APP strain with high yield of apx i toxin, construction method and application thereof
By constructing Actinobacillus pleuropneumoniae with a mutant oxyR gene (4074-oxyR) and introducing it into the apxIA gene expression vector, the problems of high production cost and unsatisfactory immunization effect of existing vaccines were solved, and the yield of ApxI toxin was significantly increased and the vaccine was prepared efficiently.
Patent Information
- Application Number
- CN202310037980.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-01-20
- Filing Date
- 2023-01-10
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2043-01-10
AI Technical Summary
Existing Actinobacillus pleuropneumoniae vaccines suffer from high production costs, low antigen secretion, and unsatisfactory immunization effects. In particular, inactivated vaccines and genetically engineered subunit vaccines have defects in preparation and application, failing to effectively stimulate the production of high-titer antibodies and lacking cross-protection between different serotypes.
A mutant Actinobacillus pleuropneumoniae strain (4074-oxyR) was constructed. By introducing the apxIA gene expression vector, the yield of ApxI toxin was increased, making it a high-yielding strain for the preparation of Actinobacillus pleuropneumoniae subunit vaccines.
It achieved a threefold increase in ApxI toxin production, providing more efficient vaccine preparation resources and improving immunization efficacy and cross-protection capabilities.
Smart Images

Figure BDA0004048547190000041 
Figure BDA0004048547190000061 
Figure BDA0004048547190000062
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbiology, specifically to APP strains that produce high levels of ApxI toxin, their construction methods, and applications. Background Technology
[0002] Actinobacillus pleuropneumoniae (APP) is the main pathogen causing infectious pleuropneumonia in pigs. It is a Gram-negative, short bacillus with a capsule and pili, is non-motile, and cannot form spores. APP enters the pig's body through the respiratory tract and then directly enters the alveoli via the trachea and bronchi, causing hemorrhagic and necrotic pneumonia and fibrinous pleuritis. Based on the differences in soluble antigens on the APP surface (mainly capsular polysaccharides and lipopolysaccharides), APP is classified into 15 serotypes, and the virulence of different serotypes varies significantly.
[0003] Given the widespread prevalence and significant economic losses caused by porcine contagious pleuropneumonia (APP) worldwide, proactive prevention and control measures are essential. While antibiotics play a crucial role in controlling the disease, APP readily develops resistance to many antibiotics; therefore, vaccination remains an effective means of prevention and control. Developing safe and effective APP vaccines has become a focus of research. In recent years, vaccines developed for APP have primarily included inactivated vaccines, live attenuated vaccines, and genetically engineered subunit vaccines. Whole-cell inactivated APP vaccines are the most widely used and mature type of vaccine for preventing APP; however, their efficacy is not ideal, failing to stimulate the production of high-titer antibodies. Even immunized pigs can exhibit clinical symptoms and lung damage upon infection. Furthermore, inactivated vaccines against different APP serotypes do not provide effective cross-protection. Commercially available Actinobacillus pleuropneumoniae subunit vaccines primarily utilize Actinobacillus pleuropneumoniae toxin extracted from culture supernatants as their main component, and their use can produce significant immune effects against multiple serotypes. Conventional subunit vaccine preparation requires extracting antigens from the culture supernatant of Actinobacillus pleuropneumoniae, but the amount of antigen secreted and expressed is low, resulting in high production costs and thus affecting its price and applicability. Furthermore, antigens purified through prokaryotic expression using genetic engineering methods, due to their large molecular weight, cannot be expressed solublely, and the prepared antigens are not in their natural conformation, thus affecting immunization efficacy. Summary of the Invention
[0004] To meet the needs of the above-mentioned fields, the present invention provides a strain of Actinobacillus pleuropneumoniae, with accession number CGMCC No. 25495 and name 4074-oxyR.
[0005] The Actinobacillus pleuropneumoniae (4074-oxyR) strain was obtained by using the wild-type APP serotype 1 reference strain (4074) as the starting strain, through mutation of the oxyR gene and introduction of the apxIA gene expression vector, resulting in a high ApxI toxin production. Its ApxI toxin production was 2.367±0.25 mg / L, which is more than 3 times that of the wild-type strain.
