hours. LC-MS showed the reaction was complete. The mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = 1 / 0-20 / 1) to give a yellow oily compound 13-2 (0.6 g, 32% yield). (MC20-1234-086)
[0501] Step 3: Synthesis of Compound 13-3
[0502] Compound 13-2 (0.48 g, 0.74 mmol, 1.0 eq.) was dissolved in dichloromethane (10.0 mL), and TFA (2.0 mL) was added at 0 °C. The mixture was stirred at room temperature for 16 hours, and LC-MS showed that the reaction was complete. After concentration, a brown oily compound 13-3 (0.42 g, crude product) was given. (MC20-1234-088)
[0503] LCMS: Rt: 0.794min; MS m / z(ESI): 551.5[M+H] + .
[0504] Step 4: Synthesis of Compound 13
[0505] Compound 13-3 (200.0 mg, 0.36 mmol, 1.0 eq.) and compound SM13 (228.0 mg, 0.54 mmol, 1.5 eq.) were dissolved in acetonitrile (15.0 mL). K2CO3 (149 mg, 1.08 mmol, 3.0 eq.), Cs2CO3 (35.0 mg, 0.11 mmol, 0.3 eq.), and NaI (5.0 mg, 0.036 mmol, 0.1 eq.) were added at room temperature. The mixture was stirred at 80 °C for 16 hours. LC-MS showed the reaction was complete. The reaction solution was concentrated and purified by high-performance liquid chromatography to give a colorless oily compound 13 (27.0 mg, yield 8%). (MC20-30-090).
[0506] 1 H NMR (400MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.14-1.36 (m, 59H), 1.45-1.70 (m, 22H), 2.21-2.41 (m, 11H), 3.89-3.90 (m, 4H).
[0507] LCMS: Rt: 1.550min; MS m / z(ESI): 889.8[M+H] + .
[0508] Example 14: Synthesis of compound 14.
[0509]
[0510] Synthesis of Compound 14
[0511] Compound 14-1 (0.75 g, 1.0 mmol, 1.0 eq.) and compound 7-3 (0.2 g, 1.0 mmol, 1.0 eq.) were added to THF (10.0 mL), followed by DIEA (0.64 g, 5.0 mmol, 5.0 eq.) and NaI (14.6 mg, 0.1 mmol, 0.1 eq.) at 0 °C. The mixture was stirred at 70 °C for 16 hours. LCMS showed that the reaction was complete. The reaction solution was concentrated and purified by high performance liquid chromatography to give a brown oily compound 14 (57.0 mg, yield 6%). (MC20-1234-102)
[0512] 1 H NMR (400MHz, CDCl3) δ: 0.86-0.90 (m, 12H), 1.26-1.32 (m, 53H), 1.43-1.45 (m, 4H), 1.59 -1.65(m, 10H), 2.28-2.32(m, 6H), 2.36(s, 6H), 2.41-2.61(m, 12H), 3.96-3.97(m, 4H).
[0513] LCMS: Rt: 1.580min; MS m / z(ESI): 878.8[M+H] + .
[0514] Example 15: Synthesis of compound 15.
[0515]
[0516] Step 1: Synthesis of Compound 15-2
[0517] Compound 15-1 (200 mg, 0.27 mmol, 1.0 eq.), MsCl (38 mg, 0.33 mmol, 1.2 eq.), and DIEA (106 mg, 0.82 mmol, 3.0 eq.) were added to dichloromethane (5 mL) and stirred for 1 hour. The mixture was quenched with water, extracted with ethyl acetate, and the organic phase was dried and concentrated to give a yellow oily compound 15-2 (306 mg, crude). (MC20-364-028)
[0518] Step 2: Synthesis of Compound 15
[0519] Compound 15-2 (137 mg, 0.19 mmol, 1.0 eq.), compound 7-3 (36 mg, 0.22 mmol, 1.2 eq.), and DIEA (73 mg, 0.56 mmol, 3.0 eq.) were added to DMF (5 mL) and stirred overnight at 80 °C. The mixture was diluted with water, extracted with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated and purified by high performance liquid chromatography to give a colorless oily compound 15 (19 mg, yield 12.8%). (MC21-364-033)
[0520] 1 H NMR (400MHz, CDCl3) δ: 0.82-0.92(m, 12H), 1.19-1.32(m, 56H), 1.33-1.38(m, 3H), 1.76-1.87(m, 2H), 1.93-2.07(m, 2H), 2.18-2.29(m, 6H), 230-238(m, 9H), 2.58-2.68(m, 2H), 3.97-4.11(m, 4H).
