Cathepsin L inhibitors

By inhibiting CatL with compounds, the treatment challenges of CatL-related diseases have been solved, enabling effective prevention and treatment of various diseases, including the long-term effects and acute sequelae of COVID-19, demonstrating significant antiviral effects.

CN116589425BActive Publication Date: 2026-03-24BIOFRONT THERAPEUTICS (BEIJING) CO LTD +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202310440959.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2023-03-31
Filing Date
2023-04-21
Publication Date
2026-03-24
Estimated Expiration
2043-04-21

AI Technical Summary

Technical Problem

Current technologies have not effectively addressed the treatment or prevention of cathepsin L (CatL)-related diseases, including severe acute respiratory syndrome (SARS), coronavirus disease 19 (COVID-19), long-term effects of coronaviruses (long COVID), acute sequelae of COVID-19 (PASC), Ebola virus infection, Middle East respiratory syndrome (MERS), herpes simplex virus infection, respiratory syncytial virus (RSV) infection, acute respiratory distress syndrome (ARDS), ARDS-induced multiple organ failure, acute kidney injury (AKI), liver injury, liver fibrosis, cancer, osteoporosis, inflammation, atherosclerosis, kidney disease, and diabetes.

Method used

A compound, represented by chemical formula (Ia) and its derivatives, is provided for preparing a CatL inhibitor for locally or in vivo reducing the activity and content of CatL. The preparation method is described in detail through exemplary embodiments.

Benefits of technology

The compound effectively inhibits CatL and is used to treat or prevent the aforementioned diseases, exhibiting significant antiviral activity. It is suitable for multiple routes of administration, including oral, injection, inhalation, and topical administration, providing various delivery methods to enhance therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116589425B_ABST
    Figure CN116589425B_ABST
Patent Text Reader

Abstract

Disclosed herein are compounds. The compounds are capable of inhibiting Cathepsin L (CatL). Also disclosed herein are compositions comprising at least one of the compounds. Also provided herein are methods of treating or preventing one or more CatL-related diseases. The methods can comprise administering the compositions to a subject.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-references

[0002] This application claims priority to Chinese Application 202211702259.1, filed December 29, 2022; U.S. Application 63 / 478,502, filed January 5, 2023; and U.S. Application 18 / 194,609, filed March 31, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This application generally relates to protease inhibitors, and in particular, to cathepsin L (CatL) inhibitors and their pharmaceutical use in the treatment or prevention of CatL-related diseases. Background Technology

[0004] Catproteases are proteases that use serine, cysteine, or aspartic acid residues as nucleophiles and are crucial for processes such as digestion, coagulation, immune responses, and peptide synthesis. Catproteases are generally divided into three families: serine proteases (catproteases A and G), aspartic proteases (catproteases D and E), and eleven cysteine ​​proteases (catproteases B, C, F, H, K, L, O, S, V, X, and W). As a member of the cysteine ​​protease family of catproteases, CatL participates in various physiological processes, including apoptosis, antigen processing, and extracellular matrix modeling. It is also associated with pathological states such as tumor invasion and metastasis, chronic inflammation, diabetes, cardiovascular disease, kidney disease, bone disease, neurodegenerative diseases, and viral infections. Therefore, there is a need to develop novel CatL inhibitors for the treatment or prevention of CatL-related diseases. Summary of the Invention

[0005] According to one aspect of this application, a compound is provided. The compound may be represented by chemical formula (Ia):

[0006]

[0007] In this configuration, R1 and R2 are independently selected from H, -CH2- groups, and alkyl groups; R1 and R2 are not connected or are connected by a single bond; W is CO or SO2; R3 is an alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, or heterocyclic group, and R3 may optionally be substituted by one or more groups selected from halogens, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; X1 is a CH group or N; X2 is O, S, or N-R4, wherein R4 is selected from H, alkyl, aryl, and heterocyclic groups; X3 is H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic group, and X3 may optionally be substituted by halogens, hydroxyl, cycloalkyl, aryl, heteroaryl, or heterocyclic groups, and X3 may optionally be substituted by one or more groups selected from halogens, hydroxyl, cycloalkyl, alkyl, heteroalkyl, or heterocyclic groups. The following groups are selected from alkyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy groups: Z1 is a CH group, C-R5, or N; Z2 is a CH group, C-R6, or N; Z3 is a CH group, C-R7, or N; and Z4 is a CH group, C-R8, or N, wherein R5-R8 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, -CN, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and each of R5-R8 is optionally substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, heterocyclic, cycloalkyl, aryl, and alkoxy groups.

[0008] According to another aspect of this application, compounds selected from Table 1 are provided. Table 1 is shown in the "Detailed Description" section.

[0009] According to one aspect of this application, a method for treating a subject's disease is provided, comprising: administering a composition to the subject suffering from the disease, the composition comprising a pharmaceutically effective amount of a compound represented by formula (Ia), an isomer thereof, an enantiomer thereof, a diastereomer thereof, a racemic mixture thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.

[0010]

[0011] In this configuration, R1 and R2 are independently selected from H, -CH2- groups, and alkyl groups; R1 and R2 are not connected or are connected by a single bond; W is CO or SO2; R3 is an alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, or heterocyclic group, and R3 may optionally be substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; X1 is a CH group or N; X2 is O, S, or N-R4, wherein R4 is selected from H, alkyl, aryl, and heterocyclic groups; X3 is H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic group, and X3 may optionally be substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy groups. Z1 is a CH group, C-R5, or N; Z2 is a CH group, C-R6, or N; Z3 is a CH group, C-R7, or N; and Z4 is a CH group, C-R8, or N, wherein R5-R8 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, -CN, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and each of R5-R8 is optionally substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, heterocyclic, cycloalkyl, aryl, and alkoxy groups, wherein the disease includes Severe Acute Respiratory Syndrome (SARS), Coronavirus Disease 19 (COVID-19), and the long-term effects of coronaviruses. The following are considered as a possible contraindication: COVID-19, acute sequelae of COVID-19 (PASC), Ebola virus infection, Middle East respiratory syndrome (MERS), herpes simplex virus infection, respiratory syncytial virus (RSV) infection, acute respiratory distress syndrome (ARDS), ARDS-induced multiple organ failure, acute kidney injury (AKI), liver injury, liver fibrosis, cancer, osteoporosis, inflammation, atherosclerosis, kidney disease, bone disease, or diabetes.

[0012] Additional features will be set forth in part in the description which follows, and in part will become apparent to those skilled in the art upon examination of the following and the accompanying drawings, or may be learned by the generation or operation of embodiments. The features of this application may be realized and obtained by practice or use of various aspects of the methods, means, and combinations set forth in the detailed examples discussed below. Attached Figure Description

[0013] This application will be further described through exemplary embodiments. These exemplary embodiments will be described in detail with reference to the accompanying drawings. The drawings are not drawn to scale. These embodiments are non-limiting exemplary embodiments, in which the same numbers in the figures denote similar structures, wherein:

[0014] Figure 1 This is a schematic diagram of exemplary conventional steps A in the preparation of compound A-7 according to some embodiments of this application;

[0015] Figure 2 This is a schematic diagram of exemplary step B-1 of preparing compound A-8 based on compound A-7 according to some embodiments of this application;

[0016] Figure 3 This is a schematic diagram of exemplary step B-2 in the preparation of compound A-8 based on compound A-7 according to some embodiments of this application;

[0017] Figure 4 This is a schematic diagram of exemplary step B-3 in the preparation of compound A-8 based on compound A-7 according to some embodiments of this application;

[0018] Figure 5 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-1 according to some embodiments of this application;

[0019] Figure 6 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-2 according to some embodiments of this application;

[0020] Figure 7 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-3 according to some embodiments of this application;

[0021] Figure 8 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-4 according to some embodiments of this application;

[0022] Figure 9 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-5 according to some embodiments of this application;

[0023] Figure 10 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-6 according to some embodiments of this application;

[0024] Figure 11 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-7 according to some embodiments of this application;

[0025] Figure 12 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-8 according to some embodiments of this application;

[0026] Figure 13 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-9 according to some embodiments of this application;

[0027] Figure 14 This is a schematic diagram illustrating exemplary steps for preparing compound 1 according to some embodiments of this application;

[0028] Figure 15This is a schematic diagram illustrating exemplary steps for preparing compound 2 according to some embodiments of this application;

[0029] Figure 16 This is a schematic diagram illustrating exemplary steps for preparing compound 3 according to some embodiments of this application;

[0030] Figure 17 This is a schematic diagram illustrating exemplary steps for preparing compound 4 according to some embodiments of this application;

[0031] Figure 18 This is a schematic diagram illustrating exemplary steps for preparing compound 5 according to some embodiments of this application;

[0032] Figure 19 This is a schematic diagram illustrating exemplary steps for preparing compound 6 according to some embodiments of this application;

[0033] Figure 20 This is a schematic diagram illustrating exemplary steps for preparing compound 7 according to some embodiments of this application;

[0034] Figure 21 This is a schematic diagram illustrating exemplary steps for preparing compound 8 according to some embodiments of this application;

[0035] Figure 22 This is a schematic diagram illustrating exemplary steps for preparing compound 9 according to some embodiments of this application;

[0036] Figure 23 This is a schematic diagram illustrating exemplary steps for preparing compound 10 according to some embodiments of this application;

[0037] Figure 24 This is a schematic diagram illustrating exemplary steps for preparing compound 11 according to some embodiments of this application;

[0038] Figure 25 This is a schematic diagram illustrating exemplary steps for preparing compound 12 according to some embodiments of this application;

[0039] Figure 26 This is a schematic diagram illustrating exemplary steps for preparing compound 13 according to some embodiments of this application;

[0040] Figure 27 This is a schematic diagram illustrating exemplary steps for preparing compound 14 according to some embodiments of this application;

[0041] Figure 28 This is a schematic diagram illustrating exemplary steps for preparing compound 15 according to some embodiments of this application;

[0042] Figure 29This is a schematic diagram illustrating exemplary steps for preparing compound 16 according to some embodiments of this application;

[0043] Figure 30 This is a schematic diagram illustrating exemplary steps for preparing compound 17 according to some embodiments of this application;

[0044] Figure 31 This is a schematic diagram illustrating exemplary steps for preparing compound 18 according to some embodiments of this application;

[0045] Figure 32 This is a schematic diagram illustrating exemplary steps for preparing compound 19 according to some embodiments of this application;

[0046] Figure 33 This is a schematic diagram illustrating exemplary steps for preparing compound 20 according to some embodiments of this application;

[0047] Figure 34 This is a schematic diagram illustrating exemplary steps for preparing compound 21 according to some embodiments of this application;

[0048] Figure 35 This is a schematic diagram illustrating exemplary steps for preparing compound 22 according to some embodiments of this application;

[0049] Figure 36 This is a schematic diagram illustrating exemplary steps for preparing compound 23 according to some embodiments of this application;

[0050] Figure 37 This is a schematic diagram illustrating exemplary steps for preparing compound 24 according to some embodiments of this application;

[0051] Figure 38 This is a schematic diagram illustrating exemplary steps for preparing compound 25 according to some embodiments of this application;

[0052] Figure 39 This is a schematic diagram illustrating exemplary steps for preparing compound 26 according to some embodiments of this application;

[0053] Figure 40 This is a schematic diagram illustrating exemplary steps for preparing compound 27 according to some embodiments of this application;

[0054] Figure 41 This is a schematic diagram illustrating exemplary steps for preparing compound 28 according to some embodiments of this application;

[0055] Figure 42 This is a schematic diagram illustrating exemplary steps for preparing compound 29 according to some embodiments of this application;

[0056] Figure 43This is a schematic diagram illustrating exemplary steps for preparing compound 30 according to some embodiments of this application;

[0057] Figure 44 This is a schematic diagram illustrating exemplary steps for preparing compound 31 according to some embodiments of this application;

[0058] Figure 45 This is a schematic diagram illustrating exemplary steps for preparing compound 32 according to some embodiments of this application;

[0059] Figure 46 This is a schematic diagram illustrating exemplary steps for preparing compound 33 according to some embodiments of this application;

[0060] Figure 47 This is a schematic diagram illustrating exemplary steps for preparing compound 34 according to some embodiments of this application;

[0061] Figure 48 This is a schematic diagram illustrating exemplary steps for preparing compound 35 according to some embodiments of this application;

[0062] Figure 49 This is a schematic diagram illustrating exemplary steps for preparing compound 36 according to some embodiments of this application;

[0063] Figure 50 This is a schematic diagram illustrating exemplary steps for preparing compound 37 according to some embodiments of this application;

[0064] Figure 51 This is a schematic diagram illustrating exemplary steps for preparing compound 38 according to some embodiments of this application;

[0065] Figure 52 This is a schematic diagram illustrating exemplary steps for preparing compound 39 according to some embodiments of this application;

[0066] Figure 53 This is a schematic diagram illustrating exemplary steps for preparing compound 40 according to some embodiments of this application;

[0067] Figure 54 This is a schematic diagram of exemplary steps for preparing compound 41 according to some embodiments of this application;

[0068] Figure 55 This is a schematic diagram illustrating exemplary steps for preparing compound 42 according to some embodiments of this application;

[0069] Figure 56 This is a schematic diagram illustrating exemplary steps for preparing compound 43 according to some embodiments of this application;

[0070] Figure 57This is a schematic diagram illustrating exemplary steps for preparing compound 44 according to some embodiments of this application;

[0071] Figure 58 This is a schematic diagram illustrating exemplary steps for preparing compound 45 according to some embodiments of this application;

[0072] Figure 59 This is a schematic diagram of exemplary steps for preparing compound 46 according to some embodiments of this application.

[0073] Figure 60 This is a schematic diagram illustrating exemplary steps for preparing compound 47 according to some embodiments of this application.

[0074] Figure 61 This is a schematic diagram of exemplary steps for preparing compound 48 according to some embodiments of this application. Detailed Implementation

[0075] The following description is provided to enable any person skilled in the art to make and use this application and is provided in the context of a particular application and its requirements. Various modifications to the disclosed embodiments will be apparent to those skilled in the art, and the general principles defined herein can be applied to other embodiments and applications without departing from the spirit and scope of this application. Therefore, this application is not limited to the embodiments shown, but is accorded the broadest scope consistent with the claims.

[0076] The terminology used herein is for describing particular exemplary embodiments only and is not intended to be limiting. As used herein, the singular forms “a,” “an,” and “the” can also include the plural forms unless the context clearly indicates otherwise. It should also be understood that the terms “comprising,” “including,” and “including” as used in this specification indicate only the presence of the stated features, integers, steps, operations, components, and / or parts, but do not exclude the presence or addition of one or more other features, integers, steps, operations, components, parts, and / or combinations thereof.

[0077] These and other features, characteristics, functions and operating methods of related structural elements, as well as component assembly and manufacturing economics, will become more apparent from the following description of the accompanying drawings, which form part of this application specification. However, it should be understood that the drawings are for illustrative purposes only and are not intended to limit the scope of this application. It should also be understood that the drawings are not drawn to scale.

[0078] According to one aspect of this application, a variety of compounds are provided. These compounds are capable of inhibiting CatL and can be used to treat or prevent CatL-related diseases in subjects. As used herein, the term "inhibit CatL" means reducing the activity and / or content of CatL locally (e.g., in vitro and / or in vivo). For convenience, these compounds provided in this application are referred to herein as "compounds". In some embodiments, a compound may be represented by formula (Ia):

[0079]

[0080] In some embodiments, W in formula (Ia) can be CO or SO2. When W is CO, the compound can be represented by formula (Ib):

[0081]

[0082] When W is SO2, the compound can be represented by formula (Ic):

[0083]

[0084] In some embodiments, R1 and R2 may be independently selected from H, -CH2- groups, and alkyl groups. In some embodiments, R1 and R2 may be unconnected or connected by a single bond.

[0085] In some embodiments, R3 may be an alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, or heterocyclic group, and R3 may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups.

[0086] In some embodiments, X1 may be a CH group or N. In some embodiments, X2 may be O, S, or N-R4, and R4 may be selected from H, alkyl, aryl, and heterocyclic groups.

[0087] In some embodiments, X3 may be H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic, and X3 may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy.

[0088] In some embodiments, Z1 may be a CH group, C-R5, or N. In some embodiments, Z2 may be a CH group, C-R6, or N. In some embodiments, Z3 may be a CH group, C-R7, or N.

[0089] In some embodiments, Z4 may be a CH group, C-R8, or N. In some embodiments, R5-R8 may be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, -CN, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and each of R5-R8 may optionally be substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, heterocyclic group, cycloalkyl, and aryl and alkoxy groups.

[0090] In some embodiments, the compound may be represented by formula (II):

[0091]

[0092] In some embodiments, the compound may be represented by formula (III):

[0093]

[0094] In some embodiments, the compound may be represented by formula (IV):

[0095]

[0096] In some embodiments, R0 may be H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic, and R0 may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy.

[0097] In some embodiments, the compound may be represented by formula (V):

[0098]

[0099] In some embodiments, at least one of R5-R8 is H. For example, all of R5-R8 are H.

[0100] In some embodiments, at least one of R5-R8 is a halogen or -CN, and the rest are H.

[0101] In some embodiments, at least one of R5-R8 is a pyrazole group, and optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups. For example, one of R5-R8 is a group represented by formula (VI-a):

[0102]

[0103] In some embodiments, R9 can be H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic. 10 and R 11It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups. Formula (VI-a) can be attached to the benzoxazole group shown in Formula (II), (III), (IV), or (V) at the methyl group. In this case, the compound can be represented by Formula (II-a), Formula (II-b), Formula (II-c), or Formula (II-d):

[0104]

[0105]

[0106] In some embodiments, R9-R 10 It can be H, and the compound can be represented by formula (II-a1):

[0107]

[0108] In some embodiments, at least one of R5-R8 is a cycloalkyl or heterocyclic group, optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and the other groups in R5-R8 are hydrogen. For example, one of R5-R8 may be a group represented by formula (VI-b):

[0109]

[0110] In some embodiments, X4 can be S, O, SO2, N, C, or C-L1. L1 can be selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and L1 can optionally be substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. In some embodiments, X5 can be N or C. In some embodiments, R 12 It is absent, or may be selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and may optionally be substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. In some embodiments, R 13 -R 16 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and R 13 -R 16 Each of these groups may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic and alkoxy groups.

[0111] Formula (VI-b) can be linked to the benzoxazole group shown in Formula (II), (III), (IV), or (V) at X5. In some embodiments, X4 and X5 in Formula (VI-b) can both be N, and the compound can be represented by Formula (II-e), (II-f), (II-g), or (II-h):

[0112]

[0113]

[0114] In some embodiments, in formula (VI-b), X4 and X5 are both nitrogen, and R 12 It is methyl, and R 13 -R 16 If H is present, then the compound can be represented by formula (II-g1):

[0115]

[0116] As another example, one of R5-R8 can be a group represented by equation (VI-c):

[0117]

[0118] In some embodiments, X6 can be S, O, SO2, N, C, or C-L2. L2 can be selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups. L2 can optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. In some embodiments, R 17 It is absent, or may be selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and may optionally be substituted by one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy. In some embodiments, R 18 -R 21 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and R 18 -R 21 Each of these groups may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic and alkoxy groups.

[0119] Formula (VI-c) may be attached to the benzoxazole group represented by formula (II), (III), (IV), or (V) at the methyl group. In some embodiments, X6 in formula (VI-c) may be N, and the compound may be represented by formula (II-i), (II-j), (II-k), or (II-l):

[0120]

[0121]

[0122] In some embodiments, in equation (VI-c), X6 is N, R 18 -R 21 Let H be the number of 'R', and R be the number of 'R'. 17 If the form is methyl, -CH2-CHF2, or -C2H4-OCH3, then the compound can be represented by formula (II-k1), formula (II-k2), and formula (II-k2):

[0123]

[0124] As yet another example, one of R5-R8 can be a group represented by formula (VI-d):

[0125]

[0126] In some embodiments, R 22 It can be H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic, and R 22 It may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy. In some embodiments, R 23 -R 25 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl and heterocyclic groups.