[0006] The present invention also provides a bacterial agent comprising the above-mentioned Actinobacillus pleuropneumoniae (4074-oxyR).
[0007] The microbial agent can be a solid microbial agent or a liquid microbial agent.
[0008] The application of Actinobacillus pleuropneumoniae (4074-oxyR) in the preparation of ApxI toxin is also within the scope of protection of this invention.
[0009] The application of Actinobacillus pleuropneumoniae (4074-oxyR) in the preparation of Actinobacillus pleuropneumoniae subunit vaccines is also within the scope of protection of this invention.
[0010] This invention also provides a method for constructing Actinobacillus pleuropneumoniae with high ApxI toxin production, characterized by comprising the following steps:
[0011] a) Inactivate the oxyR gene in Actinobacillus pleuropneumoniae to obtain a mutant strain of the oxyR gene;
[0012] b) Construct an expression vector for the apxIA gene of Actinobacillus pleuropneumoniae and introduce the expression vector into the oxyR gene mutant strain to obtain a genetically engineered strain that produces high levels of ApxI toxin.
[0013] In some embodiments of the method, step a) includes:
[0014] a1) The target fragment 1, whose nucleotide sequence is shown in SEQ ID NO: 2, was introduced into the conjugation transfer plasmid pEMOC2 to obtain the first recombinant plasmid;
[0015] a2) The target fragment 2, whose nucleotide sequence is shown in SEQ ID NO: 4, is introduced into the first recombinant plasmid to obtain the second recombinant plasmid;
[0016] a3) The second recombinant plasmid was introduced into Escherichia coli β2155 to obtain the donor bacteria;
[0017] a4) The second recombinant plasmid is introduced from the donor bacteria into the Actinobacillus pleuropneumoniae via conjugation transfer.
[0018] In some embodiments of the method, the nucleotide sequence of the second recombinant plasmid is shown in SEQ ID NO: 5.
[0019] In some embodiments of the method, the nucleotide sequence of the apxIA gene is shown in SEQ ID NO: 10.
[0020] In some embodiments of the method, the Actinobacillus pleuropneumoniae is Actinobacillus pleuropneumoniae serotype 1 strain.
[0021] This invention provides a new approach and method for constructing high-yield ApxI toxin strains, and offers new strain resources for the production of Actinobacillus pleuropneumoniae subunit vaccines.
[0022] The patent accession information for Actinobacillus pleuropneumoniae, which produces high levels of ApxI toxin, provided by this invention is as follows:
[0023] Biomaterial (strain): 4074-oxyR
[0024] Classification and naming: Actinobacillus pleuropneumoniae
[0025] Date of preservation: August 5, 2022
[0026] Accession number: CGMCC No. 25495
[0027] Preservation Institution: China General Microbiological Culture Collection Center (CGMCC)
[0028] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Attached Figure Description
[0029] Figure 1 The results are the PCR validation results for strain 4074-oxyR. M represents the DNA molecular weight standard, from top to bottom: 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp; 4074-oxyR represents the PCR product of strain 4074-oxyR, with a band size of 944bp; APP1 represents the PCR product of the wild-type APP serotype 1 reference strain (4074), with a band size of 196bp; the PCR primers used were oxyR-YF-944 / oxyR-YR-196. The results show that the wild-type strain does not contain the oxyR sequence insertion inactivation region, while the 4074-oxyR strain does contain the oxyR sequence insertion inactivation region.
[0030] Figure 2The results of Western blotting identification of OxyR protein expression in strain 4074-oxyR are presented. M represents the protein molecular weight standard; the bands shown in the figure, from top to bottom, are 180 kDa, 130 kDa, 100 kDa, 70 kDa, 55 kDa, 40 kDa, 35 kDa, 25 kDa, and 15 kDa. APP1 represents the whole-cell protein of the wild-type APP serotype 1 reference strain (4074); 4074-oxyR represents the whole-cell protein of strain 4074-oxyR. The results show that the wild-type strain expresses OxyR protein, while strain 4074-oxyR does not express OxyR protein.