[0521] LCMS: Rt: 0.080min; MS m / z(ESI): 793.6[M+H] + .
[0522] Example 16: Preparation and Characterization of Lipid Nanoparticles
[0523] In summary, the cationic lipids, DSPC, cholesterol, and PEG-lipids provided in this invention were dissolved in ethanol at a molar ratio of 50:10:38.5:1.5, and the mRNA was diluted in 10 to 50 mM citrate buffer at pH 4. Using a microfluidic device, the ethanol lipid solution was mixed with the mRNA aqueous solution at a volume ratio of 1:3 at a flow rate of 9–30 mL / min to prepare LNPs with a total lipid to mRNA weight ratio of approximately 10:1 to 30:1. Digestive PBS was used instead of ethanol to remove it. Finally, the lipid nanoparticles were filtered through a 0.2 μm sterile filter.
[0524] The size of the liposome nanoparticles was determined by dynamic light scattering using a Malvern Zetasizer NanoZS (Malvern UK) in 173° backscatter detection mode. The encapsulation efficiency of the lipid nanoparticles was determined using the Quant-it Ribogreen RNA Quantification Kit (Thermo Fisher Scientific, UK) according to the manufacturer's instructions.
[0525] As reported in the literature, the apparent pKa of LNP formulations is correlated with the efficiency of LNP delivery to nucleic acids in vivo. The apparent pKa of each formulation was determined using a fluorescence assay based on 2-(p-tolyl)-6-naphthalenesulfonic acid (TNS). LNP formulations containing cationic lipids / DSPC / cholesterol / DMG-PEG (50 / 10 / 38.5 / 1.5 mol%) were prepared as described above. TNS was prepared as a 300 μM distilled water stock solution. The LNP formulations were diluted to a total lipid concentration of 0.1 mg / mL in 3 mL of a buffer solution containing 50 mM sodium citrate, 50 mM sodium phosphate, 50 mM sodium borate, and 30 mM sodium chloride, with a pH ranging from 3 to 9. TNS solution was added to a final concentration of 0.1 mg / mL, and after vortex mixing, fluorescence intensity was measured at room temperature using an excitation wavelength of 325 nm and 435 nm on a Molecular Devices Spectramax iD3 spectrometer. S-shaped best-fit analysis was performed on the fluorescence data, and the pKa value was measured when the pH value reached half of the maximum fluorescence intensity.
[0526] Example 17: Animal Research
[0527] Lipid nanoparticles containing human erythropoietin (hEPO) mRNA encapsulated with the compounds listed in the table below were administered via tail vein injection to 6-8 week old female ICR mice (Xipuer-Bikai, Shanghai) at a dose of 0.5 mg / kg. Blood samples were collected from the mice at specific time points after administration (e.g., 6 hours). In addition to the test groups described above, lipid nanoparticles containing dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA, commonly abbreviated as MC3) encapsulating hEPO mRNA were administered at the same dose to mice of similar age and sex as a positive control.
[0528] Mice were euthanized with an overdose of CO2 after the final sampling point. Serum and whole blood were separated by centrifugation at 5000g for 10 minutes at 4°C, flash-frozen, and stored at -80°C for analysis. ELSA analysis was performed using a commercially available kit (DEP00, R&D system) according to the manufacturer's instructions.
[0529] The table below lists the characteristics of the tested lipid nanoparticles, including expression levels exceeding MC3 as measured from the test group.
[0530] Table 2.
[0531]
[0532]
[0533] A: ≥2
[0534] B: ≥1 and <2
[0535] C: ≥0.1 and <1
[0536] D: <0.1.
Claims
1. A compound represented by Formula (I): or a pharmaceutically acceptable salt or enantiomer or diastereomer thereof, wherein: G is N; * indicates a point of attachment. (I), 2. The compound or pharmaceutically acceptable salt or enantiomer or diastereomer thereof of claim 1, wherein G is N; * indicates a point of attachment.