[0127] In this case, the compound can be represented by formula (II-m), formula (II-n), formula (II-o), or formula (II-p):

[0128]

[0129]

[0130] In some embodiments, in equation (VI-d), R 22 It is methyl, and R 23 -R 25 If H is present, the compound can be represented by formula (II-o1):

[0131]

[0132] In some embodiments, at least one of R5-R8 is a heteroaryl group, optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and the remainder of R5-R8 is H. For example, one of R5-R8 may be a group represented by formula (VI-e):

[0133]

[0134] In some embodiments, R 26 -R 29 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, and NR. 38 , where R 38 It can be selected from H, alkyl, aryl, heterocyclic and ketone groups.

[0135] Formula (VI-e) can be attached to the benzoxazole group shown in Formula (II), (III), (IV), or (V) at the methyl group. In this case, the compound can be represented by Formula (II-q), Formula (II-r), Formula (II-s), or Formula (II-t):

[0136]

[0137]

[0138] In some embodiments, in formula (VI-e), R 27 -R 29 Let H be the number of 'R', and R be the number of 'R'. 26 The group can be methyl, -CHF2, or cyclopropyl; therefore, the compound can be represented by formulas (II-r1), (II-r2), and (II-r3):

[0139]

[0140] For example, one of R5-R8 can be a group represented by formula (VI-f):

[0141]

[0142] In some embodiments, R 30 -R 33 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, NR 38 , where R 38 It can be selected from H, alkyl, aryl, heterocyclic and ketone groups.

[0143] Formula (VI-f) can be attached to the benzoxazole group shown in Formula (II), (III), (IV), or (V) at the methyl group. In this case, the compound can be represented by Formula (II-u), Formula (II-v), Formula (II-w), or Formula (II-x):

[0144]

[0145]

[0146] In some embodiments, in equation (VI-f), R 31 -R 33 Let H be the number of 'R', and R be the number of 'R'. 30 Methyl, -NH2, -NC 2H6 Therefore, the compound can be represented by formulas (II-v1), (II-v2), (II-v3), (II-v4), and (II-v5): -NHCOCH3 or -NHCH3.

[0147]

[0148]

[0149] For example, one of R5-R8 can be a group represented by formula (VI-g):

[0150]

[0151] In some embodiments, R 34 -R 37 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, and NR. 38 , where R 38 It can be selected from H, alkyl, aryl, heterocyclic and ketone groups.

[0152] Formula (VI-g) can be attached to the benzoxazole group shown in Formula (II), (III), (IV), or (V) at the methyl group. In this case, the compound can be represented by Formula (II-y):

[0153]

[0154] In some embodiments, in formula (VI-g), R 35 -R 37 Let H be the number of 'R', and R be the number of 'R'. 34 Since it is methyl, the compound can be represented by formula (II-y1):

[0155]

[0156] In some embodiments, R3 may be an aryl group, and R3 may optionally be substituted with one or more groups selected from halogens, cycloalkyls, fluoroalkyls, methyl, ethyl, propyl, and butyl groups. For example, R3 may be a phenyl halide group.

[0157] In some embodiments, R3 may be a heterocyclic group, and R3 may optionally be substituted with one or more groups selected from halogen, cycloalkyl, fluoroalkyl, methyl, ethyl, propyl, and butyl. For example, R3 is a group represented by formula (VII-a):

[0158]

[0159] In some embodiments, R 39 -R 42 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, heterocyclic, and NR. 49 , where R 49 Selected from H, alkyl, aryl, heterocyclic, and ketone groups. Formula (VII-a) may be connected to -CO- or -SO2- as shown in formulas (II), (III), (IV), or (V) at the methyl group. In this case, the compound can be represented by formula (II-aa):

[0160]

[0161] In some embodiments, R 40 -R 42 Let H be the number of 'R', and R be the number of 'R'. 39 Since it is methyl, the compound can be represented by formula (II-aa1):

[0162]

[0163] In some embodiments, R3 may be selected from imidazolyl, pyrrololyl, pyrazolyl, triazolyl, piperidinyl, pyridinyl, pyrimidinyl, and pyridazinyl, and R3 may optionally be substituted with one or more groups selected from cycloalkyl, fluoroalkyl, methyl, and tert-butyl. For example, R3 is the group shown in formula (VII-b):

[0164]

[0165] In some embodiments, R 43 It can be H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic. In some embodiments, R 44 and R 45 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and R 44 and R 45Each of these groups may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. Formula (VII-b) may be attached to -CO- or -SO2- at the methyl group as shown in Formula (II), (III), (IV), or (V). In this case, the compound may be represented by Formula (II-bb):

[0166]

[0167] In some embodiments, R 45 It is H, R 43 It is methyl, cyclopropyl or And R 44 Is it tert-butyl, cyclopropyl or

[0168] For example, R3 is the group represented by formula (VII-c):

[0169]

[0170] In some embodiments, R 46 It can be H, alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic. In some embodiments, R 47 and R 48 It can be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and R 47 and R 48 Each of these groups may optionally be substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. Formula (VII-c) may be attached to -CO- or -SO2- at the methyl group as shown in Formula (II), (III), (IV), or (V). In this case, the compound may be represented by Formula (II-cc):

[0171]

[0172] In some embodiments, R 48 It is H, R 46 It is methyl, -CHF2 or -CF3, and R 47 It is cyclopropyl.

[0173] In some embodiments, R1 and R2 can be H. In some embodiments, R1 and R2 can be -CH2- groups linked by a single bond.

[0174] Table 1 shows some exemplary compounds of CatL inhibitors.

[0175] Table 1: Exemplary compounds of CatL inhibitors

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182] It should be noted that the compounds listed in Table 1 above are for illustrative purposes only. Other compounds represented by the formulas presented in this application (e.g., formulas (Ia), (Ib), (Ic), (II), (III), (IV), and (V)) are also within the scope of this application.

[0183] According to another aspect of this application, a composition is provided. The composition may include at least one pharmaceutically effective amount of the aforementioned compound, its isomers, its enantiomers, its diastereomers, its racemic mixture, its solvates, or a pharmaceutically acceptable salt thereof.

[0184] In some embodiments, the composition may further comprise a pharmaceutically acceptable carrier. For example, the carrier may include a coating, capsule, microcapsule, nanocapsule, etc., or any combination thereof. It should be noted that the carrier may need to be non-toxic and may not significantly affect the activity of the key ingredient in the pharmaceutical composition (e.g., the compounds described above). In some embodiments, the carrier may protect the key ingredient from undesirable conditions, such as oxidation, decomposition, or inactivation of the key ingredient. For example, enzymes in the stomach or a relatively low pH may cause the key ingredient to decompose or become inactivated. The carrier can help maintain or increase the efficacy of the pharmaceutical composition by protecting the key ingredient in the pharmaceutical composition. In some embodiments, the carrier may be used for the controlled release of the key ingredient. Controlled release may include, but is not limited to, sustained release, targeted release, etc. For example, the carrier may include hydrogel capsules, microcapsules, or nanocapsules made of collagen, gelatin, chitosan, alginate, polyvinyl alcohol, polyethylene oxide, starch, cross-linked starch, etc., or any combination thereof. In some embodiments, the carrier may facilitate the controlled release of the key ingredient in the pharmaceutical composition (e.g., at least one of the aforementioned compounds).

[0185] In some embodiments, the composition may be administered to a subject orally, by injection, by inhalation, or by topical administration. In some embodiments, injection may include subcutaneous injection, intramuscular injection, intravenous injection, etc. In some embodiments, injection may include injecting the composition into a tumor or a region near a tumor. In some embodiments, injection may include injecting the composition into the kidney, liver, heart, thyroid, or joint. In some embodiments, inhalation may include administering the composition as an aerosol spray, mist, or powder. In some embodiments, topical administration may include applying the composition to the skin to relieve cancers such as skin cancer or lymphoma. In some embodiments, topical administration may include vaginal administration, rectal administration, nasal administration, ear canal administration, intramedullary administration, intra-articular administration, intrapleural administration, etc., or any combination thereof. In some embodiments, the composition may be administered to a subject through a combination of different routes of administration. In some embodiments, the method may include administering the composition to the subject three times daily, twice daily, once daily, once every two days, etc.

[0186] In some embodiments, a method of treating a subject's disease is provided. This method may include administering the aforementioned composition to the subject.

[0187] In some embodiments, the subject is a human being. In some embodiments, the subject is a non-human animal. In some embodiments, the subject is male. In some embodiments, the subject is female. In some embodiments, the subject suffers from a disease or has a pathological condition.

[0188] In some embodiments, the disease may be caused by a viral infection. The compounds provided in this application have shown significant antiviral activity. Therefore, the compounds can be used to treat diseases associated with viral infections.

[0189] For example, diseases may include Severe Acute Respiratory Syndrome (SARS), Severe Acute Respiratory Syndrome Coronavirus 1 (SARS-CoV-1) infection, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection, or Coronavirus Disease 19 (COVID-19). As an example only, the compounds mentioned above could be used to treat the long-term effects of coronaviruses (long COVID) or acute sequelae of COVID-19 (PASC). Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is a coronavirus that caused the 2019 Coronavirus Disease 19 (COVID-19) pandemic over the past three years. It poses a significant threat to public health and socioeconomic systems worldwide. To date, most COVID-19 treatments have focused on targeting the viral spike protein (S protein) and viral proteases (primarily type 3C proteases and papain-type proteases). These treatments are effective in preventing SARS-CoV-2 infection and severe symptoms of COVID-19. However, immune-evading and highly infectious variants of SARS-CoV-2 continue to emerge and spread globally. This necessitates innovative strategies to develop new antiviral drugs to combat COVID-19.

[0190] For example, diseases can include herpes simplex virus (HSV) infection. Herpes simplex virus infection, also known as herpes, is common worldwide. Some medications can reduce the severity and frequency of symptoms, but they may not be curative. Cystatin C is a human cysteine ​​protease inhibitor found in extracellular fluid. The potential antiviral activity of cystatin C and a tripeptide derivative (Z-LVG-CHN2) that mimics its protease-binding center against herpes simplex virus type 1 and poliovirus type 1 was tested (J Virol, February 1990; 64(2): 941-943). Therefore, the compounds provided in this application may be used to treat HSV infection.

[0191] For example, the disease can include respiratory syncytial virus (RSV) infection. Human RSV is a common global cause of lower respiratory tract infections in all age groups. RSV infection is frequently seen in infants, the elderly, and immunocompromised patients. RSV is highly contagious and can be fatal. There is currently no vaccine available to prevent RSV infection. Current antiviral drugs for treating RSV infection have significant limitations. There is an urgent need to find new drugs that can meet clinical needs. RSV infection increases the expression and activity of various host proteases, including MMPs and cathepsins. The induced host protease response can promote RSV infection and may play a major role in disease progression. Selective cathepsin L inhibitors, alone or in combination with other host protease inhibitors, have the potential to enhance RSV clearance and prevent RSV-induced airway hyperresponsiveness and allergic reactions. Studies have shown that the cathepsin inhibitor E64 or ribavirin can inhibit airway hyperresponsiveness in RSV-infected mice and enhance viral clearance. (Mucosal Immunol, January 2015; 8(1): 161-175). Therefore, the compounds provided in this application can be used to treat RSV infection.

[0192] For example, diseases can include Ebola virus infection or Middle East Respiratory Syndrome (MERS).

[0193] In some embodiments, the disease may be acute respiratory distress syndrome (ARDS) or ARDS-induced multi-organ failure (e.g., lung, kidney, liver).

[0194] In some embodiments, the disease can be acute kidney injury (AKI). For example, AKI may be caused by anticancer drugs, microbial infections, parasites, etc.

[0195] In some embodiments, the disease may be liver damage or liver fibrosis.

[0196] In some embodiments, the disease may be cancer.

[0197] In some embodiments, the disease may be osteoporosis.

[0198] In some embodiments, the disease can be inflammation.

[0199] In some embodiments, the disease may be atherosclerosis.

[0200] In some embodiments, the disease may be a kidney disease or a bone disease.

[0201] In some embodiments, the disease may be diabetes.

[0202] In some embodiments, the method may include administering the composition orally to the subject, injecting the composition into the subject, or administering the composition to the subject via topical administration.

[0203] According to another aspect of this application, a method for inhibiting cathepsin L in a subject is provided. The method may include administering the previously described composition to the subject.

[0204] In some embodiments, administering the composition to a subject may include: orally administering the composition to the subject, inhaling the composition to the subject, injecting the composition into the subject, or administering the composition to the subject via topical administration.

[0205] According to another aspect of this application, the use of the aforementioned compound in inhibiting cathepsin L in a subject is provided. The use of the compound may include the steps mentioned in the method for inhibiting cathepsin L.

[0206] According to another aspect of this application, the use of at least one of the aforementioned compounds in the preparation of a composition for treating a subject's disease is provided.

[0207] The present invention will be further illustrated by the following embodiments, but should not be construed as limiting the scope of protection of the present invention.

[0208] Example

[0209] Abbreviations

[0210]

[0211] Ac = Acetyl group

[0212] Ac₂O = Acetic anhydride

[0213] Boc2O = ditert-butyl dicarbonate

[0214] DCM = dichloromethane

[0215] DIPEA = N,N-diisopropylethylamine or N-ethyl-N-isopropyl-2-amine

[0216] DMAP = dimethylaminopyridine

[0217] DMA = dimethylacetamide

[0218] DME = dimethoxyethane

[0219] DMF = dimethylformamide

[0220] DMSO = dimethyl sulfoxide

[0221] EtOAc / EA = Ethyl acetate

[0222] EtOH = ethanol

[0223] FA = Formic acid

[0224] HATU = 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate HOAc = acetic acid

[0225] KOAc = Potassium acetate

[0226] LiHMDS = Lithium bis(trimethylsilyl)amino

[0227] MeMgBr = Methylmagnesium bromide

[0228] MeOH = methanol

[0229] NaOAc = Sodium acetate

[0230] NBS = N-bromosuccinimide

[0231] Pd(dppf)₂Cl₂=[1,1'-bis(diphenylphosphine)ferrocene]palladium(II) chloride

[0232] PE = Petroleum Ether

[0233] PTSA = p-Toluenesulfonic acid monohydrate

[0234] rt = Room (ambient) temperature

[0235] T3P = 2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosphonane-2,4,6-trioxide

[0236] TEA = Triethylamine

[0237] TFA = Trifluoroacetic acid

[0238] THF = Tetrahydrofuran

[0239] TsCl = p-Toluenesulfonyl chloride

[0240] UV = Ultraviolet light

[0241] X-Phos = 2-Dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl

[0242] Example 1 - Inhibition of CatL by the Compound

[0243] In vitro biological data

[0244] Human cathepsin L (CatL) enzyme activity assay

[0245] Human cathepsin L activity assays were performed in assay buffer (50 mM MES, pH 5.5, 2.5 mM DTT, 0.5 mM EDTA) to evaluate the inhibitory effect of the test compound on human CatL protease activity. 60 μL of the compound was added to a 384-well dilution plate. The compound solution was serially diluted 1:3 with DMSO, 10 pts per column. Using an Echo (LABCYTE 655), 0.05 μL of the diluted compound solution was added to each row of a 384-well assay plate (Corning 4514), with two replicate wells per column. 5 μL of working solution of human CatL enzyme (Abcam#ab81780) was added to the 384-well assay plate, and the plate was centrifuged at 1000 rpm for 1 minute. The mixture was incubated at 25°C for 15 minutes, then 5 μL of CatL substrate (GensC-Ript#C7360HB140_5) working solution was added to initiate the reaction (CatL: 0.05 nM, substrate: 500 nM). Incubation was continued at 25°C for 30 minutes. Fluorescence signals at Ex370 nm and Em460 nm were read using a BMG CLARIOStar Plusaucu. The inhibition percentage for each compound was calculated, and the IC50 was obtained through nonlinear regression fitting using XLfit 5.5.0. 50 (Half-inhibitory concentration). The results of the CatL enzyme activity assay are shown in Table 2 below.

[0246] Table 2: IC50 of compounds 1-48 used to inhibit CatL 50

[0247]

[0248]

[0249] This embodiment demonstrates that the compounds provided in this application can be effectively used as CatL inhibitors. According to experimental results, many of the compounds 1-48 exhibit significant inhibitory activity against CatL. Specifically, the IC50 values ​​of compounds 1-4, 6-9, 13, 15, 19-22, 24-29, 31, and 44, used to inhibit CatL, are [not specified in the original text]. 50 Less than 50 nM. Furthermore, the IC50 values ​​of compounds 2, 3, 6, 13, 20-22, 24, 26, 27, 29, 33-35, 38-43, and 45-48 used to inhibit CatL are also significant. 50 Less than 10 nM.

[0250] Example 2 - Pseudovirus Infection Test

[0251] In order to infect a host, SARS-CoV-2 needs to enter a host cell for viral replication. This depends on the proper cleavage and activation of the viral S protein by host cell proteases (primarily furin, TMPRSS2, and cathepsin L (also known as CatL or CTSL)). TMPRSS2 and furin cleave the viral S protein at different sites, activating viral entry into the host cell. CatL then cleaves the S protein into smaller fragments, promoting fusion between the virus and the endosome membrane, thereby allowing the viral genome to be released into the host cell for viral replication. The CatL cleavage site is highly conserved across all known SARS-CoV-2 variants. Therefore, inhibiting CatL alone or synergistically inhibiting other host proteases may prevent the proper processing of the S protein, and consequently, infection with SARS-CoV-2 and its variants.

[0252] Pseudoviruses (PsVs) or mutants that bind to the S protein of SARS-CoV-2 were constructed using reported methods. For VSV-based PsV systems, the backbone was provided by a VSV-G pseudovirus (G*ΔG-VSV), in which the VSV-G in the VSV genome was replaced by firefly luciferase. To quantify PsV, viral RNA was extracted using the QIAamp Viral RNA Mini Kit (catalog number 52906, QIAGEN) and reverse transcribed using the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas K1622) as per manufacturer's instructions. The transcribed RNA was then processed using SYBR Green I Master Mix reagent (Roche). Real-time qPCR was performed on a Roche 96 real-time quantitative PCR system. The P protein gene of VSV virus was quantified, and viral replication was calculated accordingly. The forward primer was: TCTCGTTCCACTCCATCCTCTTGG (SEQ ID NO: 1); the reverse primer was: TGCTCCTTCCACTCCATCCTCTTGG (SEQ ID NO: 2). All PsV amounts were normalized to the same amounts described above. (See Zhao, MM, et al. Discovery of novel cleavage sites in SARS-CoV-2 spike protein, revealing mechanisms and therapeutic strategies for cathepsin L promoting viral infection. Cell Discovery. 8: 53-70 (2022))

[0253] Vero E6 cells were placed in Dulbecco modified Eagle high-glucose cell culture medium (DMEM) (Sigma–Aldrich, St. Louis, MO, USA), supplemented with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA) and 100 units / mL penicillin-streptomycin (Gibco). All cells were maintained at 37°C in a humid atmosphere containing 95% air and 5% CO2.

[0254] To evaluate the antiviral activity of the test compounds, Vero E6 cells were seeded in 96-well cell culture plates and then co-treated with different concentrations of the test compounds and SARS-CoV-2 PsV (100 μL of normalized PsV added to each well). After incubation at 37°C for 24 hours, the activity of firefly luciferase in cell lysates was measured using a luciferase substrate (PerkinElmer, BRITLITEPLUS 100 ml KIT, catalog number 6066761) according to the manufacturer's instructions. Luciferase activity was quantified using a photometer (Promega). The infection rate was calculated relative to a control reaction containing only the solvent. The results of the pseudovirus infection assay are shown in Table 3 below.

[0255] Table 3: Results of compounds 1-48 in pseudovirus infection experiments

[0256]

[0257] This embodiment demonstrates that the compounds provided in this application can effectively protect cells from viral infection and can be used to treat or prevent diseases associated with viral (such as SARS-CoV-2) infection. According to the results in Table 3, many of the compounds 1-48 are able to protect cells from pseudovirus infection in a dose-dependent manner at 500 nM to 5 μM, and some compounds (e.g., compounds 29, 45, and 46) exhibit almost complete protection at 500 nM.

[0258] Example 3 - Preparation of Compounds 1-48

[0259] Standard Step A

[0260] Figure 1 The standard procedure A for preparing compound A-7 is described. For example... Figure 1 As shown, conventional step A may include steps AD.

