Coxsackie b3 virus detection kit

A kit for detecting Coxsackie B3 virus was constructed by combining RNA extraction, MIRA isothermal amplification, and CRISPR-Cas12a detection system. This kit solves the problems of complexity and time-consuming operation of existing detection methods, and enables rapid, sensitive, and specific diagnosis of viral myocarditis.

CN116790811BActive Publication Date: 2026-04-24ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310561777.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-18
Publication Date
2026-04-24
Estimated Expiration
2043-05-18

AI Technical Summary

Technical Problem

Existing detection methods for Coxsackie B3 viral myocarditis are characterized by long time cycles, complex operations, and high equipment requirements, lacking a rapid and accurate instant testing method.

Method used

A kit for detecting Coxsackie B3 virus, developed using gene editing technology, combines an RNA extraction and reverse transcription system, a MIRA isothermal amplification system, and a CRISPR-Cas12a detection system. It uses crRNA specifically targeting the CVB3 gene and probes labeled with fluorescein and biotin, combined with a visual test strip, to achieve rapid detection.

Benefits of technology

This technology enables rapid, convenient, sensitive, and specific detection of CVB3 virus at room temperature without the need for PCR instruments, thus improving the diagnostic efficiency of viral myocarditis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116790811B_ABST
    Figure CN116790811B_ABST
Patent Text Reader

Abstract

The application discloses a kit for detecting coxsackie virus B3, which comprises: an RNA extraction and reverse transcription system, an MIRA isothermal amplification system, a CRISPR-Cas12a detection system, a test strip, and the like. The kit is convenient to operate, can quickly and sensitively detect coxsackie virus B3 in a biological sample, and is used for improving the diagnosis efficiency of viral myocarditis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of clinical medical diagnostic reagents, specifically relating to a kit for detecting Coxsackie B3 virus. Background Technology

[0002] Viral myocarditis is a clinical manifestation resulting from inflammatory changes in the myocardium following viral infection. Various viruses can cause myocarditis, but Coxsackievirus B3 (CVB3) is the most common. Traditional laboratory testing mainly relies on methods including complete blood count, electrocardiogram (ECG), X-ray examination, echocardiography, viral isolation and culture, antigen-antibody diagnosis, and PCR diagnosis. The first four methods are non-specific, while the latter three, although specific, require long timeframes for viral isolation and culture and antigen-antibody diagnosis, and PCR testing demands high skill from operators and specialized equipment. Therefore, a rapid and accurate diagnostic method is needed clinically to enable point-of-care testing (POCT) for CVB3 viral myocarditis. Summary of the Invention

[0003] In order to establish a convenient, sensitive, and specific detection method for the diagnosis of viral myocarditis, the inventors developed a reagent for detecting Coxsackie B3 virus based on gene editing technology. The reliability of the technical solution of this invention was verified through test strip experiments.

[0004] Specifically, this invention provides a kit for detecting Coxsackie B3 virus, comprising: an RNA extraction and reverse transcription system; a MIRA isothermal amplification system; a CRISPR-Cas12a detection system, including the nuclease Cas12a, crRNA specifically targeting the CVB3 gene, a probe containing a 6-carboxyfluorescein at the 5' end and a biotin at the 3' end; and a test strip.

[0005] Preferably, the specific sequence of the above-mentioned crRNA is UAAUUUCUACUAAGUGUAGAUACCUCACCAGGUAUCCUCAUCUC, which is represented in DNA form as TAATTTCTACTAAGTGTAGATACCTCACCAGGTATCCTCATCTC. It specifically targets sites 1834-1856 of the CVB3 gene (GenBank: M33854.1).

[0006] The probe structure described above is 5'- / 6-FAM / DNA sequence / Bio / -3', meaning it is a DNA sequence containing 6-carboxyfluorescein at the 5' end and biotin at the 3' end.

[0007] Preferably, the DNA sequence is TTATTATT, that is, the probe structure is 5'- / 6-FAM / TTATTATT / Bio / -3'.