[0031] Figure 3 The results of Western blotting identification of Apx toxin expression in strain 4074-oxyR were presented. Figure A shows the expression of ApxI toxin protein, and Figure B shows the expression of ApxII toxin protein. M represents the molecular weight standard of the protein, and the bands shown in the figures are 130 kDa, 100 kDa, and 70 kDa from top to bottom. APP1 represents the wild-type APP serotype 1 reference strain (4074). 4074-oxyR represents strain 4074-oxyR. The results showed that compared with the wild-type strain, strain 4074-oxyR had a significantly increased ApxI toxin secretion, while ApxII toxin secretion remained unchanged. Detailed Implementation
[0032] The present invention will be described in detail below with reference to the embodiments. It should be understood that the following embodiments are only for explanation and illustration of the present invention and do not limit the scope of the present invention in any way.
[0033] The strains used in the following examples:
[0034] The wild-type APP serotype 1 reference strain (4074) (hereinafter referred to as the wild-type strain) was kindly provided by Dr. Pat Blackall of Australia. It is a known strain, published in Nielsen.R. New diagnostic techniques: A review of the HAP group of bacteria. Can.J.Vet.Res., 1990, 54: 68-71. and Blackall PJ, Klaasen HL, Bosch H, et al. Proposal of a new serovar of Actinobacillus pleuropneumoniae: serovar 15. Vet Microbiol, 2002, 84: 47-52. This strain is available to the public from the Beijing Academy of Agricultural and Forestry Sciences.
[0035] Escherichia coli β2155: DAP auxotrophic strain, kindly donated by Professor Chen Huanchun of Huazhong Agricultural University. This strain is commercially available.
[0036] Escherichia coli DH5a: cloned strain, purchased from Takara Bio Engineering (Dalian) Co., Ltd.
[0037] Escherichia coli BL21(DE3): expression strain, purchased from Takara Bio Engineering (Dalian) Co., Ltd.
[0038] The plasmids used in the following examples are:
[0039] pEMOC2 plasmid: A conjugation transfer plasmid, kindly donated by Professor Huanchun Chen of Huazhong Agricultural University. This plasmid is commercially available.
[0040] pBBR1-MS2 plasmid: A broad-host plasmid, purchased from Miaoling Biotechnology.
[0041] Primers used in the following examples:
[0042]
[0043] The culture medium and additives used in the following examples:
[0044] Tryptic soy agar (TSA) and tryptic soy broth (TSB) were purchased from BD Difco and prepared according to the instructions for use in culturing Actinobacillus pleuropneumoniae (APP).
[0045] Newborn calf serum, purchased from Lanzhou Minhai Biotechnology Co., Ltd., was added to TSA or TSB at a weight / volume percentage of 5% for culturing APP competent cells.
[0046] TSA+NAD: 0.005% nicotinamide adenine dinucleotide (NAD), purchased from Roche, was added to TSA by weight-volume percentage for APP culture.
[0047] TSB+NAD: 0.005% nicotinamide adenine dinucleotide (NAD), purchased from Roche, was added to TSB by weight-volume percentage for APP culture.
[0048] LB medium: Each 1000ml contains 10g tryptone, 5g yeast extract, and 10g NaCl. Prepared according to standard methods for the culture of *Escherichia coli*.
[0049] Chloramphenicol (Cm): Purchased from Sigma. Concentrations used were 34 μg / mL (for recombinant plasmid screening) and 5 μg / mL (for APP mutant strain screening).
[0050] Diaminopimelic acid (DAP): Purchased from Sigma.
[0051] The molecular biology reagents used in the following examples:
[0052] The bacterial whole genome extraction kit was purchased from Promega.
[0053] PCR reaction reagents, such as 2×Taq mix, were purchased from TaKaRa.