[0261] Step A: Preparation of benzoxazole cyclization

[0262] Ethyl (tert-butoxycarbonyl)-L-asparaginate (A-1, 1 equivalent) was dissolved in 1,2-dichloroethane (0.2 M), and Et3O was added in portions under nitrogen atmosphere.+ BF4- (1.2 equivalents). The resulting mixture was stirred at RT (room temperature) for 24 hours. A solution of (substituted) aminophenol (A-2, 1 equivalent) dissolved in 2 mL of ethanol (2M) was transferred to the solution using a syringe. The mixture was heated to 90 °C and stirred for 24 hours. The reaction mixture was cooled to room temperature, saturated NaHCO3 (solution) was added, and the aqueous layer was extracted with dichloromethane. The composite organic layer was washed with brine and dried over anhydrous Na2SO4. After filtration and concentration, the crude product was purified by chromatography (EtOAc in PE, 25% to 50%) to give the desired product A-3.

[0263] Step B: Ester hydrolysis

[0264] Ester A-3 (1 equivalent) was added to THF (0.1 M) and 1 N LiOH (aqueous solution, 3 equivalents), and stirred at room temperature for 3 hours. The reaction solution was adjusted to pH 7 with HCl (1 M), and then extracted with DCM / MeOH (v / v, 10:1). The composite organic layer was separated, dried (MgSO4), and concentrated to obtain the desired product A-4.

[0265] Step C-amide coupling (C-terminus)

[0266] Add DIPEA (4 equivalents) to acid A-4 (1 equivalent), 1-aminocyclopropane-1-nitrile hydrochloride A-5 (1.2 equivalents), and T3P (50 wt% EA solution, 1.1 equivalents) in a stirred solution of DCM (0.2 M). Stir the reaction mixture at room temperature under N2 for 3 hours. Concentrate the reaction mixture and purify by chromatography (PE solution of EtOAc, 40% to 100%) to give the desired product A-6.

[0267] Step D: N-Boc deprotection

[0268] The protected amine A-6 was stirred in a 0.4 M HCOOH solution at 25 °C for 5 hours. The mixture was dried under nitrogen at 20 °C, alkalized with saturated NaHCO3 solution, and extracted with EA. The composite organic layer was concentrated to obtain the desired product A-7.

[0269] Standard procedure B-1

[0270] Figure 2 The conventional steps B-1 for preparing compound A-8 based on compound A-7 are shown.

[0271] A 0.5 M solution of amine A-7 (1 equivalent), acyl chloride (1.1 equivalent), and DIPEA (3 equivalent) was stirred at 25 °C for 2 hours. The reaction mixture was concentrated, and the residue was subjected to pre-…

[0272] The desired product A-8 was obtained by preparative high performance liquid chromatography (HPLC) [(Gemini-C18, 150×21.2mm, 5um; ACN-H2O (0.1% FA); 15%-80%)] purification.

[0273] Standard procedure B-2

[0274] Figure 3 The conventional steps B-2 for preparing compound A-8 based on compound A-7 are shown.

[0275] T3P (50 wt% DMF solution, 1.2 equivalences) was added dropwise to a stirred solution of amine A-7, acid (1.2 equivalents), and DIPEA (4 equivalents) in DCM (0.1 M). The reaction was stirred at 25 °C for 3 hours. The reaction mixture was quenched with water and extracted with DCM. The composite organic layer was dried over Na2SO4 and concentrated under vacuum to obtain a crude product, which was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H2O (0.1% FA); 15%–80%)] to obtain the desired product A-8.

[0276] Standard procedure B-3

[0277] Figure 4 The conventional steps B-3 for preparing compound A-8 based on compound A-7 are shown.

[0278] An acid (1 equivalent), DIPEA (5 equivalents), and HATU (3 equivalents) were added to a stirred solution of amine A-7 (70 mg, 0.2 mmol) in DMF (0.2 M). The reaction mixture was stirred at room temperature under N2 for 2 hours. After the reaction was complete, H2O was added to the reaction mixture, and the mixture was extracted with EA. The composite organic layer was washed with brine and dried over anhydrous Na2SO4. After filtration, the solution was concentrated under vacuum, and the residue was purified by preparative HPLC to obtain the desired product A-8.

[0279] Preparation of intermediate I-1: Preparation of 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylic acid

[0280] Figure 5 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-1 according to some embodiments of this application.

[0281] Step 1: Preparation of ethyl 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylate

[0282] A solution of cyclopropylhydrazine hydrochloride (1.5 g, 0.0138 mol) in EtOH (40 mL) was added to a solution of 5N NaOH (3 mL), and the mixture was stirred at 0 °C for 10 min. The mixture was then added to an ethanolic solution of ethyl 5,5-dimethyl-2,4-dioxane (4.14 g, 0.02 mol). The resulting mixture was stirred at 60 °C for 16 h. The mixture was concentrated, and the residue was purified by rapid column chromatography (PE / EA = 50:1) to give a colorless oily product (1.79 g, 50.3%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 237.1 [M+H] + .

[0283] Step 2: Preparation of 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylic acid

[0284] A solution of ethyl 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylate (1.79 g, 7.6 mmol) in THF (18 mL) was mixed with 6 mL of H₂O, 6 mL of MeOH, and 3.19 g of LiOH (76 mmol) and stirred at room temperature for 5 hours. The solvent was removed by depressurization. The residue was dissolved in 20 mL of H₂O and the pH was adjusted to 7 using 1 N hydrochloric acid. The mixture was then extracted with DCM (100 mL × 2). The composite organic layer was washed with brine (50 mL) and dried over anhydrous Na₂SO₄. After filtration, the solution was concentrated under vacuum to give a light pink solid product (1.45 g, 86%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 209.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ13.16 (s, 1H), 6.67 (s, 1H), 4.27 (d, J=3.8Hz, 1H), 1.21 (s, 9H), 1.11-1.04 (m, 2H), 0.95 (dd, J=7.2, 2.4Hz, 2H).

[0285] Preparation of intermediate I-2: 1-Cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylic acid

[0286] Figure 6 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-2 according to some embodiments of this application.

[0287] Step 1: Preparation of ethyl 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylate

[0288] Cyclopropylhydrazine hydrochloride (0.54 g, 4.9 mmol) was added to a 20 mL solution of (Z)-2-(ethoxymethylene)-4,4,4-trifluoro-3-oxobutyrate in toluene at 0 °C. The mixture was stirred at 50 °C under N2 for 16 hours. After stirring, the mixture was concentrated under vacuum. The residue was purified by preparative TLC (PE:EA = 4:1) to give a product as a white solid (500 mg, 22%). Mass spectrometry analysis of the obtained compound showed the following results: Mass (m / z): 249.2 [M+H]. + .

[0289] Step 2: Preparation of 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylic acid

[0290] A solution of ethyl 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylate (620 mg, 2.48 mmol) in 1N LiOH (5 mL) and THF (5 mL) was stirred at room temperature for 16 hours. The mixture was acidified to pH 3-4 with 5N aqueous hydrogen chloride solution and extracted with EA (20 mL × 3). The composite organic layer was washed with brine (20 mL × 2) and dried over Na₂SO₄. The mixture was then filtered, and the filtrate was concentrated to give a white solid product (447 mg, 70%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 221.0 [M+H] + .

[0291] Preparation of intermediate I-3: 1-Cyclopropyl-3-(difluoromethyl)-1H-pyrazole-4-carboxylic acid

[0292] Figure 7 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-3 according to some embodiments of this application.

[0293] Step 1: Preparation of ethyl(Z)-2-(ethoxymethylene)-4,4-difluoro-3-oxobutyrate

[0294] A solution of ethyl 4,4-difluoro-3-oxobutyrate (5 g, 30 mmol) and (diethoxymethoxy)ethane (10 mL, 58 mmol) in acetic anhydride (30 mL) was stirred at 140 °C under N2 for 6 hours. Afterward, the mixture was concentrated under vacuum to give a pale yellow oily product (5 g, 74%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 222.0 [M+H] + .

[0295] Step 2: Preparation of ethyl 1-cyclopropyl-3-(difluoromethyl)-1H-pyrazole-4-carboxylate

[0296] Cyclopropylhydrazine hydrochloride (0.46 g, 4.2 mmol) was added to a solution of ethyl (Z)-2-(ethoxymethylene)-4,4-difluoro-3-oxobutyrate in toluene (10 mL). The mixture was stirred at 50 °C under N2 for 16 hours. After completion, the mixture was concentrated under vacuum. The residue was purified by preparative TLC (PE:EA = 5:1) to give a product as a pale yellow solid (210 mg, 11%). Mass spectrometry analysis of the obtained compound showed the following results: Mass (m / z): 231.0 [M+H] + .

[0297] Step 3: Preparation of 1-cyclopropyl-3-(difluoromethyl)-1H-pyrazole-4-carboxylic acid

[0298] A solution of ethyl 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylate (210 mg, 0.9 mmol) in 1N LiOH (2 mL) and THF (2 mL) was stirred at room temperature for 16 hours. The mixture was acidified to pH 3-4 with 5N aqueous hydrogen chloride solution and extracted with EA (20 mL × 3). The composite organic layer was washed with brine (20 mL × 2) and dried over Na₂SO₄. The mixture was then filtered, and the filtrate was concentrated to give a white solid product (150 mg, 77%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 203.1 [M+H] + .

[0299] Preparation of intermediate I-4: 3-(tert-butyl)-1-(oxetane-3-yl)-1H-pyrazole-5-carboxylic acid

[0300] Figure 8 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-4 according to some embodiments of this application.

[0301] Step 1: Preparation of ethyl 3-(tert-butyl)-1-(oxetane-3-yl)-pyrazole-5-carboxylate

[0302] Ethyl 3-(tert-butyl)-1H-pyrazole-5-carboxylate (1.6 g, 8 mmol) and K2CO 3(2.24 g (16 mmol) of 3-iodooxetine (1.3 mL, 12 mmol) was added to 8 mL of DMF solution. The reaction mixture was stirred at 75 °C for 24 hours. The reaction mixture was quenched with ice water and extracted with EtOAc (30 mL × 3). The composite organic layer was washed with water (30 mL × 3) and brine (30 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under negative pressure. The residue was purified by rapid chromatography (PE / EtOAc = 4:1) to give the product (1.9 g, 94%) as a white solid. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 253.2 [M + H]. + .

[0303] Step 2: Preparation of 3-(tert-butyl)-1-(oxetane-3-yl)-pyrazole-5-carboxylic acid

[0304] LiOH·H2O (420 mg, 1 mmol) was added to a THF / H2O (5:1, 10 mL) solution of ethyl 3-(tert-butyl)-1-(oxecyclobutan-3-yl)-pyrazole-5-carboxylate (500 mg, 2 mmol). The reaction mixture was stirred at room temperature for 3 hours. The pH of the reaction solution was adjusted to 5-6 using 1N hydrogen chloride solution. The mixture was then extracted with EtOAc (30 mL × 2). The composite organic layer was washed with brine (30 mL) and dried over anhydrous Na2SO4. The mixture was filtered, and the filtrate was concentrated under vacuum to give the desired product (400 mg, 89%) as a white solid. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 225.1 [M+H] + .

[0305] Preparation of intermediate I-5: 1,3-Dicyclopropyl-1H-pyrazole-5-carbonyl chloride

[0306] Figure 9 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-5 according to some embodiments of this application.

[0307] Step 1: Preparation of methyl 1,3-dicyclopropyl-1H-pyrazole-5-carboxylate

[0308] 3 mL of 5N NaOH was added to a solution of cyclopropylhydrazine dihydrochloride (2813 mg, 19.4 mmol) in EtOH (50 mL). After stirring at 0 °C for 10 min, a solution of methyl 4-cyclopropyl-2,4-dioxobutyrate (2200 mg, 12.9 mmol) in EtOH (50 mL) was added, and the resulting mixture was stirred at 60 °C for 14 h. The solvent was removed under negative pressure, and the residue was purified by combined flash chromatography (PE / EA = 0–50%) to produce a colorless oily product (800 mg, 27%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 206.9 [M+H] + .

[0309] Step 2: Preparation of 1,3-dicyclopropyl-1H-pyrazole-5-carboxylic acid

[0310] LiOH·H2O (346 mg, 8.2 mmol) was added to a THF / H2O (5:1, 6 mL) solution of methyl 1,3-dicyclopropyl-1H-pyrazole-5-carboxylate (170 mg, 0.82 mmol). The reaction mixture was stirred at room temperature for 4 hours. The pH of the reaction solution was adjusted to 5–6 using 1N hydrogen chloride solution. The mixture was then extracted with EA (20 mL × 2). The composite organic layer was washed with brine (30 mL) and dried over anhydrous Na2SO4. The mixture was filtered, and the filtrate was concentrated under vacuum to give a white solid product (140 mg, 79.5%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 193.1 [M+H] + .

[0311] Step 3: Preparation of 1,3-dicyclopropyl-1H-pyrazole-5-carbonyl chloride

[0312] To a solution of 1,3-dicyclopropyl-1H-pyrazole-5-carboxylic acid (140 mg, 0.73 mmol) in DCM (10 mL), oxalyl chloride (140 mg, 1.1 mmol) and DMF (0.05 mL) were added. The reaction mixture was stirred at 0 °C for 1 hour. The solvent was removed under negative pressure to obtain the crude product. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 207.1 [M-Cl+MeOH] + .

[0313] Preparation of intermediate I-6: 1-Cyclopropyl-3-methyl-1H-pyrazole-4-carbonyl chloride

[0314] Figure 10 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-6 according to some embodiments of this application.

[0315] Step 1: Preparation of ethyl 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylate

[0316] A solution of ethyl (Z)-2-(ethoxymethylene)-3-oxobutyrate (5 g, 0.02 mol) and cyclopropylhydrazine (1.94 g, 0.02 mol) in EA (50 mL) was stirred under reflux for 3 hours. The mixture was concentrated under negative pressure and the residue was purified by a rapid column (PE / EA = 5:1) to produce an orange oily product (0.53 g, 9.6%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 195.1 [M+H] + .

[0317] Step 2: Preparation of 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylic acid

[0318] Ethyl 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylate (0.53 g, 0.7 mmol) was mixed with an aqueous solution of 1N lithium hydroxide (10 mL) and THF (10 mL). The reaction mixture was stirred at 25 °C for 24 hours. After completion, the mixture was concentrated under vacuum. The residue was dissolved in water (10 mL), the pH was adjusted to 7 with an aqueous solution of 1N hydrogen chloride, and extracted with ethyl acetate (10 mL × 2). The composite organic layer was washed with brine (10 mL), dried over Na₂SO₄, filtered, and concentrated under vacuum to give a product as a yellow solid (380 mg, 85.7%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 167.2 [M+H] + .

[0319] Step 3: Preparation of 1-cyclopropyl-3-methyl-1H-pyrazole-4-carbonyl chloride

[0320] To a solution of 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylic acid (150 mg, 0.9 mmol) in DCM (2 mL), oxalyl dichloride (103 mg, 0.8 mmol) and one drop of DMF were added. The reaction mixture was stirred at 25 °C for 16 hours. The mixture was concentrated under vacuum to produce a yellow oily product (150 mg, 81%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 181.0 [M-Cl+MeOH] + .

[0321] Preparation of intermediate I-7: 2-Cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid

[0322] Figure 11 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-7 according to some embodiments of this application.

[0323] Step 1: Preparation of ethyl 4-(1-methylcyclopropyl)-2,4-dioxobutyrate

[0324] LiHMDS (30.6 mL, 30.6 mmol) was added to a THF (30.0 mL) solution of 1-(1-methylcyclopropyl)ketene (3.00 g, 30.6 mmol) and diethyl oxalate (4.47 g, 30.6 mmol). The reaction mixture was stirred at -70 °C for 16 h. The reaction mixture was quenched with NH4Cl solution (100 mL) at 0 °C, followed by extraction with EA (100 mL × 3). The composite organic layer was washed with brine (100 mL × 3), dried over Na2SO4, and concentrated under negative pressure. The residue was purified by rapid column chromatography (PE:EA = 0–50%) to give the desired product, ethyl 4-(1-methylcyclopropyl)-2,4-dioxobutyrate (2.80 g, 42%), as a brown oil. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 199.1 [M+H] + .

[0325] Step 2: Preparation of ethyl 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylate

[0326] The pH of a solution of ethyl 4-(1-methylcyclopropyl)-2,4-dioxobutyrate (2.80 g, 14.1 mmol) in EtOH (20.0 mL) was adjusted to 10 at 0 °C using an aqueous sodium hydroxide solution (5 N). The reaction solution was stirred at 60 °C for 16 hours. The reaction mixture was concentrated under negative pressure. The residue was purified by a rapid column chromatography (PE:EA = 0-5%) to give a colorless oily product, ethyl 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylate (2.20 g, 60%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 235.1 [M+H] + .

[0327] Step 3: Preparation of 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid

[0328] LiOH (80 mg, 28.2 mmol) was added to a THF / H₂O (3:1, 24.0 mL) solution of ethyl 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid (2.20 g, 9.40 mmol). The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was concentrated under negative pressure. The residue was diluted with water (50 mL) and the pH was adjusted to 4 with an aqueous solution of HCl (2 M). The mixture was extracted with EA (100 mL × 3), washed with brine (100 mL), dried over Na₂SO₄, and concentrated under negative pressure to give a white solid product, 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid (1.20 g, 55%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 207.1 [M+H] + .

[0329] Preparation of intermediate I-8: (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionic acid

[0330] Figure 12 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-8 according to some embodiments of this application.

[0331] Step 1: Preparation of ethyl (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionate

[0332] Triethyloxonium tetrafluoroborate (15.1 g, 79.78 mmol) was added to a DCE (300 mL) solution of (tert-butoxycarbonyl)-L-asparaginate ethyl ester (20.7 g, 79.78 mmol). The reaction mixture was stirred at 25 °C under N2 for 16 h. 2-Amino-5-bromophenol (15 g, 79.78 mmol) was added to the resulting mixture. The reaction mixture was stirred at 85 °C under N2 for 16 h. The mixture was diluted with water (500 mL) and extracted with DCM (300 mL × 2). The organic phase was evaporated, and the residue was purified by silica gel column chromatography (PE:EA = 5:1) to give a black oily product (19 g, 46%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 413.0-415.0 [M+H] + .

[0333] Step 2: Preparation of (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionic acid

[0334] LiOH·H2O (914 mg, 21.78 mmol) was added to a solution of ethyl (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionate (6 g, 14.52 mmol) in THF (45 mL) and H2O (15 mL). The reaction mixture was stirred at 25 °C under N2 for 2 hours. The pH of the mixture was adjusted to 6–7 with 2N hydrogen chloride solution. The mixture was washed with water (50 mL) and extracted with EA (50 mL × 3). The organic phase was washed with brine (50 mL × 2), dried over Na2SO4, and evaporated to give a black oily product (5.2 g, 74%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 385.0 387.0 [M+H] + .

[0335] Preparation of intermediate I-9: (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-[(3-chlorophenyl)carboxamide]-N-(1-cyanocyclopropyl)propionamide

[0336] Figure 13 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-9 according to some embodiments of this application.

[0337] Step 1: Preparation of N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(1-cyanocyclopropyl)carbamoyl]ethyl]tert-butyl carbamate

[0338] A solution of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-{[(tert-butoxy)carbonyl]amino}propionic acid (3.3 g, 0.0086 mol) in DMF (30 mL) was supplemented with DIEA (3.33 g, 0.0258 mol), HATU (4.10 g, 0.0129 mol), and 1-aminocyclopropane-1-onitrile (1.06 g, 0.0129 mol). The solution was stirred at 25 °C under N2 for 2 hours. Water (50 mL) was added, and the mixture was extracted with EA (40 mL × 3). The composite organic layer was washed with brine (30 mL × 3) and then dried with anhydrous Na2SO4. After filtration, the solution was concentrated under vacuum, and the crude product was purified by combined flash chromatography (EA / PE = 20%-25%) to obtain a yellow solid tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(1-cyanocyclopropyl)carbamoyl]ethyl]carbamate. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 449.3 [M+H] + .