[0008] In one embodiment, the MIRA (Multi-enzyme Isothermal Rapid Amplification) isothermal amplification system described above uses amplification primers for amplifying cDNA, including forward primers and reverse primers:

[0009] Forward primer CVB3_F: ATATGAGTCACACCAGAGATGAGGATACC,

[0010] Reverse primer CVB3_R: AATAGTCAAGATCTCTCCTAGGAGCGTCC.

[0011] The MIRA isothermal amplification system described above includes at least three enzymes: recombinase, which promotes the pairing of specific primers with template DNA; single-stranded DNA binding protein, which can form single-stranded DNA without heating; and DNA polymerase, which is responsible for DNA fragment amplification and extension.

[0012] Optionally, the test strips mentioned above are commercially available test strips, preferably chromatographic double antibody sandwich DNA test strips, such as colloidal gold test strips, used to detect the cleavage of CVB3 gene amplification fragments and probes by Cas12.

[0013] The test strip can at least display the detection line (T) and control line (C) of the CRISPR signal probe cutting product.

[0014] Optionally, the above-mentioned RNA extraction and reverse transcription system includes commercially available RNA extraction reagents and commercially available RNA reverse transcription reagents.

[0015] For example, the RNA extraction reagent and the MIRA isothermal amplification system are both in the form of EP tubes (Eppendorf centrifuge tubes), and the RNA reverse transcription reagent is in the form of EP tubes (Eppendorf centrifuge tubes), pipettes, or reagent bottles.

[0016] The above-mentioned kit can be used in the following steps: Add the collected biological sample to a first EP tube (or EP tube A) containing RNA extraction reagent; add the reverse transcription reagent contained in a pipette or reagent bottle to the first EP tube and react at room temperature, for example, about 37°C, for a certain time, for example, about 15 minutes; add the reaction solution from the first EP tube to a second EP tube (or EP tube B) containing the MIRA isothermal amplification system and CRISPR-Cas12a detection reagent and react at room temperature, for example, about 37°C, for a certain time, for example, about 30 minutes; insert the conjugate pad end of the test strip into the second EP tube, or drop the reaction solution from the second EP tube into the conjugate pad of the test strip and react for a certain time, for example, about 1 minute, and then read the detection result, which is, for example, a visual band display result.

[0017] In this paper, when describing numerical characteristics, the terms "about", "approximately", or "around" refer to the fact that the expressed number may have an error range or fluctuation range of ±10%, ±9%, ±8%, ±7%, ±6%, or ±5%.

[0018] Unless otherwise defined, the range of numerals used in this invention includes the numeral and any number within that range.

[0019] In one manner, the biological sample is selected from the group consisting of whole blood, plasma, serum, saliva, oral mucosa, nasopharyngeal secretions, tissue fluid, and body fluids.

[0020] Preferably, the above-mentioned kit may further include at least one of the following items: a carrying tool, the space of which is divided into a defined space for accommodating one or more containers, such as reagent bottles, test tubes, and the like, each container containing a single component for the method of the present invention; and an instruction manual, which may be written on the bottles, test tubes, and the like, or on a separate piece of paper, or on the outside or inside of the container, such as a paper document with an operation demonstration video APP download window, such as a QR code. The instruction manual may also be in multimedia form, such as a computer CD, USB flash drive, etc.

[0021] In a preferred embodiment, the instruction manual for the above-mentioned kit also includes a computer program for establishing a standard curve, for comparing with the standard curve to calculate and determine the Coxsackie B virus load (virus copy number) per unit volume of sample, and installation and usage instructions.

[0022] The kit for detecting the CVB3 gene in this invention is easy to use, requires no PCR instrument, and can be completed at room temperature with just a few centrifuge tubes and small pipettes. It is also very quick to use. When detecting the CVB3 gene, it exhibits high sensitivity and specificity, which helps to greatly improve the diagnostic efficiency of viral myocarditis. Attached Figure Description

[0023] Figure 1 The diagram illustrates the usage process of an embodiment of the kit of the present invention. In the diagram, EP tube A contains RNA extraction reagent, the pipette contains a reverse transcription system, EP tube B contains isothermal amplification reagent and CRISPR-Cas12a detection reagent, and the test strip is used to detect CRISPR-Cas12a-cut probes.