[0054] All restriction endonucleases were purchased from Thermo Fisher Scientific.
[0055] Plasmid extraction kit, agarose gel DNA recovery kit, T4 DNA ligase and pre-stained protein marker were all purchased from NEB.
[0056] The Immobilon-P PVDF (polyvinylidene fluoride) membrane used in the Western blot was purchased from Millipore.
[0057] Phenol, chloroform, isoamyl alcohol, and other commonly used chemical reagents were all purchased from Beijing Chemical Reagent Company.
[0058] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, commercially available or prepared according to conventional methods in the art, and are of laboratory purity. Unless otherwise specified, the experimental methods and conditions used in the following examples are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0059] Example 1. Construction of an APP strain producing high levels of ApxI toxin
[0060] Using APP serotype 1 reference strain (4074) as the starting strain, a mutant strain with inactivated oxyR gene was prepared. The nucleotide sequence of the oxyR gene of APP serotype 1 reference strain (4074) is shown in SEQ ID NO: 1.
[0061] 1. Construction of p-EA-OxyR plasmid
[0062] The pEMOC2 plasmid (conjugation transfer plasmid) was used as the backbone plasmid. Target fragment 1 was designed based on the sequence information of the pACD4K plasmid, and the nucleotide sequence of target fragment 1 is shown in SEQ ID NO: 2. Target fragment 1 was synthesized by Beijing Bomeide Biotechnology Co., Ltd., and recombined into the pEMOC2 plasmid using seamless cloning technology to construct an intron vector, named pEA plasmid.
[0063] Intron insertion sites were designed based on the nucleotide sequence (SEQ ID NO: 1) of the oxyR gene from the APP serotype 1 reference strain (4074), and sites 138|139 were ultimately selected as the target sites. The nucleotide sequence of site 138|139s is as follows:
[0064] Position 138|139s: 5'-CGCAAACTAGAGGGACGAATTAGGTACGGTA gtgc...tcacTTACTTGAACGTACC-3' (SEQ ID NO: 3)
[0065] The target gDNA sequence (target fragment 2) was designed based on the intron insertion site sequence as follows:
[0066]
[0067] The target fragment 2 was synthesized by Beijing Bomeide Biotechnology Co., Ltd. and inserted between the HindIII and BsrGI restriction sites of the pEA plasmid to obtain the recombinant plasmid, named p-EA-OxyR, for inactivation of the oxyR gene. The nucleotide sequence of plasmid p-EA-OxyR is shown in SEQ ID NO: 5.
[0068] 2. Transformation of Escherichia coli β2155
[0069] Escherichia coli β2155 competent cells were prepared using the conventional CaCl2 method, and then the recombinant plasmid p-EA-OxyR was transformed into the E. coli β2155 competent cells via heat shock transformation. Transformants were screened for chloramphenicol (Cm) resistance. Single clones were picked, and positive clones were identified by colony PCR using primers pEA-F and pEA-R. E. coli β2155 carrying the recombinant plasmid p-EA-OxyR was obtained.
[0070] The amplification products of primers pEA-F and pEA-R are Cm gene fragments, with a product size of 634 bp. The nucleotide sequences of the primers are as follows:
[0071]
[0072] PCR system: 12.5 μL pure water, 15 μL 2×Taq mix, 1 μL PEA-F primer (10 μM), 1 μL PEA-R primer (10 μM), 1 μL bacterial genomic DNA.
[0073] PCR program: First, denature at 95℃ for 5 min, then perform 30 cycles (denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 2 min), and finally extend at 72℃ for 10 min.
[0074] 3. Obtaining gene mutant strains
[0075] Following the method described in Dehio C, Meyer M. Maintenance of broad-host-range incompatibility group P and group Q plasmids and transposition of Tn5in Bartonella henselaefollowing conjugal plasmid transfer from Escherichia coli. Journal of Bacteriology. 1997, 179(2): 538-540, the recombinant plasmid p-EA-OxyR was transferred from the donor bacterium (Escherichia coli β2155 carrying the recombinant plasmid p-EA-OxyR) to the recipient bacterium [wild-type APP serotype 1 reference strain (4074)] via conjugation transfer.