[0339] Step 2: Preparation of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide

[0340] A solution of N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(1-cyanocyclopropyl)carbamoyl]ethyl]carbamate (1.6 g, 0.0036 mmol) in FA (10 mL) was stirred at 25 °C for 1 hour. The product was concentrated under vacuum to give a yellow solid of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (900 mg, 69%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 349.1 [M+H] + .

[0341] Preparation of step 3 (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-[(3-chlorophenyl)formamido]-N-(1-cyanocyclopropyl)propionamide

[0342] 3-Chlorobenzoic acid (349 mg, 2.23 mmol), HATU (820 mg, 2.23 mmol), and DIEA (666 mg, 5.15 mmol) were added to a DMF (6 mL) solution of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (600 mg, 1.71 mmol). The solution was stirred at 25 °C under N2 for 2 hours. Water (50 mL) was added, and the mixture was extracted with EA (40 mL × 3). The composite organic layer was washed with brine (30 mL × 3) and then dried over anhydrous Na2SO4. After filtration, the solution was concentrated under vacuum, and the crude product was purified by combined flash chromatography (EA / PE = 25%-30%) to obtain a yellow solid (2S)-3-(6-bromo-1,3-benzoxazol-2)-yl)-2-[(3-chlorophenyl)carbamate]-N-(1-cyanocyclopropyl)propionamide (450 mg, 51%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 487.2 [M+H] + .

[0343] Example 3.1: Preparation of compound 1 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxypropyl-2-yl)-3-chlorobenzamide)

[0344] Figure 14 This is a schematic diagram illustrating exemplary steps for preparing compound 1 according to some embodiments of this application.

[0345] Following standard procedure A, a yellow solid (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 2-aminophenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 271.0 [M+H] + .

[0346] Following standard procedure B-1, compound 1 (25 mg, 33%) was obtained as a white solid based on (S)-2-amino-3-(phenylpropionyl[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (50 mg). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 409.0 [M+H] + . 1 HNMR (400MHz, CDCl3) δ8.34 (d, J=7.1Hz, 1H), 8.17 (s, 1H), 7.87 (t, J=1.7Hz, 1H), 7.74 (d, J=7.8HZ, 1H), 7.68 (m, 1H), 7.54 (m, 2H), 7.42 (t, J =7.9Hz, 1H), 7.36 (m, 2H), 5.16 (td, J = 7.0, 4.4Hz, 1H), 3.69 (dd, J = 16.6, 4.3Hz, 1H), 3.37 (dd, J = 16.6, 6.9Hz, 1H), 1.51 (m, 2H), 1.24 (m, 2H).

[0347] Example 3.2: Preparation of compound 2((S)-N-(3-(4-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-chlorobenzamide)

[0348] Figure 15 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-2 according to some embodiments of this application.

[0349] Following standard procedure A, a yellow solid (S)-2-amino-3-(4-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 2-amino-3-bromophenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 349.02, 351.02 [M+H] + .

[0350] Following standard procedure B-1, a white solid compound 2 (4 mg, 7%) was obtained based on (S)-2-amino-3-(4-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (40 mg). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 487.01, 489.01 [M+H]. + . 1H NMR (400MHz, DMSO-d6) δ9.09 (s, 1H), 9.03 (d, J = 7.9Hz, 1H), 7.85 (t, J = 1.8Hz, 1H), 7.76–7.71 (m, 1H), 7.64 (dd, J = 7.9, 0.9Hz, 1H), 7.60–7.52 (m, 2 H), 7.47 (t, J=7.9Hz, 1H), 7.25 (t, J=8.0Hz, 1H), 4.96–4.89 (m, 1H), 3.49 (dd, J=15.6, 5.6Hz, 1H), 3.36 (d, J=8.9Hz, 1H), 1.44 (m, 2H), 1.08 (m, 2H).

[0351] Example 3.3: Preparation of compound 3((S)-N-(3-(7-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-chlorobenzamide)

[0352] Figure 16 This is a schematic diagram illustrating exemplary steps for preparing intermediate I-3 according to some embodiments of this application.

[0353] Following standard procedure A, a yellow solid (S)-2-amino-3-(7-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 2-amino-3-bromophenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 349.1 [M+H] + .

[0354] Following standard procedure B-1, based on 2-amino-6-bromophenol and (S)-2-amino-3-(7-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (35 mg), a white solid compound 3 (17.2 mg, 35%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 486.8 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.11 (s, 1H), 9.05 (d, J=7.9Hz, 1H), 7.90 (t, J=1.8Hz, 1H), 7.79 (d, J=7.8Hz, 1H), 7.67 (m, 1H), 7.61 (m, 2H), 7.51 (t, J=7.9 Hz, 1H), 7.29 (t, J=8.0Hz, 1H), 4.97 (td, J=8.5, 5.6Hz, 1H), 3.54 (dd, J=15.6, 5.5Hz, 1H), 3.39 (dd, J=12.5, 5.7Hz, 1H), 1.48 (m, 2H), 1.13 (m, 2H).

[0355] Example 3.4: Preparation of compound 4((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-fluorobenzo[d]oxazol-2-yl)-1-oxopropane-2-yl)benzamide)

[0356] Figure 17 This is a schematic diagram illustrating exemplary steps for preparing compound 4 according to some embodiments of this application.

[0357] Following standard procedure A, a yellow solid (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-fluorobenzo[d]oxazol-2-yl)propionamide was prepared based on 2-amino-5-fluorophenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 289.0 [M+H] + .

[0358] Following standard procedure B-1, compound 4 was obtained as a white solid (20.2 mg, 23%) based on (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-fluorobenzo[d]oxazol-2-yl)propionamide (60 mg). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 427.0 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.10 (s, 1H, 9.04 (d, J=7.9Hz, 1H), 7.89 (s, 1H), 7.78 (d, J=7. 8Hz, 1H), 7.66 (m, 3H), 7.50 (d, J=7.9Hz, 1H), 7.24-7.18 (m, 1H), 4.95 (dd, J=14.0, 8.3 Hz, 1H), 3.48 (dd, J = 15.6, 5.9 Hz, 2H), 1.46 (t, J = 6.0 Hz, 2H), 1.13-1.03 (m, 2H). Example 3.5: Preparation of compound 5((S)-3-chloro-N-(3-(7-cyanobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)phenylpropionamide)

[0359] Figure 18 This is a schematic diagram illustrating exemplary steps for preparing compound 5 according to some embodiments of this application.

[0360] Following standard procedure A, a pale yellow solid (S)-2-amino-3-(7-cyanobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 3-amino-2-hydroxybenzonitrile. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 296.0 [M+H] + .

[0361] Following standard procedure B-1, compound 5 (12.5 mg, 16%) was obtained as a white solid based on (S)-2-amino-3-(7-cyanobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (52 mg). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 434.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.09 (s, 1H), 9.04 (d, J=8.0Hz, 1H), 8.02 (dd, J=8.0, 1.0Hz, 1H), 7.87-7.80 (m, 2H), 7.74 (m, 1H), 7.62-7.56 (m, 1H), 7.48 (m, 2H), 4.95 (td, J=8.4, 5.8Hz, 1H), 3.54 (dd, J=15.5, 5.8Hz, 1H), 3.39 (dd, J=15.5, 8.7Hz, 1H), 1.48-1.36 (m, 2H), 1.15-0.98 (m, 2H).

[0362] Example 3.6: Preparation of compound 6((S)-3-chloro-N-(3-(7-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)phenylpropionamide)

[0363] Figure 19 This is a schematic diagram illustrating exemplary steps for preparing compound 6 according to some embodiments of this application.

[0364] Following standard procedure A, a pale yellow solid (S)-2-amino-3-(7-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 2-amino-6-chlorophenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 305.0 [M+H] + .

[0365] Following standard procedure B-1, based on (S)-2-amino-3-(7-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (58 mg), a white solid compound 6 (68.9 mg, 82%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 443.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.11 (s, 1H), 9.06 (d, J=7.9Hz, 1H), 7.89 (t, J=1.9 Hz, 1H), 7.79-7.77(m, 1H), 7.67-7.64(m, 1H), 7.64-7.61(m, 1H), 7.51(t, J =7.9Hz, 1H), 7.48-7.46 (m, 1H), 7.35 (t, J = 8.0Hz, 1H), 5.01-4.90 (m, 1H), 3 .58-3.49 (m, 1H), 3.45-3.36 (m, 1H), 1.52-1.41 (m, 2H), 1.20-1.05 (m, 2H).

[0366] Example 3.7: Preparation of compound 7((S)-3-chloro-N-(3-(4-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)phenylpropionamide)

[0367] Figure 20 This is a schematic diagram illustrating exemplary steps for preparing compound 7 according to some embodiments of this application.

[0368] Following standard procedure A, a pale yellow solid (S)-2-amino-3-(4-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 2-amino-3-chlorophenol. Mass spectrometry analysis of the obtained compound was performed, and the results are as follows: Mass (m / z): 305.0 [M+H] + .

[0369] Following standard procedure B-1, based on (S)-2-amino-3-(4-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (5 mg), a white solid compound 7 (29 mg, 40%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 443.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.11 (s, 1H), 9.06 (d, J = 8.0Hz, 1H), 7.89 (t, J = 1.7Hz, 1H), 7.78 (d, J = 7.8Hz, 1H), 7.64 (m, 2H), 7.51 (t, J = 7.9Hz, 1H), 7.44 (dd, J=8.0, 0.9Hz, 1H), 7.38 (t, J=8.0Hz, 1H), 4.97 (dd, J=14.2, 8.1Hz, 1 H), 3.57-3.50 (m, 1H), 3.42-3.36 (m, 1H), 1.46 (m, 2H), 1.17-1.04 (m, 2H).

[0370] Example 3.8: Preparation of compound 8((S)-3-chloro-N-(3-(5-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)phenylpropionamide)

[0371] Figure 21 This is a schematic diagram of exemplary steps for preparing compound 8 according to some embodiments of this application.

[0372] Following standard procedure A, a pale yellow solid (S)-2-amino-3-(5-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 2-amino-4-chloro-phenol. Mass spectrometry analysis of the obtained compound was performed, and the results are as follows: Mass (m / z): 305.0 [M+H] + .

[0373] Following standard procedure B-1, based on (S)-2-amino-3-(5-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (60 mg), a white solid compound 8 (28.9 mg, 33%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 442.9 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.14 (s, 1H), 9.08 (d, J=7.9Hz, 1H), 7.92-7.86 (m, 1 H), 7.79 (dd, J=4.9, 2.7Hz, 2H), 7.71 (d, J=8.7Hz, 1H), 7.62 (dd, J=8.0, 1.1H z, 1H), 7.52 (q, J=7.5Hz, 1H), 7.41 (dd, J=8.7, 2.1Hz, 1H), 5.04-4.89 (m, 1H ), 3.50 (m, 1H), 3.39 (d, J = 8.7Hz, 1H), 1.53-1.41 (m, 2H), 1.17-1.02 (m, 2H).

[0374] Example 3.9: Preparation of compound 9((S)-3-chloro-N-(3-(5-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)propionamide)

[0375] Figure 22 This is a schematic diagram illustrating exemplary steps for preparing compound 9 according to some embodiments of this application.

[0376] Following standard procedure A, a pale yellow solid (S)-2-amino-3-(6-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide was obtained based on 2-amino-5-chloro-phenol. Mass spectrometry analysis of the obtained compound was performed, and the results are as follows: Mass (m / z): 305.0 [M+H] + .

[0377] Following standard procedure B-1, based on (S)-2-amino-3-(6-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (55 mg), a white solid compound 9 (30.1 mg, 42%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 442.9 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.10 (s, 1H), 9.04 (d, J=7.9Hz, 1H), 7.88 (m, 2H), 7.78 (d, J=7.8Hz, 1H), 7.68 (d, J=8.5Hz, 1H), 7.62 (m, 1H), 7.51 (t, J=7.9 Hz, 1H), 7.39 (dd, J=8.5, 1.9Hz, 1H), 4.96 (dd, J=14.0, 8.2Hz, 1H), 3.50 (dd, J=15.6, 5.9Hz, 1H), 3.37 (d, J=8.7Hz, 1H), 1.46 (m, 2H), 1.09 (m, 2H).

[0378] Example 3.10: Preparation of compound 10((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(5-(trifluoromethyl)benzo[d]oxazol-2-yl)propane-2-yl)phenylpropionamide)

[0379] Figure 23 This is a schematic diagram of exemplary steps for preparing compound 10 according to some embodiments of this application.

[0380] Following standard procedure A, a pale yellow solid (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5-(trifluoromethyl)benzo[d]oxazol-2-yl)propionamide was obtained based on 2-amino-4-trifluoromethyl-phenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 339.0 [M+H] + .

[0381] Following standard procedure B-1, (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5-(trifluoromethyl)benzo[d]oxazol-2-yl)propylamide (60 mg) yielded a white solid compound 10 (30.8 mg, 36%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 477.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.07 (s, 1H), 9.02 (d, J=7.8Hz, 1H), 8.08-8.04 (m, 1H), 7.89-7.83 (m, 2H), 7.73 (dd, J=6.8, 5.4Hz , 2H), 7.62-7.56 (m, 1H), 7.47 (t, J=7.9Hz, 1H), 4.96 (td, J=8.3, 5.9Hz, 1H), 3.55-3.32 (m, 2H), 1.43 (m, 2H), 1.06 (m, 2H).

[0382] Example 3.11: Preparation of compound 11((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(trifluoromethyl)benzo[d]oxazol-2-yl)propyl-2-yl)phenylpropionamide)

[0383] Figure 24 This is a schematic diagram of exemplary steps for preparing compound 11 according to some embodiments of this application.

[0384] Following standard procedure A, a pale yellow solid (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(trifluoromethyl)benzo[d]oxazol-2-yl)propylamide was obtained based on 2-amino-5-trifluoromethyl-phenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 339.0 [M+H] + .

[0385] Following standard procedure B-1, compound 11 (25 mg, 51%) was obtained as a white solid based on (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(trifluoromethyl)benzo[d]oxazol-2-yl)propionamide (35 mg). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 477.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.08 (s, 1H), 9.03 (d, J=7.9Hz, 1H), 8.16-8.10 (m, 1H), 7.84 (m, 2H), 7.76-7.71 (m, 1H), 7.67 (m, 1H), 7.58 (m, 1H), 7.47 (t, J=7.9Hz, 1H), 4.96 (td, J=8.3, 6.0Hz, 1H), 3.52 (m, 1H), 3.41-3.32 (m, 1H), 1.47-1.34 (m, 2H), 1.13-1.05 (m, 2H).

[0386] Example 3.12: Preparation of compound 12((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(7-(trifluoromethyl)benzo[d]oxazol-2-yl)propane-2-yl)phenylpropionamide)

[0387] Figure 25 This is a schematic diagram illustrating exemplary steps for preparing compound 12 according to some embodiments of this application.

[0388] Following standard procedure A, a pale yellow solid (S)-2-amino-N-(1-cyanocyclopropyl)-3-(7-(trifluoromethyl)benzo[d]oxazol-2-yl)propionamide was obtained based on 2-amino-6-trifluoromethyl-phenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 339.0 [M+H] + .

[0389] Following standard procedure B-1, based on (S)-2-amino-N-(1-cyanocyclopropyl)-3-(7-(trifluoromethyl)benzo[d]oxazol-2-yl)propionamide (60 mg), a white solid compound 12 (35.4 mg, 42%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 476.9 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.11 (s, 1H), 9.05 (d, J = 8.0Hz, 1H), 8.01 (d, J = 7.8Hz, 1H), 7.87 (d, J = 1.8Hz, 1H), 7.74 (m, 2H), 7.65-7.59 (m, 1H), 7.52 (m, 2H), 4.99 (dd, J=13.5, 8.7Hz, 1H), 3.58 (dd, J=15.7, 5.4Hz, 1H), 3.41 (dd, J=15.7, 9.0Hz, 1H), 1.48 (m, 2H), 1.14 (m, 2H).

[0390] Example 3.13: Preparation of compound 13((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-(tert-butyl)-1-methyl-1H-pyrazole-5-methylamide)

[0391] Figure 26 This is a schematic diagram illustrating exemplary steps for preparing compound 13 according to some embodiments of this application.

[0392] Following standard procedure B-2, compound 13 was purified from (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propylamide (50 mg) by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H2O (0.1% FA); 15%–80%)] to obtain a white solid (15 mg, 19%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 435.1 [M+H] + . 1H NMR (400MHz, CDC-L3) δ8.19 (s, 1H), 7.99 (d, J=6.9Hz, 1H), 7.67 (m, 1H), 7.54 (s, 1H), 7.38 (m, 2H), 6.55 (s, 1H), 5.06 (td, J=7.2, 4. 0Hz, 1H), 4.13 (s, 3H), 3.68 (dd, J=16.9, 3.9Hz, 1H), 3.32 (dd, J=16.9, 7.4Hz, 1H), 1.55 (s, 2H), 1.34 (d, J=7.1Hz, 9H), 1.22 (m, 2H).

[0393] Example 3.14: Preparation of compound 14((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-6-methylpyridinecarboxamide)

[0394] Figure 27 This is a schematic diagram illustrating exemplary steps for preparing compound 14 according to some embodiments of this application.

[0395] Following standard procedure B-2, compound 14 was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H2O (0.1% FA); 15%–80%)] from (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (50 mg) to obtain a white solid (6.1 mg, 9%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 390.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.18 (s, 1H), 8.97 (d, J = 8.3Hz, 1H), 7.84 (t, J = 7.6Hz, 1H), 7.78 (d, J = 7.3Hz, 1H), 7.62 (m, 2H), 7.45 (d, J = 7 .5Hz, 1H), 7.35-7.26 (m, 2H), 4.95 (dd, J=14.5, 6.4Hz, 1H), 3.52-3.39 (m, 2H), 2.52 (m, 3H), 1.47-1.38 (m, 2H), 1.11-0.99 (m, 2H). Example 3.15: Preparation of compound 15((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((cyanomethyl)amino)-1-oxopropyl-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-carboxamide)

[0396] Figure 28This is a schematic diagram illustrating exemplary steps for preparing compound 15 according to some embodiments of this application.

[0397] Step 1: Preparation of ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-formamide)propionate

[0398] DIPEA (282 mg, 2.2 mmol) was added to a solution of 1,3-dicyclopropyl-1H-pyrazole-5-carbonyl chloride (150 mg, 0.73 mmol) and ethyl (2S)-2-amino-3-(1,3-benzoxazole-2-yl)propionate (170 mg, 0.73 mmol) in DCM (30 mL). The reaction mixture was stirred at 0 °C for 1 hour. The solvent was removed under negative pressure, and the residue was purified by preparative thin-layer chromatography (TLC) (PE / EA = 3 / 1) to produce a product as a white solid (170 mg, 56%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 408.9 [M+H] + .

[0399] Preparation of step 2(S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-formamide)acrylic acid

[0400] Ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-carboxamido)propionate (170 mg, 0.42 mmol) in a THF / H₂O (5:1, 12 mL) solution was added to LiOH·H₂O (175 mg, 4.2 mmol). The reaction mixture was stirred at room temperature for 1 hour. The pH of the reaction solution was adjusted to 5-6 using 1N hydrogen chloride solution. The mixture was then extracted with EA (20 mL × 2). The composite organic layer was washed with brine (10 mL) and dried over anhydrous Na₂SO₄. The mixture was filtered, and the filtrate was concentrated under vacuum to give the desired product (150 mg, 90%) as a yellow oil. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 381.2 [M+H] + .

[0401] Preparation of step 3(S)-N-(3-(benzo[d]oxazol-2-yl)-1-((cyanomethyl)amino)-1-oxopropyl-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-methylamide

[0402] DIPEA (255 mg, 2.0 mmol) was added to a solution of (S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-carboxamido)acrylic acid (150 mg, 0.39 mmol) and 2-aminoacetonitrile hydrochloride (40 mg, 0.44 mmol) in DCM (15 mL). After stirring at 0 °C for 10 min, T3P (50% in EA, 753 mg, 1.2 mmol) was added and the mixture was stirred at room temperature for 4 h. The solvent was removed under negative pressure and the residue was purified by Combi-flash (PE / EA = 0–50%) to give compound 15 (35.7 mg, 22%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 419.2 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ8.89-8.75 (m, 2H), 7.73-7.62 (m, 2H), 7.43-7.28 (m, 2H), 6.47 (s, 1H), 5.10-5.01 (m, 1H), 4.28-4.1 3 (m, 3H), 3.54 (dd, J=15.6, 5.2Hz, 1H), 3.37 (s, 1H), 3.30 (s, 1H), 1.86-1.77 (m, 1H)), 1.03-0.76 (m, 6H), 0.59-0.50 (m, 2H).