3. The compound or pharmaceutically acceptable salt or enantiomer or diastereomer thereof of claim 1, wherein G is N; * indicates a point of attachment. L 1 , L 2 , and L 3 are each independently selected from a bond or Ci-C8alkylene; R 1 selected from -C(O)OR 4 ; R 2 selected from -C(O)OR 5 C3-C8cycloalkyl or Ci-C8alkyl; R 3 selected from ; R 4 is C 10 -C 20 alkyl; R 5 is C 10 -C 20 alkyl; R 6 selected from -C(O)(CH2) 1-8 N(C1-C8alkyl)C1-C8alkyl, C1-C8alkyl or -(CH2) 1-8 C(O)OR 11 ; R 11 is C 10 -C 20 alkyl; and 5. The compound or pharmaceutically acceptable salt or enantiomer or diastereomer thereof of claim 1, wherein the compound is selected from the group consisting of:
6. A composition comprising a compound according to any one of claims 1 to 5 and a therapeutic or prophylactic agent.
7. The composition of claim 6, further comprising one or more structural lipids. L 1 , L 2 and L 3 each independently is C1-C8alkylene; R 1 -C(O)OR 4 ; R 2 -C(O)OR 5 ; R 3 For ; R 4 is C 10 -C 20 alkyl; R 5 is C 10 -C 20 alkyl; R 6 selected from -C(O)(CH2) 1-8 N(C1-C8alkyl)C1-C8alkyl or C1-C8alkyl; and 8. The composition of claim 7, wherein the one or more structural lipids is DSPC.
9. The composition of claim 8, wherein the molar ratio of the compound to the structural lipid is in the range of 2: 1 to 8:
1.
10. The composition of claim 6, further comprising a sterol. L 1 and L 3 each independently is C1-C8alkylene; L 2 is a bond; R 1 -C(O)OR 4 ; R 2 selected from C3-C8cycloalkyl or Ci-C8alkyl; R 3 For ; R 4 is C 10 -C 20 alkyl; R 6 is -(CH2) 1-8 C(O)OR 11 ; R 11 is C 10 -C 20 alkyl; and 11. The composition of claim 10, wherein the sterol is cholesterol.
4. The compound according to any one of claims 1 to 3, or a pharmaceutically acceptable salt or enantiomer or diastereomer thereof, wherein R 4 , R 5 and R 11 are each independently selected from the group consisting of: -(CH2) 1-3 -CH(C5-C 10 alkyl)(C5-C 10 alkyl).
12. The composition of claim 10, wherein the molar ratio of the compound to the sterol is in the range of 5: 1 to 1:
1. or 。 13. The composition of claim 6, further comprising one or more polymer-conjugated lipids.
14. The composition of claim 13, wherein the polymer-conjugated lipid is DMG-PEG2000 or DMPE-PEG2000.
15. The composition of claim 13, wherein the molar ratio of the compound to the polymer-conjugated lipid is in the range of 100: 1 to 20:
1.
16. The composition of claim 6, wherein the therapeutic or prophylactic agent comprises at least one mRNA or fragment or epitope thereof encoding an antigen.
17. The composition of claim 16, wherein the mRNA is a monocistronic mRNA or a polycistronic mRNA.
18. The composition of claim 16, wherein the antigen is a pathogenic antigen.
19. The composition of claim 16, wherein the antigen is a tumor-associated antigen.
20. The composition of claim 16, wherein the mRNA comprises one or more functional nucleotide analogs selected from one or more of pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.
21. A lipid nanoparticle comprising a compound according to any one of claims 1 to 5 or a composition according to claim 6.
22. A pharmaceutical composition comprising a compound according to any one of claims 1 to 5, a composition according to claim 6, or a lipid nanoparticle according to claim 21, and a pharmaceutically acceptable excipient.
23. The pharmaceutical composition of claim 22, wherein the excipient is a diluent.
Citation Information
Patent Citations
Compositions and methods related to mRNA translational enhancer elements
EP2610340A1
Compositions and methods related to mRNA translational enhancer elements
EP2610341A1
Translation enhancer-element dependent vector systems
US20070048776A1
Methods of Identifying Synthetic Transcriptional and Translational Regulatory Elements, and Compositions Related to Same
US20090093049A1
Compositions and methods related to mRNA translational enhancer elements
US20090226470A1