[0076] The steps for bonding transfer are as follows:
[0077] After the donor and recipient bacteria were cultured separately until they reached full colony size on plates, the bacteria were washed off with trypsin-soybean broth (TSB) twice, and the OD600 of both the donor and recipient bacterial solutions was adjusted to 1.0. The donor and recipient bacterial solutions were mixed at a 1:1 volume ratio and added dropwise to a preheated (37°C) TSA+NAD+DAP plate with an NC membrane (50 mg / ml DAP). The plate was incubated at 37°C for 8 hours. A control group was also included, containing only the recipient bacterial solution. After incubation, the bacteria on the plates were washed off with TSB twice, diluted appropriately, and then evenly spread onto TSA+NAD+Cm plates (17 μg / ml chloramphenicol). The plates were incubated at 37°C for 24-48 hours. Single colonies were cultured in TSB medium until the OD600 reached 0.2, then IPTG was added at a final concentration of 1 mM for 1 hour for induction. The bacterial suspension was appropriately diluted and evenly spread onto TSA+NAD+Cm plates with a chloramphenicol (Cm) concentration of 17 μg / ml. The plates were incubated at 37°C until single colonies grew. PCR verification of the single colonies was performed using primers oxyR-YF-944 and oxyR-YR-196 (for amplifying the oxyR sequence insertion inactivation region). The amplified fragment size of positive clones was 944 bp, and that of negative clones was 196 bp. An APP serotype 1 reference strain (4074) carrying the recombinant plasmid p-EA-OxyR was obtained and designated as the oxyR gene mutant strain.
[0078] The primer sequences are as follows:
[0079] oxyR-YF-944(5'-3'): CAGCCGACACTAAGCGGTCA (SEQ ID NO: 8)
[0080] oxyR-YR-196(5'-3'): GCAGCGGTCCGGACATTTCT (SEQ ID NO: 9)
[0081] PCR system: 12.5 μL pure water, 15 μL 2×Taq mix, 1 μL oxyR-YF-944 primer (10 μM), 1 μL oxyR-YR-196 primer (10 μM), 1 μL bacterial genomic DNA.
[0082] PCR program: First, denature at 95℃ for 5 min, then perform 30 cycles (denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 1 min), and finally extend at 72℃ for 10 min.
[0083] 4. Constructing genetically engineered strains that produce high levels of ApxI toxin
[0084] Genomic DNA was extracted from wild-type APP serotype 1 reference strain (4074) using a bacterial whole-genome extraction kit (Promega). Using this genomic DNA as a template, PCR was performed with primers apxIA-F and apxIA-R to obtain the apxIA gene fragment with XhoI and BamHI restriction sites at both ends, respectively. The nucleotide sequence of the apxIA gene is shown in SEQ ID NO: 10. The apxIA gene fragment was inserted between the XhoI and BamHI restriction sites of the pBBR1-MS2 plasmid (broad host plasmid) through restriction enzyme digestion and ligation reactions to obtain the recombinant plasmid pBBR1-ApxI. The recombinant plasmid pBBR1-ApxI was electroporated into the oxyR gene mutant strain obtained in step 3 above. After kanamycin resistance selection and colony PCR verification, the ApxI genetically engineered strain was obtained.
[0085]
[0086] PCR system: 12.5 μL pure water, 15 μL 2×Taq mix, 1 μL apxIA-F primer (10 μM), 1 μL apxIA-R primer (10 μM), 1 μL bacterial genomic DNA.
[0087] PCR program: First, denature at 95℃ for 5 min, then perform 30 cycles (denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 3 min), and finally extend at 72℃ for 10 min.