[0403] Example 3.16: Preparation of compound 16((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-3-methyl-1H-pyrazole-5-methylamide)

[0404] Figure 29 This is a schematic diagram illustrating exemplary steps for preparing compound 16 according to some embodiments of this application.

[0405] Step 1: Preparation of ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propionate

[0406] 1-Cyclopropyl-3-methyl-1H-pyrazole-4-carbonyl chloride (150 mg, 0.81 mmol) was added to a solution of (S)-2-amino-3-(benzo[d]oxazol-2-yl)propionate (190 mg, 0.81 mmol) and DIPEA (410 mg, 4.06 mmol) in DCM (5 mL). The reaction mixture was stirred at 25 °C for 16 hours. The mixture was concentrated under negative pressure to prepare a crude product (210 mg, 54%) as a yellow oil. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 383.1 [M+H] + .

[0407] Preparation of step 2(S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propionic acid

[0408] Ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propionate (230 mg, 0.6 mmol) was treated with THF (2 mL) and 1N LiOH (2 mL) at 25 °C for 2 hours. After treatment, the mixture was concentrated under vacuum. The residue was dissolved in water (10 mL), the pH was adjusted to 7 with 1N hydrogen chloride solution, and extracted with ethyl acetate (10 mL × 2). The composite organic layer was washed with brine (10 mL), dried over Na₂SO₄, filtered, and concentrated under vacuum to give a yellow oily product (140 mg, 52.56%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 355.1 [M+H] + .

[0409] Preparation of step 3(S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropyl-2-yl)-1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamide

[0410] A solution of (S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propionic acid (140 mg, 0.39 mmol), 1-aminocyclopropane-1-onitrile (70 mg, 0.59 mmol), T3P (50% of EA, 754 mg, 2.379 mmol), and DIPEA (255 mg, 1.97 mmol) in DCM (5 mL) was stirred at 25 °C for 16 hours. The residue was diluted with NaHCO3 (10 mL) and extracted with DCM (10 mL × 2). The composite organic layer was washed with brine (10 mL), dried over Na₂SO₄, filtered, and concentrated under vacuum. The residue was subjected to preparative HPLC [Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H₂O (0.1% TFA), 30–50] to obtain a white solid compound 16 (38.4 mg, 22%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 419.1 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ8.05 (s, 1H), 7.67-7.46 (m, 2H), 7.45-7.30 (m, 2H), 4.98 (dd, J=7.8, 6.2Hz, 1H), 3.62-3.46 (m, 2H), 3.37 ( dd, J=15.4, 7.8Hz, 1H), 3.28 (dt, J=3.2, 1.6Hz, 3H), 1.44 (dd, J=6.2, 3.4Hz, 2H), 1.15 (dd, J=18.2, 1.6Hz, 2H), 1.02-0.99 (m, 4H).

[0411] Example 3.17: Preparation of compound 17((S)-N-(1-((1-cyanocyclopropyl)amino)-3-(5,6-difluorobenzo[d]oxazol-2-yl)-1-oxopropane-2-yl))-1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamide)

[0412] Figure 30 This is a schematic diagram illustrating exemplary steps for preparing compound 17 according to some embodiments of this application.

[0413] Following standard procedure A, a pale yellow solid (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5,6-difluorobenzo[d]oxazol-2-yl)propionamide was obtained based on 2-amino-4,5-difluorophenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 306.8 [M+H] + .

[0414] Following standard procedure B-1, compound 17 was obtained as a white solid (10 mg, 8%) from (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5,6-difluorobenzo[d]oxazol-2-yl)propionamide (83 mg). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 454.8 [M+H] + . 1 H NMR (400MHz, MeOD) δ8.10 (s, 1H), 7.61 (ddd, J=17.4, 9.6, 7.2Hz, 2H), 5.02 (d, J=6.2Hz, 1H), 3.61 (d, J=5.4Hz, 1H), 3.55 (dd, J=15.4 , 6.2Hz, 1H), 3.40 (dd, J=15.6, 7.8Hz, 1H), 2.33 (s, 3H), 1.50 (d, J=2.2Hz), 2H), 1.23 (dd, J=8.2, 2.2Hz, 2H), 1.06 (d, J=5.6Hz, 4H).

[0415] Example 3.18: Preparation of compound 18((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxamide)

[0416] Figure 31 This is a schematic diagram illustrating exemplary steps for preparing compound 18 according to some embodiments of this application.

[0417] Following standard procedure B-2, based on (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (81 mg), a white solid compound 18 (38 mg, 22%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 473.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ8.24 (s, 1H), 7.60 (s, 1H), 7.54 (d, J = 0.8Hz, 1H), 7.39-7.27 (m, 2H), 4.97 (d, J = 1.0Hz, 1 H), 3.80-3.67 (m, 1H), 3.49 (d, J=6.4Hz, 1H), 3.40 (d, J=7.8Hz, 1H), 1.44 (d, J=3.0Hz), 2H), 1.18-1.04 (m, 6H).

[0418] Example 3.19: Preparation of compound 19 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-3-(difluoromethyl)-1H-pyrazole-4-carboxamide)

[0419] Figure 32 This is a schematic diagram illustrating exemplary steps for preparing compound 19 according to some embodiments of this application.

[0420] Following standard procedure B-2, based on (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (50 mg), a white solid compound 19 (14.5 mg, 17%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 455.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ8.22 (s, 1H), 7.62-7.51 (m, 2H), 7.38-7.29 (m, 2H), 7.02 (t, J=54.0Hz, 1H), 4.99 (s, 1H), 3.76-3.68 (m, 1H), 3.50 (d, J=6.2Hz, 1H), 3.40 (d, J=7.8Hz, 1H), 1.44 (s, 2H), 1.19-1.02 (m, 6H).

[0421] Example 3.20: Preparation of compound 20 ((S)-3-(tert-butyl)-N-(3-(7-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide)

[0422] Figure 33 This is a schematic diagram illustrating exemplary steps for preparing compound 20 according to some embodiments of this application.

[0423] Following standard procedure B-3, based on (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (200 mg), a white solid compound 20 (37 mg, 19%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 495.2 [M+H] + . 1H NMR (400MHz, MeOD) δ7.58 (dd, J=7.8, 1.2Hz, 1H), 7.39 (dd, J=8.0, 1.2Hz, 1H), 7.33 (t, J=7 .8Hz, 1H), 6.62 (s, 1H), 5.05 (dd, J=8.6, 5.6Hz, 1H), 3.98-3.91 (m, 1H), 3.62 (dd, J=15.6, 5.8Hz, 1H), 3.45 (dd, J=15.4, 8.6Hz, 1H), 1.49 (t, J=5.6Hz, 2H), 1.28 (s, 1H), 1.25 (s, 9H) , 1.23 (d, J=2.6Hz, 1H), 1.06 (dd, J=6.4, 3.8Hz, 1H), 1.00-0.95 (m, 1H), 0.92-0.82 (m, 2H).

[0424] Example 3.21: Preparation of compound 3.21 ((S)-3-(tert-butyl)-N-(3-(7-chloro-5-fluorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide)

[0425] Figure 34 This is a schematic diagram illustrating exemplary steps for preparing compound 21 according to some embodiments of this application.

[0426] Following standard procedure A, a yellow oily compound, (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide, was obtained based on 2-amino-6-chloro-4-fluorophenol. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 323.2 [M+H] + .

[0427] Following standard procedure B-3, compound 21 (4.7 mg, 3%) was obtained as a white solid based on (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (49 mg). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 513.0 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.12 (s, 1H), 8.80 (d, J=8.0Hz, 1H), 7.64 (dd, J=8.4, 2.2Hz , 1H), 7.55 (dd, J=9.4, 2.0Hz, 1H), 6.69 (s, 1H), 4.92 (d, J=5.8Hz, 1H), 4.19 (dd, J=7 .4, 3.8Hz, 1H), 3.53 (dd, J=15.4, 5.4Hz, 1H), 1.48 (t, J=4.1Hz, 2H), 1.37-1.08 (m, 12H), 1.04 (dd, J=10.0, 6.2Hz, 1H), 0.94 (dd, J=9.8, 5.8Hz, 1H), 0.90-0.75 (m, 2H).

[0428] Example 3.22: Preparation of compound 22((S)-3-(tert-butyl)-N-(3-(7-chloro-5-fluorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-(oxetane-3-yl)-1H-pyrazole-5-carboxamide)

[0429] Figure 35 This is a schematic diagram illustrating exemplary steps for preparing compound 22 according to some embodiments of this application.

[0430] Following standard procedure B-3, based on (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (100 mg), a white solid compound 22 (6 mg, 4%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 529.2 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.15 (s, 1H), 8.96 (d, J = 4.8Hz, 1H), 7.65-7.55 (m, 2H), 6.85 (s, 1H), 5.88-5.79 ( m, 1H), 4.75-4.95 (m, 5H), 3.55-3.48 (m, 1H), 1.55-1.42 (m, 2H), 1.38-1.55 (m, 10H), 1.19-1.05 (m, 2H).

[0431] Example 3.23: Preparation of compound 23((S)-N-(3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-chlorobenzamide)

[0432] Figure 36This is a schematic diagram of exemplary steps for preparing compound 23 according to some embodiments of this application.

[0433] Step 1: Preparation of tert-butyl(S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-ethoxy-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1 carboxylate

[0434] A mixture of (S)-3-(4-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionate ethyl ester solution (450 mg, 1.09 mmol), tert-butyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)-1H-pyrazole-1-carboxylate (384 mg, 1.31 mmol), Pd(dppf)Cl2 (70.65 mg, 0.10 mmol), and Na2CO3 (231 mg, 2.18 mmol) in a 1,4-dioxane / H2O (12 mL / 2 mL) solution was stirred at 90 °C for 1 hour. The reaction mixture was quenched with water and extracted with EA (60 mL × 3). The composite organic layer was dried with Na₂SO₄ and concentrated under vacuum to obtain a crude product, which was then purified by rapid chromatography (MeOH in DCM, 2% to 10%) to obtain a white solid product (200 mg, 74%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 501.1 [M+H] + .

[0435] Step 2: Preparation of (S)-3-(4-(1-(tert-butoxycarbonyl)-1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionic acid

[0436] A solution of tert-butyl(S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-ethoxy-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1-carboxylate (350 mg, 0.7 mmol) and LiOH (19.06 mg, 0.80 mmol) in THF / H₂O (15 mL / 4 mL) was stirred at 25 °C for 1 hour. The reaction mixture was quenched with water and extracted with EA (60 mL × 3). The composite organic layer was dried over Na₂SO₄ and concentrated under vacuum to give a pale yellow solid product (280 mg, 85%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 473.1 [M+H] + .

[0437] Step 3: Preparation of tert-butyl(S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-((1-cyanocyclopropyl)amino)-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1-carboxylate

[0438] A solution of (S)-3-(4-(1-(tert-butoxycarbonyl)-1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionic acid (280 mg, 0.59 mmol), A-5 (84 mg, 0.71 mmol), DIPEA (228 mg, 1.77 mmol), and T3P (50% in EA, 402 mg, 0.63 mmol) in DCM (5 mL) was stirred at 25 °C for 3 hours under N2. The reaction mixture was quenched with water and extracted with DCM (30 mL × 3). The composite organic layer was dried over Na2SO4 and concentrated under vacuum to give a crude product, which was purified by rapid chromatography (MeOH in DCM, 2% to 10%) to obtain a white solid product (130 mg, 41%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 537.1 [M+H] + .

[0439] Step 4: Preparation of (S)-3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-amino-N-(1-cyanocyclopropyl)propionamide

[0440] 130 mg (0.24 mmol) of tert-butyl(S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-((1-cyanocyclopropyl)amino)-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1-carboxylate was added to FA (2 mL) and stirred at 25 °C for 3 hours. The mixture was concentrated under negative pressure to obtain a residue. The residue was quenched with saturated NaHCO3 solution and extracted with EtOAc (60 mL × 3). The composite organic layer was dried with Na2SO4 and concentrated under vacuum to obtain a crude product (30 mg, 37%) as a pale yellow solid. Mass spectrometry analysis of the obtained compound showed the following results: Mass (m / z): 437.1 [M+H] + .

[0441] Step 5: Preparation of (S)-N-(3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-chlorobenzamide

[0442] A solution of 3-chlorobenzoyl chloride (18.73 mg, 0.11 mmol) in EA (0.5 mL) was added dropwise to a solution of (S)-3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-amino-N-(1-cyanocyclopropyl)propionamide (30 mg, 0.09 mmol) and K₂CO₃ (24.66 mg, 0.18 mmol) in EA (2 mL) and H₂O (3 mL). After the addition, the reaction mixture was stirred at 25 °C for 0.5 h. The reaction mixture was then quenched with water and extracted with EA (20 mL × 3). The composite organic layer was dried with Na2SO4 and concentrated under vacuum to obtain a crude product. The crude product was purified by preparative HPLC [(Gemini-C18, 150×21.2mm, 5µm; ACN-H2O (0.1% FA)); 15%-95%)] to obtain a white solid compound 23 (4.1 mg, 10%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 475.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ13.18 (s, 1H), 9.15 (s, 1H), 9.10 (d, J=7.8Hz, 1H), 8.4 3 (s, 2H), 8.19-8.12 (m, 1H), 7.86 (s, 1H), 7.76 (d, J=8.0Hz, 1H), 7.64 (d, J=6.7 Hz, 1H), 7.58 (d, J=9.1Hz, 1H), 7.45 (s, 1H), 7.31 (t, J=7.8Hz, 1H), 5.06 (d, J=4 .1Hz, 1H), 3.55 (d, J=4.2Hz, 1H), 3.45 (s, 1H), 1.47 (m, 2H), 1.17-1.06 (m, 2H).

[0443] Example 3.24: Preparation of compound 24((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)propionamide)

[0444] Figure 37 This is a schematic diagram illustrating exemplary steps for preparing compound 24 according to some embodiments of this application.

[0445] Step 1: Preparation of ethyl (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionate

[0446] A solution of ethyl (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propionate (50 mg, 0.73 mmol), 1-methylpiperazine (73 mg, 0.73 mmol), Cs₂CO₃ (474.5 mg, 1.46 mmol), and RuPhos-Pd-G₂ (57 mg, 0.073 mmol) in toluene (5 mL) was stirred at 110 °C for 18 hours under nitrogen. The reaction mixture was cooled to room temperature, combined, and concentrated under vacuum to give a crude product. The crude product was then purified on silica gel by elution with MeOH (5% to 10%) in DCM to give a light brown oily product (180 mg, 57%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 433.1 [M+H] + .

[0447] Step 2: Preparation of (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionic acid

[0448] A solution of ethyl (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionate (160 mg, 0.37 mmol) and Me3SnOH (134 mg, 0.74 mmol) in DCE (6 mL) was heated to 80 °C and stirred for 3 hours under nitrogen. After concentration, the crude product was purified on silica gel by elution with MeOH (5% to 10%) in DCM to give a light brown solid compound (80 mg, 53.3%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 405.1 [M+H] + .

[0449] Step 3: Preparation of tert-butyl(S)-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)carbamate

[0450] A solution of (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionic acid (70 mg, 0.17 mmol), A-5 (25 mg, 0.21 mmol), HATU (97 mg, 0.26 mmol), and DIPEA (66 mg, 0.51 mmol) in DMF (3 mL) was stirred at 25 °C for 3 hours under nitrogen. The reaction mixture was quenched with water (10 mL) and extracted with EA (35 mL × 3). The complex organic layer was dried over Na₂SO₄ and concentrated to dryness, then purified on silica gel and eluted with MeOH (5% to 10%) in DCM to obtain the desired product (60 mg, 75%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 469.1 [M+H] + .

[0451] Step 4: Preparation of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionamide

[0452] A solution of tert-butyl(S)-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)carbamate (60 mg, 0.13 mmol) in FA (2 mL) was stirred at 25 °C for 5 hours under nitrogen. The mixture was dried under nitrogen at 20 °C. The residue was then alkalized with saturated sodium bicarbonate and extracted with EA (20 mL × 3). The composite organic layer was concentrated to dryness to give the desired product (30 mg, 63.8%) as a pale white solid. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 369.1 [M+H] + .

[0453] Step 5: Preparation of (S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)propionamide

[0454] A solution of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionamide (30 mg, 0.08 mmol) in EA (3 mL) was added to a solution of K2CO3 (22 mg, 0.16 mmol) in water (0.5 mL). Then, a solution of 3-chlorobenzoyl chloride (14 mg, 0.08 mmol) in EA (1 mL) was added dropwise. After the addition was complete, the reaction mixture was stirred at 25 °C for 1 hour. The reaction mixture was quenched with water (5 mL) and extracted with EA (15 mL × 3). The complex organic layer was concentrated to dryness, and the residue was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H2O (0.1% FA); 15%–95%)] to give compound 24 (4.9 mg, 12%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 507.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.08 (s, 1H), 9.00 (d, J=7.9Hz, 1H), 7.89 (t, J=1.8Hz, 1H), 7.78 (d, J= 7.8Hz, 1H), 7.64-7.59 (m, 1H), 7.51 (t, J=7.9Hz, 1H), 7.44 (d, J=8.8Hz, 1H), 7.14 (d, J=2.2Hz, 1H), 6.97 (dd, J=8.8, 2.3Hz, 1H), 4.94-4.88 (m, 1H), 3.43 (d, J=5.7Hz, 1H), 3.26 (d, J=8.8Hz, 1H), 3.17-3.11(m, 4H), 2.48-2.43(m, 4H), 2.22(m, 3H), 1.46-1.47(m, 2H), 1.13-1.02(m, 2H).

[0455] Example 3.25: Preparation of compound 25((S)-N-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-methylamide)

[0456] Figure 38 This is a schematic diagram illustrating exemplary steps for preparing compound 25 according to some embodiments of this application.

[0457] Step 1: Preparation of tert-butyl(S)-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)carbamate

[0458] DIPEA (798 mg, 6.2 mmol), HATU (1410 mg, 3.72 mmol), and 2-aminoacetonitrile (114 mg, 1.86 mmol) were added to a DMF (20 mL) solution of (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionic acid (500 mg, 1.24 mmol) and stirred at room temperature for 2 hours. After the reaction was complete, H2O (30 mL) was added to the reaction mixture, and the mixture was then extracted with EA (30 mL × 3). The composite organic layer was washed with brine (50 mL × 3) and then dried with anhydrous Na2SO4. After filtration, the solution was concentrated under vacuum, and the residue was purified by combined flash chromatography (DCM / MeOH = 0–10%) to obtain a yellow oily product, tert-butyl(S)-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropyl-2-yl)carbamate (310 mg, 56%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 442.9 [M+H] + .

[0459] Step 2: Preparation of (S)-2-amino-N-(cyanomethyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionamide

[0460] A solution of tert-butyl (S)-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)carbamate (310 mg, 0.7 mmol) in FA (5 mL) was stirred at room temperature for 3 hours. The resulting mixture was dried with compressed air to give a brown oily product (S)-2-amino-N-(cyanomethyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionamide (160 mg, 66%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 343.1 [M+H] + .

[0461] Step 3: Preparation of (S)-N-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-carboxamide

[0462] Following standard procedure B-3, based on (S)-2-amino-N-(cyanomethyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionamide (70 mg), a white solid compound 25 (5 mg, 4%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 517.3 [M+H] + . 1 H NMR (400MHz, MeOD) δ7.55 (d, J=8.8Hz, 1H), 7.26 (d, J=2.2Hz, 1H), 7.12 (dd, J=8.8, 2.4Hz, 1H ), 6.39 (s, 1H), 5.16 (dd, J=8.8, 5.6Hz, 1H), 4.21 (s, 2H), 3.93 (ddd, J=11.2, 7.4, 4.0Hz, 2H), 3.62 (dd, J=15.6, 5.6Hz, 2H), 3.39 (dd, J=15.4, 8.8Hz, 2H), 3.00 (s, 3H), 1.87 (ddd, J=13.4, 8.6, 5.0Hz, 1H), 1.05 (dd, J=9.0, 4.8Hz, 1H), 0.98-0.78 (m, 6H), 0.65 (dt, J=6.2, 4.2Hz, 2H).

[0463] Example 3.26: Preparation of compound 26((S)-3-(tert-butyl)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide)

[0464] Figure 39 This is a schematic diagram illustrating exemplary steps for preparing compound 26 according to some embodiments of this application.

[0465] Following standard procedure B-3, based on (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propionamide (80 mg), a white solid compound 26 (14 mg, 11%) was obtained. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 559.3 [M+H] + . 1H NMR (400MHz, MeOD) δ7.43 (d, J=8.8Hz, 1H), 7.14 (d, J=2.2Hz, 1H), 7.01 (dd, J=8 .8, 2.4Hz, 1H), 6.50 (s, 1H), 4.91 (dd, J=8.2, 6.0Hz, 1H), 3.88-3.79 (m, 1H), 3.4 5 (dd, J=15.4, 6.2Hz, 2H), 3.29 (d, J=8.2Hz, 4H), 2.83 (s, 3H), 1.39 (d, J=2.6Hz , 2H), 1.19 (d, J=1.6Hz, 2H), 1.15 (s, 9H), 1.14-1.09 (m, 2H), 1.02-0.69 (m, 6H).

[0466] Example 3.27: Preparation of compound 27((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)propionamide)

[0467] Figure 40 This is a schematic diagram illustrating exemplary steps for preparing compound 27 according to some embodiments of this application.

[0468] 1-Methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaboron-2-yl)-3-chlorobenzamide (100 mg, 0.20 mmol) was added to a solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3,6-dihydro-2H-pyridine (91 mg, 0.41 mmol), K3PO4 (87 mg, 0.411 mmol), and Pd(dppf)Cl2 (15 mg, 0.02 mmol) in dioxane / H2O (10:1, 5 mL). The solution was stirred at 80 °C for 2 hours under N2. After filtration, the solution was concentrated under negative pressure, and the crude product was purified by rapid chromatography to give the target product 27 (18.6 mg, 17.27%) as a white solid.

[0469] The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 504.2 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.09 (s, 1H), 9.03 (d, J=7.8Hz, 1H), 7.89 (t, J=1.8Hz, 1H), 7.78 (d, J=7. 9Hz, 1H), 7.67 (d, J=1.3Hz, 1H), 7.64-7.60 (m, 1H), 7.58 (d, J=8.3Hz, 1H), 7.52 (d, J=7.9Hz, 1H) , 7.43 (dd, J=8.4, 1.6Hz, 1H), 6.21 (s, 1H), 4.96 (dd, J=14.0, 8.3Hz, 1H), 3.51-3.35 (m, 4H), 3.0 2 (d, J=3.0Hz, 2H), 2.57 (d, J=4.8Hz, 2H), 2.28 (s, 3H), 1.47 (d, J=2.8Hz, 2H), 1.12-1.06 (m, 2H).

[0470] Example 3.28: Preparation of compound 28((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)propionamide)

[0471] Figure 41 This is a schematic diagram illustrating exemplary steps for preparing compound 28 according to some embodiments of this application.

[0472] To a solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl))-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide (130 mg, 0.47 mmol) in dioxane / H₂O (10 / 1, 10 mL), 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)-1,2,3,6-tetrahydropyridine (84 mg, 0.57 mmol), K₃PO₄ (113 mg, 0.94 mmol), and Pd(dppf)Cl₂ were added. 2( 20 mg (0.05 mmol). The reaction mixture was stirred at 100 °C for 16 hours under N2. The solvent was removed under negative pressure and the residue was purified by combined flash chromatography (DCM / MeOH = 0–10%) to give product 28 (35 mg, 13%) as a yellow solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 554.2 [M+H] + . 1H NMR (400MHz, MeOD) δ7.83 (t, J=1.8Hz, 1H), 7.75-7.71 (m, 1H), 7.62 (d, J=1.4Hz, 1H), 7.58-7.53 (m, 2H)), 7.49-7.43 (m, 2H), 6.18 (d, J=5.6Hz, 1H), 6.04 (s, 1H), 5.05 (dd, J=8.2, 6.4Hz, 1H), 4.9 1 (d, J=1.8Hz, 1H), 4.85 (s, 1H), 3.59 (dd, J=15.4, 6.4Hz, 1H), 3.44 (dd, J=15.4, 8.2Hz, 1H), 3.3 3 (d, J=3.4Hz, 2H), 2.95-2.86 (m, 4H), 1.48 (dd, J=5.2, 2.2Hz, 2H), 1.19 (dd, J=17.0, 2.4Hz, 2H).

[0473] Example 3.29: Preparation of compound 29((S)-3-(tert-butyl)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide)

[0474] Figure 42 This is a schematic diagram of exemplary steps for preparing compound 29 according to some embodiments of this application.

[0475] Step 1: Preparation of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide

[0476] T3P (5.83 g, 9.16 mmol) and DIPEA (1.18 g, 9.16 mmol) were added to a DCM (20 mL) solution of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (1.6 g, 4.58 mmol) and 5-tert-butyl-2-cyclopropylpyrazole-3-carboxylic acid (954 mg, 4.58 mmol). The reaction mixture was stirred at 25 °C under N2 for 3 hours. The reaction mixture was concentrated and the residue was purified by silica gel column chromatography (PE:EA = 1:1) to give a product as a yellow solid (1.3 g, 47%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 539.1 541.1 [M+H] + .

[0477] Step 2: Preparation of (S)-3-(tert-butyl)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide

[0478] K3PO4 (118 mg, 0.56 mmol) and Pd(dppf)Cl2 (20 mg, 0.028 mmol) were added to a solution of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-[(5-tert-butyl-2-cyclopropylpyrazole-3-yl)carboxamide]-N-(1-cyanocyclopropyl)propionamide (150 mg, 0.28 mmol), 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-2-yl)-3,6-dihydro-2H-pyridine (114 mg, 0.42 mmol) in dioxane (3 mL) and H2O (0.3 mL). The reaction mixture was stirred at 90 °C under N2 for 16 hours. The reaction mixture was concentrated, and the residue was purified by preparative HPLC [Gemini-C18 150×21.2mm, 5µm, mobile phase: ACN-H2O (0.1% FA), gradient: 20-40] to give a white solid product 29 (30mg, 19%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 606.3 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.13 (s, 1H), 8.79 (d, J = 8.0Hz, 1H), 7.73 (s, 1H), 7.62 (d, J = 8.2Hz, 1H), 7.47 (d, J=8.4Hz, 1H), 6.69 (s, 1H), 6.23 (s, 1H), 4.99-4.88 (m, 1H), 4.23-4.15 (m, 1H), 3.49 (dd, J=15.4, 5.8Hz, 1H), 3.39-3.29 (m, 6H), 3.09-2.56 (m, 4H), 1.53-1.40 (m, 2H), 1.2 4-1.17 (m, 9H), 1.16-1.07 (m, 2H), 1.06-1.01 (m, 1H), 0.97-0.91 (m, 1H), 0.87-0.78 (m, 2H).

[0479] Example 3.30: Preparation of compound 30((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methyl-2-oxoperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)propionamide)

[0480] Figure 43 This is a schematic diagram of exemplary steps for preparing compound 30 according to some embodiments of this application.

[0481] K₂CO₃ was added to a mixture of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide (200 mg, 0.4 mmol) and dioxane (10.0 mL). 3( 113 mg (0.8 mmol), 4-methylpiperazin-2-one (93 mg, 0.8 mmol), CuI (15 mg, 0.08 mmol), and DMEDA (7 mg, 0.08 mmol) were added. The reaction mixture was degassed with N2 and stirred at 110 °C for 16 hours. The reaction mixture was concentrated under negative pressure, and the residue was purified by preparative HPLC [Gemini-C18 150 × 21.2 mm, 5 μm; mobile phase: MeCN / H2O (0.1% FA); ratio: 10-25] to give the desired product compound 30 (12 mg, 6%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 521.1 [M+H] + . 1 H NMR (400MHz, MeOD) δ7.84 (t, J=1.8Hz, 1H), 7.75-7.72 (m, 1H), 7.68 (d, J=8.5Hz, 1H), 7.59 (d, J=1.6Hz, 1H), 7.57-7.54(m, 1H), 7.45(t, J=7.8Hz, 1H), 7.29(dd, J=8.4, 1.8Hz, 1H), 5.06(dd , J=8.2, 6.2Hz), 1H), 3.79-3.76 (m, 2H), 3.61 (dd, J=15.4, 6.2Hz, 1H), 3.47 (dd, J=15.4, 8.2H z, 1H), 3.29 (s, 2H), 2.89 (t, J=5.4Hz, 2H), 2.44 (s, 3H), 1.52-1.44 (m, 2H), 1.26-1.16 (m, 2H).

[0482] Example 3.31: Preparation of compound 31((S)-N-(3-(benzo[d]thiazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-chlorobenzamide

[0483] Figure 44 This is a schematic diagram illustrating exemplary steps for preparing compound 31 according to some embodiments of this application.

[0484] Step 1: Preparation of allyl (S)-2-((((9H-fluorene-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazol-2-yl)propionate

[0485] One drop of DMF was added to a solution of (S)-3-((((9H-fluorene-9-yl)methoxy)carbonyl)amino)-4-(allyloxy)-4-oxobutyric acid (1 g, 2.53 mmol) and (COCl)₂ (0.38 g, 3.0 mmol) in DCM (25 mL), and the reaction mixture was stirred at 25 °C for 2 hours under N₂. The solvent was then removed under vacuum to obtain a residue, which was dissolved in anhydrous toluene (15 mL). Then, 2-aminothiophenol (0.33 g, 2.6 mmol) and DIPEA (0.97 g, 7.5 mmol) were added, and the reaction mixture was heated to 40 °C and stirred for 2 hours. After cooling to room temperature, the solvent in the reaction mixture was removed, quenched with water (30 mL), and extracted with DCM (120 mL × 3). The composite organic layer was dried with Na₂SO₄ and concentrated under vacuum to obtain the desired crude product, which was purified by rapid chromatography (EA in PE, 30% to 50%) to give a white solid product (0.47 g, 32%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 485.1 [M+H] + .

[0486] Step 2: Preparation of (S)-2-(((((9H-fluorene-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazolyl)acrylic acid

[0487] A solution of allyl (S)-2-((((9H-fluorene-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazol-2-yl)propionate (470 mg, 0.96 mmol) in DCM (12 mL) was mixed with phenylsilane (215.43 mg, 2.9 mmol), followed by the addition of tetrakis(triphenylphosphine)palladium (559.23 mg, 0.48 mmol) under nitrogen protection. After the addition, the reaction mixture was stirred at 25 °C for 3 hours. The solvent was removed under vacuum to obtain the crude product, which was purified by rapid chromatography (MeOH in DCM, 2%–10%) to obtain the desired product as a light-colored solid (350 mg, 64.93%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 445.1 [M+H] + .

[0488] Step 3: Preparation of (9H-fluorene-9-yl)methyl(S)-(3-(benzo[d]thiazo-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)carbamate

[0489] A solution of (S)-2-((((9H-fluorene-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazolyl-2-yl)acrylic acid (350 mg, 0.78 mmol), 1-aminocyclopropane-1-onitrile hydrogen chloride (67.73 mg, 0.82 mmol), DIPEA (203.06 mg, 0.57 mmol), and HATU (358.45 mg, 0.45 mmol) in DMF (5 mL) was stirred at 25 °C for 3 hours under N2. The reaction mixture was quenched with water and extracted with EA (30 mL × 3). The composite organic layer was dried over Na2SO4 and concentrated under vacuum to obtain a crude product, which was purified by rapid chromatography (MeOH in DCM, 2% to 10%) to obtain a white solid product (90 mg, 20%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 509.1 [M+H] + .

[0490] Step 4: Preparation of (S)-2-amino-3-(benzo[d]thiazolyl)-N-(1-1-cyanocyclopropyl)propionamide

[0491] Et₂NH (1 mL) was added to a solution of (9H-fluorene-9-yl)methyl(S)-(3-(benzo[d]thiazolyl-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)carbamate (90 mg, 0.17 mmol) in MeCN (5 mL). The reaction mixture was stirred at 25 °C for 3 hours under N₂. The mixture was concentrated under negative pressure to obtain a residue. The residue was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H₂O (0.1% FA); 15-90)] to give the desired product (95 mg, 54%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 287 [M+H] + .

[0492] Step 5: Preparation of (S)-N-(3-(benzo[d]thiazolyl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-chlorobenzamide

[0493] A solution of 3-chlorobenzoyl chloride (7.7 mg, 0.04 mmol) in DCM (0.5 mL) was added dropwise to a solution of (S)-2-amino-3-(benzo[d]thiazolyl-2-yl)-N-(1-cyanocyclopropyl)propionamide and DIPEA (16.25 mg, 0.12 mmol) in DCM (1 mL). The reaction mixture was stirred at 25 °C for 0.5 h. The reaction mixture was then quenched with water and extracted with DCM (20 mL × 3). The composite organic layer was dried over Na2SO4 and concentrated under vacuum to obtain a crude product, which was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H2O (0.1% FA)); 15%–90%] to give a white solid product 31 (11.2 mg, 31%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 425.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ8.63 (d, J=6.4Hz, 1H), 8.24 (s, 1H), 8.01-7.97 (m, 1H), 7.92 (t, J=1.8Hz, 1H), 7.88 (d, J=7.8Hz, 1H), 7.80 -7.77 (m, 1H), 7.55-7.49 (m, 2H), 7.41 (m, 2H), 5.03 (m, 1H), 3.83 (m, 1H), 3.49-3.43 (m, 1H), 1.53-1.47 (m, 2H), 1.23-1.13 (m, 2H).

[0494] Example 3.32: Preparation of compound 32((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)-1-oxopropane-2-yl)propionamide)

[0495] Figure 45 This is a schematic diagram illustrating exemplary steps for preparing compound 32 according to some embodiments of this application.

[0496] Step 1: Preparation of methyl (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propionate

[0497] (S)-3-((tert-butoxycarbonyl)amino)-4-methoxy-4-oxobutyric acid (1.3 g, 5.26 mmol), N 1A mixture of 1,2-diamine (284 mg, 5.26 mmol), HOBt (858 mg, 6.31 mmol), EDCl (1.21 g, 6.31 mmol), and Et3N (1.59 g, 15.78 mmol) in DCM (20 mL) was stirred at 25 °C for 18 hours under nitrogen. The reaction mixture was quenched with 15 mL of water and extracted with DCM (30 mL × 3). The composite organic layer was dried over Na2SO4 and concentrated under vacuum, then purified on silica gel (PE in EtOAc solution, 50% to 100%) to give a light brown oily mixture of NH and NMe-amides. This mixture (1.18 mg, 3.4 mmol) was added to AcOH (10 mL), heated to 60 °C under nitrogen, and stirred for 18 hours. The reaction was cooled to room temperature and the solvent was removed to obtain a residue. The residue was dissolved in EtOAc (30 mL) and alkalized with saturated NaHCO3 (20 mL). The organic layer was separated, and the aqueous layer was extracted with EtOAc (30 mL × 3). The combined organic layer was washed with brine and dried over anhydrous Na2SO4. After filtration and concentration, the crude product was purified on silica gel by elution with a petroleum ether (35% to 100%) solution of EtOAc to give a pale yellow oily product (700 mg, 62.5%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 334.1 [M+H] + .

[0498] Step 2: Preparation of (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propionic acid

[0499] A solution of methyl (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propionate (500 mg, 1.50 mmol) in THF (8 mL) was slowly added to a solution of methyl LiOH (72 mg, 3.0 mmol) in water (1.5 mL). After addition, the reaction mixture was stirred for 5 hours. The reaction mixture was then acidified to pH 3 with HCl (1 M) and extracted with EtOAc (30 mL × 3). The composite organic layer was washed with brine and dried over anhydrous Na₂SO₄. The solvent was removed under vacuum to give a light brown solid crude product (330 mg, 69%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 320.1 [M+H] + .

[0500] Preparation of step 3: (S)-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzimidazol-2-yl)-1-oxopropane-2-yl)tert-butyl carbamate

[0501] A solution of (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propionic acid (330 mg, 1.03 mmol), A-5 (147 mg, 1.24 mmol), HATU (471 mg, 1.24 mmol), and DIPEA (401.7 mg, 3.09 mmol) in DMF (5 mL) was stirred at 25 °C for 3 hours under nitrogen. The reaction mixture was quenched with water (10 mL) and extracted with EA (35 mL × 3). The complex organic layer was dried over Na2SO4 and concentrated to dryness, then purified on silica gel and eluted with (PE in EA solution, 30% to 100%) to obtain a white, hard product (250 mg, 63.4%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 384.1 [M+H] + .

[0502] Step 4: Preparation of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propionamide

[0503] A solution of tert-butyl(S)-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)-1-oxopropane-2-yl)carbamate (70 mg, 0.18 mmol) in FA (2 mL) was stirred at 25 °C for 5 hours under nitrogen. The mixture was dried under nitrogen at 20 °C. The residue was then alkalized with saturated sodium bicarbonate and extracted with EA (20 mL × 3). The composite organic layer was then concentrated to dryness to give a light-colored solid product (22 mg, 43%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 284.1 [M+H] + .

[0504] Step 5: Preparation of (S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzimidazol-2-yl)-1-oxopropane-2-yl)propionamide

[0505] A solution of 3-chlorobenzoyl chloride (14 mg, 0.08 mmol) in DCM (0.5 mL) was added dropwise to a solution of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propionamide (22 mg, 0.08 mmol) and DIPEA (20.64 mg, 0.16 mmol) in DCM (2 mL). After addition, the reaction mixture was stirred at 25 °C for 1 hour. The reaction mixture was quenched with water (5 mL) and extracted with DCM (15 mL × 3). The complex organic layer was concentrated to dryness, and the residue was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H2O (0.1% FA); 15%–95%)] to give compound 32 (4.2 mg, 12.4%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 422.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.01 (s, 1H), 8.98 (d, J = 7.6Hz, 1H), 7.91 (s, 1H), 7.79 (d, J = 7.9Hz, 1H), 7.61 (d, J = 9.0Hz, 1H), 7.51 (t, J = 7.8Hz, 2H), 7.17 (m, 2H), 4.96 (dd, J=14.3, 7.6Hz, 1H), 3.78 (s, 3H), 3.37 (dd, J=16.5, 6.6Hz, 2H), 1.47-1.36 (m, 2H), 1.02 (m, 2H).

[0506] Example 3.33: Preparation of compound 33(S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide

[0507] Figure 46 This is a schematic diagram of exemplary steps for preparing compound 33 according to some embodiments of this application.

[0508] T3P (5.83 g, 9.16 mmol) and DIEA (1.18 g, 9.16 mmol) were added to a DCM (20 mL) solution of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propionamide (1.6 g, 4.58 mmol) and 5-tert-butyl-2-cyclopropylpyrazole-3-carboxylic acid (954 mg, 4.58 mmol). The reaction mixture was stirred at 25 °C under N2 for 3 hours. The reaction mixture was concentrated and the residue was purified by silica gel column chromatography (PE:EA = 1:1) to give the desired product compound 33 (1.3 g, 47%) as a yellow solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 539.1 541.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.17 (s, 1H), 8.84 (d, J = 8.0Hz, 1H), 8.00 (d, J = 1.7Hz, 1H), 7.64 (d, J = 8.4Hz, 1H), 7.52 (dd, J = 8.4, 1.8Hz, 1H), 6.68 (s, 1H), 4.99-4.88(m, 1H), 4.26-4.13(m, 1H), 3.49(dd, J=15.4, 5.8Hz, 1H) , 3.34-3.29(m, 1H), 1.55-1.39(m, 2H), 1.20(s, 9H), 1.13-0.80(m, 6H).

[0509] Example 3.34: Preparation of compound 34(S)-N-((3-(6-(6-aminopyridin-3-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide

[0510] Figure 47 This is a schematic diagram illustrating exemplary steps for preparing compound 34 according to some embodiments of this application.