[0088] 5. Screening of genetically engineered strains
[0089] Wild-type APP serotype 1 reference strain (4074) and the ApxI genetically engineered strain obtained in step 4 above were inoculated into TSB medium and cultured at 37°C for 6 hours. The cultures were then collected by centrifugation, and the supernatant was determined. The ApxI toxin content in the supernatant was measured, and the ApxI toxin yield of each strain was calculated. The detection method is as follows:
[0090] The culture supernatant collected by centrifugation was concentrated using a 50kD ultrafiltration centrifuge tube. After concentrating 1L of supernatant to 20ml, the buffer of the total protein sample was replaced with a pH 7-8, 10-30mmol / L Tris-HCl buffer using an ion desalting column (Cytiva). Then, elution was performed using a Sephacryl S-200HR gel chromatography column (Zeye Biotechnology) with a pH 7-8, 10-30mmol / L Tris-HCl buffer at a flow rate of 0.5-1mL / min. The first eluted protein peak was collected based on the UV280 ultraviolet absorption curve, which yielded the purified ApxI toxin solution. The concentration (mg / mL) of ApxI toxin in the purified ApxI toxin solution was detected using the BCA protein quantification kit (Pierce). The total amount of ApxI toxin (mg) was then obtained by multiplying the concentration (mg / mL) of ApxI toxin by the volume (mL) of the ApxI toxin solution. Finally, the ApxI toxin yield of the strain was calculated using Formula 1.
[0091] Formula 1: ApxI toxin yield of strain (mg / L) = Total amount of ApxI toxin (mg) / Volume of strain culture used to detect ApxI toxin content (L).
[0092] The results are shown in Table 1. The ApxI toxin yield of the wild-type APP serotype 1 reference strain (4074) was 0.76±0.12 mg / L. The ApxI toxin yields of the five ApxI genetically engineered strains were 2.367±0.25 mg / L, 2.086±0.18 mg / L, 2.137±0.22 mg / L, 1.975±0.13 mg / L, and 1.886±0.17 mg / L, respectively. Among them, the ApxI toxin yield of ApxI genetically engineered strain No. 1 was more than three times that of the wild-type strain.
[0093] Table 1
[0094]
[0095] The aforementioned ApxI genetically engineered strain No. 1 was deposited with the China General Microbiological Culture Collection Center (CGMCC) under the name 4074-oxyR, accession number CGMCC No. 25495, and accession date August 5, 2022. This ApxI genetically engineered strain No. 1 is referred to herein as strain 4074-oxyR.
[0096] 6. Western blotting was used to identify the expression of OxyR protein in strain 4074-oxyR.
[0097] Single colonies of strain 4074-oxyR and wild-type strain [wild-type APP serotype 1 reference strain (4074)] were picked and inoculated into 5 mL TSB+NAD medium, respectively, and cultured at 37℃ with shaking for 12-16 h. The culture was then removed and inoculated into 100 mL TSB+NAD medium at a volume ratio of 1:50. The culture was continued at 37℃ with shaking until the OD600 reached 0.8. The culture was then removed and centrifuged at 12000g for 15 min. The bacterial pellet was collected, diluted appropriately, and then sonicated. The sonicated supernatant was collected and detected by SDS-PAGE electrophoresis.
[0098] Western blotting analysis:
[0099] After SDS-PAGE electrophoresis, remove the gel, cut off the excess, and transfer the protein using the standard transfer method. The transfer of pre-stained protein markers is used to preliminarily assess the protein transfer efficiency. Immerse the transferred PVDF membrane in 100% methanol for approximately 10 seconds, then place it on filter paper to air dry for approximately 15 minutes. Immerse the completely dried PVDF membrane in 100% methanol for about 10 seconds, remove it and place it in deionized water for 2 minutes, then transfer it to blocking buffer (PBST solution containing 5% skim milk) and block at 37°C for 1 hour or at 4°C overnight. Add OxyR polyantiserum to the blocking buffer at a volume ratio of 1:200 and react at 37°C for 1 hour. Wash the membrane three times with blocking buffer for 10 minutes each time. Then add horseradish peroxidase-labeled goat anti-rabbit IgG (Sigma-Aldrich, A9169) diluted 1:10000 and react at 37°C for 1 hour. Wash the membrane three times with blocking buffer for 10 minutes each time. Finally, place the membrane in horseradish peroxidase substrate (Sigma-Aldrich) solution for color development. Once the bands are clear, quickly stop the color development reaction with distilled water.