[0511] In a solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl))-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide (150 mg, 0.28 mmol) and (6-aminopyridin-3-yl)boronic acid (58 mg, 0.42 mmol) in dioxane (3 mL) and H₂O (0.3 mL), K₃PO₄ (118 mg, 0.56 mmol) and Pd(dppf)Cl₂ (20 mg, 0.028 mmol) were added. The reaction mixture was stirred at 90 °C under N₂ for 10 hours. The reaction mixture was concentrated and the residue was purified by preparative TLC (DCM:MeOH = 20:1) to give the desired product compound 34 (120 mg, 72%) as a brown solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 553.3 [M+H] + . 1 HNMR (400MHz, DMSO-d6) δ9.08 (s, 1H), 8.75 (d, J = 8.0Hz, 1H), 8.25 (d, J = 2.2Hz, 1H), 7.80 (d, J = 1.2Hz, 1H), 7 .71 (dd, J=8.6, 2.4Hz, 1H), 7.62 (d, J=8.2Hz, 1H), 7.50 (dd, J=8.2, 1.6Hz, 1H), 6.65 (s, 1H), 6.49 (d, J=8.6Hz , 1H), 6.07 (s, 2H), 4.96-4.85 (m, 1H), 4.21-4.13 (m, 1H), 3.45 (dd, J=15.6, 5.8Hz), 1H), 3.30-3.24 (m, 1H), 1.49-1.38 (m, 2H), 1.16 (s, 9H), 1.12-1.05 (m, 2H), 1.01-0.96 (m, 1H), 0.93-0.88 (m, 1H), 0.83-0.76 (m, 2H).

[0512] Example 3.35: Preparation of compound 35(S)-N-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0513] Figure 48 This is a schematic diagram illustrating exemplary steps for preparing compound 35 according to some embodiments of this application.

[0514] Step 1: Preparation of N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(cyanomethyl)carbamoyl]ethyl]tert-butyl carbamate

[0515] 2-Aminoacetonitrile (0.69 g, 7.5 mmol), DIEA (2.91 g, 22.5 mmol), and HATU (5.70 g, 15 mmol) were added to a solution of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-{[(tert-butoxy)carbonyl]amino}propionic acid (2.90 g, 7.5 mmol) in DMF (30.0 mL). The reaction mixture was stirred at room temperature for 2 hours. Water (100 mL) was added and the reaction mixture was extracted with EA (100 mL × 3). The compound was washed with brine (100 mL × 3), dried over Na₂SO₄, and concentrated under negative pressure. The residue was purified by rapid column chromatography (PE:EA = 0-50%) to give the desired product, tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(cyanomethyl)carbamoyl]ethyl]carbamate (2.7 g, 76%), as a white solid. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 423.0 [M+H] + .

[0516] Step 2: Preparation of tert-butyl(S)-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)carbamate

[0517] To a solution of tert-butyl (S)-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((cyanomethyl)amino)-1-oxopropane-2-yl)carbamate (1400 mg, 3.31 mmol) in dioxane / H₂O (10 / 1, 30 mL), (2-methylpyridin-4-yl)boronic acid (679 mg, 4.96 mmol), K₃PO₄ (2103 mg, 9.92 mmol), and 1,1-bis(diphenylphosphino)ferrocene palladium dichloride (242 mg, 0.33 mmol) were added. The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The solvent was removed under negative pressure, and the residue was purified by combined flash chromatography (PE / EA = 0–80%) to produce a product as a brown solid (840 mg, 58%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 436.1 [M+H] + .

[0518] Step 3: Preparation of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propionamide

[0519] TMSI (907 mg, 4.54 mmol) was added to a MeCN (15 mL) solution of tert-butyl(S)-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)carbamate (790 mg, 1.81 mmol). The reaction mixture was stirred at room temperature under N2 for 0.5 h. H2O (50 mL) was added to the reaction mixture, and the pH was adjusted to 8 using saturated NaHCO3. Extraction was performed using EA (50 mL × 3). The composite organic layer was washed with brine (30 mL × 2) and then dried with anhydrous Na2SO4 to give a product as a yellow solid (550 mg, 58%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 336.2 [M+H] + .

[0520] Step 4: Preparation of (S)-N-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0521] 2-Cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid (80 mg, 0.39 mmol), DIEA (250 mg, 1.94 mmol), and HATU (370 mg, 1.16 mmol) were added to a DMF (10 mL) solution of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)phenylpropionate[d]oxazol-2-yl)propionamide (130 mg, 0.39 mmol). The reaction mixture was stirred at room temperature under N2 for 2 hours. After the reaction was complete, H2O (30 mL) was added to the reaction mixture, and the mixture was then extracted with EA (30 mL × 3). The composite organic layer was washed with brine (50 mL × 2) and then dried with anhydrous Na2SO4. After filtration, the solution was concentrated under vacuum, and the residue was purified by combined flash chromatography (DCM / MeOH = 0–10%) to obtain the desired product compound 35 (140 mg, 68%) as a white solid. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 523.9 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ8.86 (t, J=6.8Hz, 2H), 8.51 (d, J=5.4Hz, 1H), 8.14 (s, 1H), 7.78 (s, 2H), 7.67 ( s, 1H), 7.58 (d, J=5.2Hz, 1H), 6.61 (s, 1H), 5.09 (d, J=5.4Hz, 1H), 4.21 (dd, J=7.6, 3.8Hz, 1H), 4.17 (d d, J = 5.6, 2.0 Hz, 2H), 3.59 (dd, J = 15.6, 5.4 Hz, 1H), 3.42-3.36 (m, 1H), 2.54 (s, 3H), 1.33 (s, 3H), 1.01 (dd, J = 6.3, 3.8 Hz, 1H), 0.91 (dd, J = 10.0, 6.2 Hz, 1H), 0.85-0.74 (m, 4H), 0.68 (dd, J = 6.2, 3.8 Hz, 2H). Example 3.36: Preparation of compound 36(S)-2-((3-bromophenyl)sulfonamide)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazole-2-yl)propionamide

[0522] Figure 49 This is a schematic diagram illustrating exemplary steps for preparing compound 36 according to some embodiments of this application.

[0523] 3-bromobenzenesulfonyl chloride (60 mg, 0.24 mmol) and TEA (73 mg, 0.72 mmol) were added to a solution of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propionamide (80 mg, 0.24 mmol) in DCM (5 mL) at 0 °C. The reaction mixture was stirred at room temperature under N2 for 3 hours. The resulting mixture was concentrated. The residue was purified by preparative TLC (DCM / MeOH = 20 / 1) to give the desired product compound 36(S)-2-((3-bromophenyl)sulfonylamino)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propionamide (20 mg, 15%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 554.0 [M+H] + . 1H NMR (400MHz, MeOD) δ8.48 (d, J=5.4Hz, 1H), 7.88-7.83 (m, 2H), 7.74 (dd, J=8.2, 1.6Hz, 1H), 7.69-7.62 (m, 3H), 7.59 (d, J=5.4Hz, 1H), 7.42-7.38 ( m, 1H), 7.16 (t, J=7.8Hz, 1H), 4.49 (dd, J=9.6, 5.0Hz, 1H), 4.14 (s, 2H), 3.41 (dd, J=15.4, 5.0Hz, 1H), 3.21 (dd, J=15.4, 9.6Hz, 1H), 2.63 (s, 3H).

[0524] Example 3.37: Preparation of compound 37(S)-2-((3-chlorophenyl)sulfonamide)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propionamide

[0525] Figure 50 This is a schematic diagram illustrating exemplary steps for preparing compound 37 according to some embodiments of this application.

[0526] 3-Chlorobenzenesulfonyl chloride (50 mg, 0.24 mmol) and TEA (73 mg, 0.72 mmol) were added to a solution of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propionamide (80 mg, 0.24 mmol) in DCM (5 mL) at 0 °C. The reaction mixture was stirred at room temperature under N2 for 3 hours. The resulting mixture was concentrated. The residue was purified by preparative TLC (DCM / MeOH = 20 / 1) to give the desired product compound 37(S)-2-((3-chlorophenyl)sulfonylamino)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propionamide (30 mg, 20%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 510.0 [M+H] + . 1H NMR (400MHz, MeOD) δ8.48 (d, J=5.4Hz, 1H), 7.86 (d, J=1.2Hz, 1H), 7.75-7.69 (m, 2H), 7.66 (d, J=8.4Hz, 2H), 7.60 (dt, J=10.6, 2.8Hz, 2H), 7.25 (t, J=4.6Hz, 2H), 4.49 (dd, J=9.4, 5.0Hz, 1H), 4.13 (s, 2H), 3.41 (dd, J=15.4, 5.0Hz, 1H), 3.21 (dd, J=15.4, 9.4Hz, 2H), 2.63 (s, 3H).

[0527] Example 3.38: Preparation of compound 38(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0528] Figure 51 This is a schematic diagram illustrating exemplary steps for preparing compound 38 according to some embodiments of this application.

[0529] Step 1 (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}acrylamide

[0530] DIEA (504 mg, 3.90 mmol) and T3P (50% in EA, 1.65 g, 2.60 mmol) were added to a DCM (10.0 mL) solution of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl) (454 mg, 1.30 mmol) and 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid (295 mg, 1.43 mmol) respectively. The reaction was stirred at room temperature for 16 hours. The solution was diluted with water (100 mL). The reaction mixture was extracted with EA (100 mL × 3). The composite organic layer was washed with NaHCO3 (100 mL × 3) and brine (100 mL), dried with Na2SO4, and concentrated under negative pressure. The residue was purified by rapid column chromatography (PE:EA = 0-60%) to give the product (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl))-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}propionamide (360 mg, 49%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 537.1 [M+H]+.1 HNMR (400MHz, MeOD) δ7.83 (d, J=1.6Hz, 1H), 7.54 (dt, J=8.4, 5.2Hz, 2H), 6.51 ( s, 1H), 5.04 (dd, J=8.2, 6.2Hz, 1H), 4.01-3.89 (m, 1H), 3.59 (dd, J=15.4, 6.2Hz , 1H), 3.43 (dd, J=15.4, 8.2Hz, 1H), 1.57-1.46 (m, 2H), 1.40 (s, 3H), 1.23 (td, J =12.6, 4.6Hz, 2H), 1.11-1.05 (m, 1H), 1.02-0.80 (m, 5H), 0.70 (q, J = 4.0Hz, 2H).

[0531] Step 2: Preparation of (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0532] A solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (300 mg, 0.56 mmol) in dioxane / H₂O (10 / 1, 15 mL) was mixed with (2-methylpyridin-4-yl)boronic acid (77 mg, 0.56 mmol), K₃PO₄ (237 mg, 1.12 mmol), and 1,1'-bis(diphenylphosphino)ferrocene palladium dichloride (45 mg, 0.06 mmol). The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The resulting mixture was concentrated. The residue was purified by preparative TLC (DCM / MeOH = 20 / 1) to obtain the desired product compound 38(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (208 mg, 68%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 550.2 [M+H] + . 1H NMR (400MHz, MeOD) δ8.46 (d, J=5.2Hz, 1H), 8.00 (s, 1H), 7.76 (d, J=0.9Hz, 2H), 7.65 (s, 1H), 7.56 (d, J=5.2Hz, 1H), 6.51 (s, 1H), 5.15-5.01 (m, 1H), 3.97-3.94 (m, 1H), 3.653.60 (m, 1H), 3.49-3.43 (m, 1H)), 2.61 (s, 3H), 1.50 (d, J=3.0Hz, 2H), 1.38 (s, 3H), 1.26-1.19 (m, 2H), 1.09-1.02 (m, 1H), 0.96-0.93 (m, 1H), 0.90-0.79 (m, 4H), 0.68 (q, J=4.0Hz, 2H).

[0533] Example 3.39: Preparation of compound 39(2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}-3-{6-[6-(dimethylamino)pyridin-3-yl]-1,3-benzoxazole-2-yl}propionamide

[0534] Figure 52 This is a schematic diagram of exemplary steps for preparing compound 39 according to some embodiments of this application.

[0535] A solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (80 mg, 0.1489 mmol) in dioxane / H₂O (10 / 1, 2 mL) was supplemented with (6-(dimethylamino)pyridin-3-yl)boronic acid (37 mg, 0.223 mmol), K₃PO₄ (63 mg, 0.297 mmol), and 1,1'-bis(diphenylphosphino)ferrocene palladium dichloride (7 mg, 0.089 mmol). The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The solvent was removed under negative pressure, and the residue was purified by preparative HPLC [Gemini-C18, 150×21.2mm, 5µm; ACN-H2O (0.1% FA), 25-50] to obtain the desired product compound 39 (25mg, 27%) as a white solid. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 579.0 [M+H] +. 1H NMR (400MHz, DMSO-d6) δ9.12 (s, 1H), 8.77 (d, J = 7.8Hz, 1H), 8.48 (d, J = 2.2Hz, 1H), 7.90 (s, 1H), 7. 68 (d, J=8.2Hz, 1H), 7.59 (d, J=8.2Hz, 1H), 6.75 (d, J=8.6Hz, 1H), 6.61 (s, 1H), 4.94 (dd, J=14.0, 8 .2Hz, 1H), 4.24-4.12 (m, 1H), 3.48 (dd, J=15.4, 5.6Hz, 1H), 3.07 (d, J=9.8Hz, 6H), 1.48 (d, J=2.4H z, 2H), 1.34 (s, 3H), 1.23 (s, 1H), 1.11 (q, J=10.6Hz, 2H), 1.04-0.97 (m, 1H), 0.97-0.89 (m, 1H), 0.8 5-0.77 (m, 4H), 0.68 (dd, J=6.0, 3.8Hz, 2H).

[0536] Example 3.40: Preparation of compound 40(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0537] Figure 53 This is a schematic diagram illustrating exemplary steps for preparing compound 40 according to some embodiments of this application.

[0538] To a solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (100 mg, 0.18 mmol) in dioxane / H₂O (10 / 1, 10 mL), 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-2-yl)-1,2,3,6-tetrahydropyridine (51 mg, 0.18 mmol), K₃PO₄ (76 mg, 0.36 mmol), and 1,1'-bis(diphenylphosphino)ferrocene palladium dichloride (16 mg, 0.02 mmol) were added. The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The resulting mixture was concentrated. The residue was purified by preparative TLC (DCM / MeOH = 10 / 1) to obtain the desired product compound 40(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (8 mg, 7%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 604.1 [M+H] + . 1H NMR (400MHz, MeOD) δ7.64 (s, 1H), 7.59 (d, J = 8.4Hz, 1H), 7.49 (d, J = 8.4Hz, 1H), 6.51 (s, 1H), 6.20 (d, J = 4.2Hz, 1H ), 5.99 (dt, J=55.8, 4.2Hz, 1H), 5.04 (dd, J=8.2, 6.2Hz, 1H), 3.94 (td, J=7.4, 3.8Hz, 1H), 3.59 (dd, J=15.2, 6.2Hz , 1H), 3.43 (dd, J=15.2, 8.4Hz, 1H), 3.37-3.34 (m, 2H), 2.99-2.87 (m, 3H), 2.65 (s, 2H), 1.49 (t, J=8.2Hz, 2H), 1.4 0 (s, 3H), 1.31 (s, 1H), 1.30-1.15 (m, 2H), 1.06 (dt, J=8.2, 5.2Hz), 1H), 1.00-0.77 (m, 5H), 0.70 (q, J=3.8Hz, 2H).

[0539] Example 3.41: Preparation of compound 41(2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}-3-[6-(6-acetamidopyridin-3-yl)-1,3-benzoxazole-2-yl]propionamide

[0540] Figure 54 This is a schematic diagram illustrating exemplary steps for preparing compound 41 according to some embodiments of this application.

[0541] Step 1 (S)-N-(3-(6-(6-aminopyridin-3-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0542] A solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (300 mg, 0.56 mmol) in dioxane / H₂O (10 / 1, 15 mL) was mixed with (6-aminopyridin-3-yl)boronic acid (77 mg, 0.56 mmol), K₃PO₄ (237 mg, 1.12 mmol), and 1,1'-bis(diphenylphosphino)ferrocene palladium dichloride (45 mg, 0.06 mmol). The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The resulting mixture was concentrated. The residue was purified by preparative TLC (DCM:MeOH = 10:1) to give a product as a white solid (140 mg, 45%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 551.0 [M+H]+. ¹H NMR (400MHz, DMSO-d6) δ 9.12 (s, 1H), 8.76 (d, J = 8.0Hz, 1H), 8.29 (d, J = 2.4Hz, 1H), 7.85 (s, 1H), 7.77 (dd, J = 8.6, 2.4Hz, 1H), 7.66 (d, J = 8.2Hz, 1H), 7.54 (dd, J = 8.4, 1.4Hz, 1H), 6.61 (s, 1H), 6.55 (d, J = 8.6Hz, 1H), 6 .17 (s, 2H), 4.93 (dd, J=14.2, 8.4Hz, 1H), 4.26-4.12 (m, 1H), 3.48 (dd, J=15.6, 5.8Hz), 1H), 3.29 (s, 1H), 1 .51-1.44(m, 2H), 1.34(s, 3H), 1.12-1.07(m, 2H), 1.04-0.98(m, 1H), 0.95-0.89(m, 1H), 0.88-0.75(m, 4H).

[0543] Step 2: Preparation of (2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}-3-[6-(6-acetamidopyridin-3-yl)-1,3-benzoxazole-2-yl]propionamide

[0544] Acetoacetate (16 mg, 0.163 mmol) was added to a pyridine (1 mL) solution of (2S)-3-[6-(6-aminopyridin-3-yl)-1,3-benzoxazol-2-yl]-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl]-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}acrylamide (45 mg, 0.081 mmol). The reaction was stirred at room temperature under N2 for 18 hours. The solvent was removed under negative pressure, and the residue was subjected to preparative HPLC [Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-H2O (0.1% FA), 15-40] to give the desired product compound 41 (15 mg, 29%) as a white solid. The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 593.0 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ10.58 (s, 1H), 9.08 (s, 1H), 8.73 (d, J = 8.0Hz, 1H), 8.65 (d, J = 1.8Hz, 1H), 8.11 (d, J = 2.4H z, 2H), 8.00 (d, J=1.4Hz, 1H), 7.67 (dt, J=8.4, 5.0Hz, 2H), 6.57 (s, 1H), 4.91 (td, J=8.2, 5.8Hz, 1H), 4.26-4.04 ( m, 1H), 3.51-3.42 (m, 1H), 3.30 (dd, J=15.6, 8.8Hz, 1H), 2.08 (s, 3H), 1.47-1.41 (m, 2H), 1.30 (m, 3H), 1.23-1.19 (m, 3H), 1.14-1.02 (m, 2H), 0.99-0.94 (m, 1H), 0.91-0.86 (m, 1H), 0.84-0.72 (m, 5H), 0.64 (dd, J=6.2, 3.8Hz, 2H).

[0545] Example 3.42: Preparation of compound 42(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0546] Figure 55 This is a schematic diagram of exemplary steps for preparing compound 42 according to some embodiments of this application.

[0547] A solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (150 mg, 0.28 mmol) in dioxane / H₂O (10:1, 10 mL) was mixed with (6-methylpyridin-3-yl)boronic acid (57 mg, 0.42 mmol), K₃PO₄ (118 mg, 0.56 mmol), and 1,1'-bis(diphenylphosphino)ferrocene palladium dichloride (20 mg, 0.03 mmol). The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The resulting mixture was concentrated to give the crude product. The residue was purified by preparative TLC (DCM / MeOH = 20 / 1) to obtain the desired product compound 42(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridinyl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (70 mg, 45%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 550.2 [M+H]+. 1 H NMR (400MHz, DMSO-d6) δ9.12 (s, 1H), 8.80 (dd, J=14.0, 5.2Hz, 2H), 8.06-8.00 (m, 2H), 7.76 (d, J=8.4H z, 1H), 7.68 (dd, J=8.4, 1.6Hz, 1H), 7.36 (d, J=8.2Hz, 1H), 6.61 (s, 1H), 4.95 (d, J=5.8Hz, 1H), 4.19 (d , J=3.8Hz, 1H), 3.49 (d, J=5.8Hz, 1H), 3.37 (d, J=8.8Hz, 1H), 1.48 (d, J=2.4Hz, 2H), 1.34 (s, 3H), 1.12 (d, J=10.8Hz, 2H), 1.00 (s, 1H), 0.93 (s, 1H), 0.80 (dd, J=5.6, 3.8Hz, 4H), 0.68 (dd, J=6.2, 3.8Hz, 2H).

[0548] Example 3.43: Preparation of compound 43(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-(ethylamino)pyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0549] Figure 56This is a schematic diagram of exemplary steps for preparing compound 43 according to some embodiments of this application.

[0550] Step 1: Preparation of (6-(ethylamino)pyridin-3-yl)boronic acid

[0551] To a solution of 5-bromo-N-ethylpyridin-2-amine (100 mg, 0.5 mmol) in dioxane (10 mL), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bis(1,3,2-dioxoborane) (190 mg, 0.75 mmol), KOAc (98 mg, 1 mmol), and Pd(dppf)Cl2 (40 mg, 0.05 mmol) were added. The reaction mixture was stirred at 90 °C under N2 for 16 hours. The solvent was removed under negative pressure to give a crude product of (6-(ethylamino)pyridin-3-yl)boronic acid (90 mg, purity: 60%), which is a yellow oil. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 167.3 [M+H] + .

[0552] Step 2: Preparation of (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-(ethylamino)pyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0553] To a solution of S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropane-2-yl)-1-, cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (100 mg, 0.19 mmol) in dioxane / H₂O (10:1, 10 mL) was added (6-(ethylamino)pyridin-3-yl)boronic acid (46 mg, 0.28 mmol), K₃PO₄ (79 mg, 0.38 mmol), and Pd(dppf)Cl₂ (14 mg, 0.02 mmol). The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The solvent was removed under negative pressure, and the residue was purified by combined flash chromatography (DCM / MeOH = 0–10%) to obtain the desired product compound 43(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-(ethylamino)pyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (43 mg, 39%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 579.2 [M+H] + . 1H (400MHz, MeOD) δ8.23 (d, J=2.2Hz, 1H), 7.78-7.72 (m, 2H), 7.67 (d, J=8.4Hz, 1H), 7.54 (dd, J=8.2, 1.6Hz, 1H), 6.6 3(d, J=8.8Hz, 1H), 6.52 (s, 1H), 5.06 (dd, J=8.4, 6.0Hz, 1H), 4.00-3.92 (m, 1H), 3.61 (dd, J=15.2, 6.2Hz, 1H), 3.45 (dd, J=15.4, 8.4Hz, 1H), 3.40-3.35 (m, 2H), 1.51 (d, J=2.8Hz, 2H), 1.39 (s, 3H), 1.28 (d, J=7.2Hz, 3H), 1.25-1.16 ( m, 2H), 1.10-1.03 (m, 1H), 0.97 (dd, J=10.0, 6.0Hz, 1H), 0.88 (ddd, J=13.6, 8.6, 4.0Hz, 4H), 0.69 (q, J=4.0Hz, 2H).

[0554] Example 3.44: Preparation of compound 44(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-2-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0555] Figure 57 This is a schematic diagram illustrating exemplary steps for preparing compound 44 according to some embodiments of this application.

[0556] Step 1: Preparation of (S)-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-2-yl)benzo[d]oxazol-2-yl)propyl-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0557] To a solution of (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (500 mg, 0.93 mmol) in dioxane (15 mL), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxoborane-2-yl)-1,3,2-dioxoborane (354 mg, 1.39 mmol), KOAc (183 mg, 1.86 mmol), and Pd(dppf)Cl2 (68 mg, 0.09 mmol) were added. The reaction mixture was stirred at 90 °C under N2 for 16 hours. The solvent was removed under negative pressure, and the residue was purified by combined flash chromatography (DCM / MeOH = 0–5%) to obtain the product (S)-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-2-yl)benzo[d]oxazol-2-yl)propyl-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (400 mg, 73%), as a brown oil. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 585.3 [M+H] + .

[0558] Step 2: Preparation of (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-2-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0559] In a solution of (S)-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-)2-yl)benzo[d]oxazol-2-yl)propyl-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (40 mg, 0.07 mmol), 2-bromo-6-methylpyridine (13 mg, 0.07 mmol), K3PO4 (33 mg, 0.14 mmol), and Pd(dppf)Cl2 (6 mg, 0.01 mmol) were added to (S)-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-)2-yl)benzo[d]oxazol-2-yl)propyl-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (40 mg, 0.07 mmol), dioxane / H2O (10:1, 5 mL), and 2-bromo-6-methylpyridine (13 mg, 0.07 mmol), K3PO4 (33 mg, 0.14 mmol), and Pd(dppf)Cl2 (6 mg, 0.01 mmol). The reaction mixture was stirred at 90 °C under N2 for 16 hours. The solvent was removed under negative pressure, and the residue was purified by combined flash chromatography (DCM / MeOH = 0–10%) to obtain the desired product compound 44(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-2-yl)benzo[d]oxazol-2-yl)-1-oxopropyl-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (4 mg, 10%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 550.2 [M+H] + . 1 HNMR (400MHz, MeOD) δ8.18 (d, J=1.2Hz, 1H), 7.97 (dd, J=8.4, 1.6Hz, 1H), 7.77 (d, J=7.6Hz, 1H), 7.70 (d d, J=17.6, 8.2Hz, 2H), 7.24 (d, J=7.6Hz, 1H), 6.51 (s, 1H), 5.06 (dd, J=8.4, 6.2Hz, 1H), 3.98-3.92 (m, 1H ), 3.60 (s, 1H), 3.48 (d, J = 8.4Hz, 1H), 2.61 (s, 3H), 1.49 (d, J = 2.8Hz, 2H), 1.38 (s, 3H), 1.24-1.18 (m, 2 H), 1.07-1.01 (m, 1H), 0.96 (dd, J=10.0, 6.0Hz, 1H), 0.88 (dt, J=9.8, 5.2Hz, 4H), 0.68 (q, J=4.0Hz, 2H).

[0560] Example 3.45: Preparation of compound 45(2S)-2-[(5-tert-butyl-2-cyclopropylpyrazole-3-yl)formamide]-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}propionamide

[0561] Figure 58This is a schematic diagram of exemplary steps for preparing compound 45 according to some embodiments of this application.

[0562] Step 1: Preparation of 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxoborane-2-yl)-3,6-dihydro-2H-pyridine

[0563] DIEA (1.58 g, 12.2 mmol) and 1-bromo-2-methoxyethane (623 mg, 4.48 mmol) were added to a DMF (15.0 mL) solution of 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyclopentan-2-yl)-1,2,3,6-tetrahydropyridine (1.0 g, 4.07 mmol). The reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was diluted with water (50 mL) and then extracted with EA (50 mL × 3). The composite organic layer was washed with brine (100 mL × 3), dried over Na₂SO₄, and concentrated under negative pressure. The residue was purified by rapid column chromatography (DCM:MeOH = 15:1) to obtain the desired product, 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhexacyclopentan-2-yl)-3,6-dihydro-2H-pyridine (1.5 g, 96.5%), as a colorless oil. Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 268.2 [M+H] + .

[0564] Step 2: Preparation of tert-butyl N-[(1S)-1-[(cyanomethyl)carbamoyl]-2-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}ethyl]carbamate

[0565] A solution of 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxoron-2-yl)-3,6-dihydro-2H-pyridine (196 mg, 0.732 mmol) in 1,4-dioxane / H₂O (10:1, 11.0 mL) was prepared by adding tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(cyanomethyl)carbamoyl]ethyl]carbamate (310 mg, 0.732 mmol), K₂CO₃ (304 mg, 2.20 mmol), and Pd(dppf)Cl₂ (59.8 mg, 0.0732 mmol). The reaction mixture was stirred at 90 °C for 6 hours under N₂. The reaction mixture was filtered and the filtrate was concentrated under negative pressure. The residue was diluted with water (20 mL) and then extracted with EA (20 mL × 3). The composite organic layer was washed with brine (50 mL × 2), dried over Na₂SO₄, and concentrated under negative pressure. The residue was purified by rapid column chromatography (DCM:MeOH = 20:1) to give a white solid product, tert-butyl N-[(1S)-1-[(cyanomethyl)carbamoyl]-2-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}ethyl]carbamate (150 mg, 42%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 484.2 [M+H] + .

[0566] Step 3: Preparation of (2S)-2-amino-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}propionamide

[0567] A solution of tert-butyl N-[(1S)-1-[(cyanomethyl)carbamoyl]-2-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}ethyl]carbamate (150 mg, 0.310 mmol) in MeCN (5.0 mL) was added to TMSI (155 mg, 0.776 mmol). The reaction solution was stirred at room temperature for 0.5 h. The reaction mixture was concentrated under negative pressure to give a brown solid product (2S)-2-amino-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}propionamide (100 mg, 75.7%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 384.2 [M+H] + .

[0568] Step 4: Preparation of (2S)-2-[(5-tert-butyl-2-cyclopropylpyrazole-3-yl)carboxamide]-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}propionamide

[0569] To a DMF (5.0 mL) solution of the above mixture (120 mg, 0.248 mmol), 5-tert-butyl-2-cyclopropylpyrazole-3-carboxylic acid (62 mg, 0.298 mmol), DIEA (96 mg, 0.745 mmol), and HATU (189 mg, 0.496 mmol) were added. The reaction solution was stirred at room temperature for 2 hours. The reaction mixture was diluted with water (20 mL) and then extracted with EA (20 mL × 3). The composite organic layer was washed with brine (50 mL × 3), dried over Na₂SO₄, and concentrated under negative pressure. The residue was purified by preparative TLC (DCM:MeOH = 15:1) to obtain the desired product compound 45(2S)-2-[(5-tert-butyl-2-cyclopropylpyrazole-3-yl)carboxamide]-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}propionamide (15 mg, 10%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 547.8 [M+H] + . 1 H NMR (400MHz, CDCl3) δ8.12 (d, J=6.8Hz, 1H), 8.01 (t, J=5.6Hz, 1H), 7.57 (d, J=8.2Hz, 1H), 7.51 (s, 1H), 7.39 (d, J=8.4Hz, 1H), 6.55 (s, 1H), 6.08 (s, 1H), 5.19 (dd, J=11.0, 6.8Hz, 1H), 4.18 (t, J=4.6Hz, 2H), 3.75-3.67 (m, 2H), 3.68 (d, J = 4.0Hz, 1H), 3.53 (s, 2H), 3.39 (s, 3H), 3.33 (dd, J = 16.8, 6.8)Hz, 1H), 3.07 (s, 2H), 2.97 ( s, 2H), 2.77 (s, 2H), 1.43-1.39 (m, 1H), 1.27 (d, J=12.2Hz, 9H), 1.01 (d, J=8.0Hz, 2H), 0.88 (t, J=6.8Hz, 2H).

[0570] Example 3.46: Preparation of compound 46(2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}propionamide

[0571] Figure 59 This is a schematic diagram illustrating exemplary steps for preparing compound 46 according to some embodiments of this application.

[0572] A solution of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)-2-{[a mixture of pyrazol-3-yl[2-cyclopropyl-5-(1-methylcyclopropyl)]formamide}propionamide (200 mg, 0.372 mmol) and 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborane-2-yl)-3,6-dihydro-2H-pyridine (249 mg, 0.931 mmol) in dioxane / H₂O (10:1, 11 mL) was prepared with K₃PO₄ (158 mg, 0.744 mmol) and Pd(dppf)Cl₂ (30 mg, 0.037 mmol). The reaction solution was stirred under N₂ at 90 °C for 16 hours. The reaction mixture was filtered and the filtrate was extracted with H₂O (100 mL) and EtOAc (50 × 3 mL). The composite organic layer was washed with brine (100 mL), dried over Na₂SO₄, and concentrated under negative pressure. The crude product was purified by SFC [column: chiral column; mobile phase: CO₂-IPA(DEA)] to give the target compound 46(2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]carboxamide}-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazole-2-yl}propionamide (25 mg, 11%). The obtained compound was analyzed by mass spectrometry, and the results are as follows: Mass (m / z): 598.2 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.10 (s, 1H), 8.75 (d, J = 8.0Hz, 1H), 7.70 (s, 1H), 7.61 (d, J = 8.4Hz, 1H), 7.45 ( d, J=8.4Hz, 1H), 6.59 (s, 1H), 6.22 (s, 1H), 4.92 (dd, J=14.0, 8.2Hz, 1H), 4.20-4.16 (m, 1H), 3.54 (s, 2 H), 3.47 (dd, J=15.6, 5.8Hz, 1H), 3.28 (s, 3H), 3.33 (s, 3H), 2.79 (s, 3H), 2.59 (s, 2H), 1.49-1.45 (m, 2 H), 1.34 (s, 3H), 1.14-0.98 (m, 3H), 0.94-0.89 (m, 1H), 0.86-0.77 (m, 4H), 0.68 (dd, J=6.2, 3.8Hz, 2H).

[0573] Example 3.47: Preparation of compound 47(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-(difluoromethyl)pyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0574] Figure 60 This is a schematic diagram illustrating exemplary steps for preparing compound 47 according to some embodiments of this application.

[0575] To a solution of (S)-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborane)2-yl)benzo[d]oxazol-2-yl)propyl-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (100 mg, 0.17 mmol) in dioxane / H₂O (10:1, 10 mL), 4-bromo-2-(difluoromethyl)pyridine (43 mg, 0.17 mmol), K₃PO₄ (73 mg, 0.34 mmol), and Pd(dppf)Cl₂ (14 mg, 0.02 mmol) were added. The reaction mixture was stirred at 90 °C under N₂ for 16 hours. The solvent was removed under negative pressure, and the residue was purified by combined flash chromatography (DCM / MeOH = 0–10%) to obtain the desired compound 47(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-(difluoromethyl)pyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropyl-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (7 mg, 7%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 586.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.15 (s, 1H), 8.79 (dd, J=19.8, 6.6Hz, 2H), 8.26 (s, 1H), 8.06 (s, 1H), 7.98 (d, J=4.8Hz, 1H), 7.90-7.80 (m, 2H), 7.02 (t, J=54.8Hz, 1H), 6.61 (s, 1H), 4.97 (d, J=6.0 Hz, 1H), 4.23-4.15 (m, 1H), 3.52 (d, J=5.6Hz, 1H), 3.41-3.35 (m, 1H), 1.48 (s, 2H), 1.33 (s, 3H ), 1.12 (d, J=10.4Hz, 2H), 1.04-0.89 (m, 2H), 0.86-0.74 (m, 4H), 0.68 (dd, J=6.2, 3.8Hz, 2H).

[0576] Example 3.48: Preparation of compound 48(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-cyclopropylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide

[0577] Figure 61 This is a schematic diagram of exemplary steps for preparing compound 48 according to some embodiments of this application.

[0578] 4-Bromo-2-cyclopropylpyridine (51 mg, 0.26 mmol), K3PO4 (109 mg, 0.51 mmol), and Pd(dppf)Cl2 (19 mg, 0.03 mmol) were added to a solution of (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-cyclopropylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (150 mg, 0.26 mmol) in dioxane / H2O (10:1, 10 mL). The reaction mixture was incubated under N2 at 90 °C and stirred for 16 hours. The solvent was removed under negative pressure, and the residue was purified by combined flash chromatography (DCM / MeOH = 0–10%) to obtain the desired compound 48(S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-cyclopropylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropane-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (32 mg, 21%). Mass spectrometry analysis of the obtained compound yielded the following results: Mass (m / z): 576.3 [M+H] + . 1 H (400MHz, MeOD) δ8.40 (d, J=5.2Hz, 1H), 7.99 (s, 1H), 7.76 (d, J=1.0Hz, 2H), 7.54 (d, J=1.2Hz, 1H), 7.4 7 (dd, J=5.2, 1.8Hz, 1H), 6.51 (s, 1H), 5.06 (dd, J=8.4, 6.2Hz, 1H), 3.98-3.92 (m, 1H), 3.63 (dd, J=15.4 , 6.2Hz, 1H), 3.46 (dd, J=15.4, 8.4Hz, 1H), 2.21-2.16 (m, 1H), 1.49 (t, J=6.2Hz, 2H), 1.38 (s, 3H), 1.24 -1.18 (m, 2H), 1.09-1.05 (m, 2H), 1.03 (dd, J=4.6, 2.8Hz, 2H), 0.98-0.78 (m, 6H), 0.68 (q, J=4.0Hz, 2H).

[0579] Having described the basic concepts thus, it will be quite apparent to those skilled in the art, upon reading this detailed disclosure, that the foregoing detailed disclosure is intended to be illustrative only and not restrictive. Various changes, modifications, and alterations may be made, and such changes, modifications, and alterations are intended for those skilled in the art, although not expressly stated herein. These changes, modifications, and alterations are intended to be proposed by this application and are within the spirit and scope of the exemplary embodiments of this application.

[0580] Furthermore, this application uses specific terms to describe its embodiments. For example, "an embodiment," "one embodiment," and / or "some embodiments" refer to a particular feature, structure, or characteristic related to at least one embodiment of this application. Therefore, it should be emphasized and noted that "an embodiment," "one embodiment," or "an alternative embodiment" mentioned twice or more in different locations in this specification do not necessarily refer to the same embodiment. In addition, certain features, structures, or characteristics in one or more embodiments of this application can be appropriately combined.

[0581] Furthermore, the order of description of the elements or sequences, or the use of numbers, letters, or other names, is not intended to limit the claimed processes and methods to any order unless otherwise specified in the claims. While the foregoing disclosure has discussed by way of various examples what are currently considered useful embodiments of the present application, it should be understood that such details are for that purpose only and that the appended claims are not limited to the disclosed embodiments, but rather are intended to cover modifications and equivalent arrangements within the spirit and scope of the disclosed embodiments. For example, while the implementation of the various components described above can be embodied in a hardware device, it can also be implemented as a purely software solution, such as installed on an existing server or mobile device.

[0582] Similarly, it should be understood that in the foregoing description of embodiments of this application, various features are sometimes combined in a single embodiment, drawing, or description therein to simplify the application and thereby aid in understanding one or more various embodiments. However, this approach to disclosure should not be construed as reflecting an intention to require more features than expressly recited in each claim. Rather, the subject matter of the claims does not consist of all the features of a single foregoing disclosed embodiment.

Claims

1. A compound represented by formula (Ia), (I-a), in, R1 and R2 are independently selected from H, or R1 and R2 are -CH2- and connected by a single bond; W stands for CO; R3 is a group represented by formula (VII-b). (VII-b), in, R 43 It is cyclopropyl, and R 44 Selected from tert-butyl and R 45 Selected from H, the wavy line indicates the connection point; X1 is N; X2 is 0; X3 is H; Z1 is C-R5; Z2 is C-R6; Z3 is C-R7; and Z4 is C-R8, where, Any one of R5-R8 including Or a group represented by the following formula (VI-c), (Joke), in, R 26 It is methyl. X6 is N, R 17 Selected from -CH2-CHF2 and -C2H4-OCH3, R 18 -R 21 Independently selected from H, The wavy line indicates the connection point, and The others in R5-R8 are H.

2. The compound according to claim 1, characterized in that, R1 and R2 are independently selected from H.

3. The compound according to claim 1, characterized in that, R1 and R2 are -CH2- and are linked by a single bond to form cyclopropyl groups.

4. The compound according to claim 1, characterized in that, R 44 It is tert-butyl.

5. The compound according to claim 1, characterized in that, R 44 for .

6. The compound according to claim 1, characterized in that, R7 is The group indicated.

7. The compound according to claim 1, characterized in that, R7 is a group represented by formula (VI-c).

8. The compound according to claim 1, characterized in that, R 17 It is -CH2-CHF2.

9. The compound according to claim 1, characterized in that, R 17 It is -C2H4-OCH3.

10. A compound comprising: , , 、 、 、 。

Citation Information

Patent Citations

  • Dipeptide nitriles

    CN1278244A

  • Novel compounds and compositions as protease inhibitors

    US20020086996A1

  • Cyanomethyl derivatives as cysteine protease inhibitors

    US20060122184A1

  • Apparatus for curing a composite laminate

    US20060252813A1

  • Acetamido acetonitrile derivatives as inhibitors of cathepsin l and / or cathepsin s

    WO2000049007A1