[0100] The preparation process of OxyR polyclonal antibody serum is as follows: Genomic DNA was extracted from wild-type APP serotype 1 reference strain (4074) using a bacterial whole genome extraction kit (Promega). Using the genomic DNA as a template, the oxyR gene fragment with NdeI and XhoI restriction sites at both ends was amplified using primers pET28-oxyR-F and pET28-oxyR-R. The nucleotide sequence of the oxyR gene is shown in SEQ ID NO: 1. The oxyR gene fragment was inserted between the NdeI and XhoI restriction sites of the pET28a vector through restriction enzyme digestion and ligation reactions to obtain the ligation product. The ligation product was transformed into *E. coli* DH5α and positive clones were identified to obtain the prokaryotic expression plasmid pET28a-oxyR with the correct inserted sequence. The pET28a-oxyR plasmid was transformed into *E. coli* BL21(DE3) and the protein was expressed and purified to obtain OxyR protein. Rabbits were immunized with the purified OxyR protein to obtain OxyR polyclonal antibody serum.
[0101]
[0102] Western blotting results are as follows Figure 2 As shown, APP1 represents the whole-cell protein of the wild-type APP serotype 1 reference strain (4074); 4074-oxyR represents the whole-cell protein of the 4074-oxyR strain. The molecular weight of the natural OxyR protein is approximately 33 kDa. The results show that the wild-type strain expresses the OxyR protein, while the 4074-oxyR strain does not express the OxyR protein. Therefore, the oxyR gene in the 4074-oxyR strain is inactivated.
[0103] 7. Western blotting was used to identify the expression of ApX toxin in strain 4074-oxyR.
[0104] Single colonies of strain 4074-oxyR and wild-type strain [wild-type APP serotype 1 reference strain (4074)] were picked and inoculated into 5 mL TSB+NAD medium, respectively, and cultured at 37℃ with shaking for 12-16 h. The culture was then removed and inoculated into 100 mL TSB+NAD medium at a volume ratio of 1:50, and cultured at 37℃ with shaking for another 6 h. The culture was then removed and centrifuged at 12000 g for 5 min. The supernatant was collected and 20 mL of the supernatant was concentrated to 500 μL using a 50 kD ultrafiltration centrifuge tube for SDS-PAGE electrophoresis detection.
[0105] Western blotting analysis:
[0106] After SDS-PAGE electrophoresis, remove the gel, cut off the excess, and transfer the protein using the standard transfer method. The transfer of pre-stained protein markers is used to preliminarily assess the protein transfer efficiency. Immerse the transferred PVDF membrane in 100% methanol for approximately 10 seconds, then place it on filter paper to air dry for approximately 15 minutes. Immerse the completely dried PVDF membrane in 100% methanol for about 10 seconds, remove it and place it in deionized water for 2 minutes, then transfer it to blocking buffer (PBST solution containing 5% skim milk) and block at 37°C for 1 hour or at 4°C overnight. Add ApxIAN polyantiserum or ApxIIAN polyantiserum to the blocking buffer at a volume ratio of 1:500 and react at 37°C for 1 hour. Wash the membrane three times with blocking buffer for 10 minutes each time. Then add horseradish peroxidase-labeled goat anti-rabbit IgG (Sigma-Aldrich, A9169) diluted 1:5000 and react at 37°C for 1 hour. Wash the membrane three times with blocking buffer for 10 minutes each time. Finally, place the membrane in horseradish peroxidase substrate (Sigma-Aldrich) solution for color development. Once the bands are clear, quickly stop the color development reaction with distilled water.
[0107] The preparation process of ApxIAN polyclonal antibody serum and ApxIIAN polyclonal antibody serum is as follows: Genomic DNA was extracted from wild-type APP serotype 1 reference strain (4074) using a bacterial whole genome extraction kit (Promega). Using the genomic DNA as a template, the apxIAN gene fragment with NdeI and XhoI restriction sites at both ends was amplified using primers pET28-apxIAN-F and pET28-apxIAN-R. The nucleotide sequence of the apxIAN gene is shown in SEQ ID NO: 19. Using the genomic DNA as a template, the apxIIAN gene fragment with NdeI and XhoI restriction sites at both ends was amplified using primers pET28-apxIIAN-F and pET28-apxIIAN-R. The nucleotide sequence of the apxIIAN gene is shown in SEQ ID NO: 20. The amplified apxIAN and apxIIAN gene fragments were inserted between the NdeI and XhoI restriction sites of the pET28a vector through enzyme digestion and ligation reactions to obtain the ligation products. The ligation products were transformed into *E. coli* DH5α, and positive clones were identified to obtain prokaryotic expression plasmids pET28a-apxIAN and pET28a-apxIIAN with correct inserted sequences. pET28a-apxIAN and pET28a-apxIIAN were then transformed into *E. coli* BL21IDE3, and the proteins were expressed and purified to obtain ApxIAN and ApxIIAN proteins, respectively. Rabbits were immunized with the purified ApxIAN and ApxIIAN proteins to obtain ApxIAN polyclonal antibody serum and ApxIIAN polyclonal antibody serum, respectively.
[0108]
[0109] Western blotting results are as follows Figure 3 As shown in the figure, Figure A shows the expression of ApxI toxin protein, and Figure B shows the expression of ApxII toxin protein; APP1 represents the wild-type APP serotype 1 reference strain (4074); 4074-oxyR represents the 4074-oxyR strain. The molecular weight of ApxI toxin is approximately 110 kDa, and the molecular weight of ApxII toxin is approximately 103 kDa. The results indicate that compared with the wild-type strain, the 4074-oxyR strain has a significantly increased secretion of ApxI toxin, while the secretion of ApxII toxin remains unchanged.
Claims
1. A strain of Actinobacillus pleuropneumoniae 4074-oxyR, with accession number CGMCC No. 25495.
2. A microbial agent, characterized in that, It contains Actinobacillus pleuropneumoniae as described in claim 1.
3. The microbial agent as described in claim 2, characterized in that, The bacterial agent can be a solid bacterial agent or a liquid bacterial agent.
4. The use of Actinobacillus pleuropneumoniae according to claim 1 in the preparation of ApxI toxin.
5. The use of Actinobacillus pleuropneumoniae according to claim 1 in the preparation of Actinobacillus pleuropneumoniae subunit vaccines.
6. A method for constructing Actinobacillus pleuropneumoniae with high ApxI toxin production, characterized in that, Includes the following steps: a) Inactivate the oxyR gene in Actinobacillus pleuropneumoniae 4074 to obtain a mutant strain of the oxyR gene. b) Construct an expression vector for the apxIA gene of Actinobacillus pleuropneumoniae 4074 and introduce the expression vector into the mutant strain of the oxyR gene to obtain Actinobacillus pleuropneumoniae with high production of ApxI toxin. Step a) includes: a1) The target fragment 1, whose nucleotide sequence is shown in SEQ ID NO: 2, was introduced into the conjugation transfer plasmid pEMOC2 to obtain the first recombinant plasmid; a2) The target fragment 2, whose nucleotide sequence is shown in SEQ ID NO: 4, is introduced into the first recombinant plasmid to obtain the second recombinant plasmid; a3) The second recombinant plasmid was introduced into Escherichia coli β2155 to obtain the donor bacteria; a4) The second recombinant plasmid is introduced from the donor bacteria into Actinobacillus pleuropneumoniae via conjugation transfer.
7. The method according to claim 6, characterized in that, The nucleotide sequence of the second recombinant plasmid is shown in SEQ ID NO:
5.
8. The method according to claim 6, characterized in that, The nucleotide sequence of the apxIA gene is shown in SEQ ID NO: 10.