[0024] Figure 2 The image shows a photograph of a test strip used to test the sensitivity of a kit for detecting the CVB3 gene according to the present invention. The test strips are numbered as follows: 1, 10,000 copies of substrate (CVB3 gene); 2, 1,000 copies of substrate; 3, 100 copies of substrate; 4, 10 copies of substrate; 5, 1 copy of substrate; 6, negative control; 7, positive control. Detailed Implementation

[0025] Nucleic acid-based diagnostic methods have been extensively established and widely applied in laboratory testing for human diseases. Gene editing technologies, such as CRISPR-Cas12a / Cas13a / Cas14a, are increasingly used in gene detection and are continuously evolving and improving. Meanwhile, isothermal amplification technology is also undergoing continuous improvement. Compared to other nucleic acid amplification technologies, isothermal amplification offers advantages such as speed, efficiency, and specificity, and requires no specialized equipment. Therefore, it was considered a potential diagnostic method comparable to PCR from the outset. Currently, common mainstream isothermal nucleic acid amplification technologies include LAMP, RPA, RCA, MIRA, CPA, SDA, and HDA.

[0026] To quickly and accurately detect Coxsackievirus CVB3 in samples, the inventors combined the RNA extraction and reverse transcription system for extracting the CVB3 gene, the CRISPR-Cas12a system, and isothermal amplification technology, along with a visual test strip, to construct the CVB3 detection kit of this invention.

[0027] To reduce product costs and alleviate the economic burden on test subjects, the CVB3 detection kit of this invention uses commercially available products as much as possible in its components. For example, the RNA extraction and reverse transcription system can use commercially available RNA extraction kits and reverse transcription kits, such as TRNzol Universal Total RNA Extraction Reagent (DP424) from Tiangen Biotech (Beijing) Co., Ltd., and [other kits] from Yisheng Biotechnology (Shanghai) Co., Ltd. II. 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) reverse transcription reagent, etc.; the test strips use commercially available chromatographic double-antibody sandwich DNA test strips, such as (Cas12 / 13 dedicated nucleic acid test strips from Beijing Libote Technology Co., Ltd., and disposable nucleic acid test strips from Wuhan Junuode Biotechnology Co., Ltd.); the recombinase, single-stranded DNA binding protein, and DNA polymerase in the MIRA isothermal amplification system can be commercially available enzymes / proteins; the nuclease Cas12a in the CRISPR-Cas12a detection system uses commercially available Cas12a.

[0028] To achieve accurate detection of the CVB3 gene, the inventors designed 40 primer pairs for cDNA amplification in the MIRA isothermal amplification system. These primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and through experimental comparison and screening, the following primer pairs, including both forward and reverse primers, were selected:

[0029] Forward primer CVB3_F: ATATGACGTCACACCAGAGATGAGGATACC (SEQ ID NO:1),

[0030] Reverse primer CVB3_R: AATAGTCAAGATCTCTCCTAGGAGCGTCC (SEQ ID NO:2).

[0031] Those skilled in the art will understand that the cDNA amplification primers used in the kits of the present invention are not limited to the sequences described above.

[0032] Targeting the CVB3 gene sequence (GenBank: M33854.1), the inventors designed various crRNA sequences for use in the CRISPR-Cas12a detection system to target specific sites. Seventy nucleotide sequences were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. Through experimental comparison and screening, the optimal crRNA sequence was determined to be:

[0033] TAATTTCTACTAAGTGTAGATACCTCACCAGGTATCCTCATCTC (SEQ ID NO: 3).

[0034] Those skilled in the art will understand that the crRNA used in the kits of the present invention is not limited to the sequences described above.

[0035] In this document, for the sake of simplicity, the names of crRNA and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they refer to different substances in different descriptive contexts. For example, crRNA gene refers to the gene DNA that can be transcribed into crRNA.

[0036] At the same time, to achieve the purpose of visualizing nucleic acid detection, the DNA probe is labeled with a chromogenic substance. This invention loads 6-carboxyfluorescein at the 5' end of the DNA sequence and biotin at the 3' end.

[0037] Through the above design and screening comparison experiments, the constructed kit is easy to operate and can quickly and accurately detect the CVB3 gene expression level in biological samples. It has high stability and reproducibility, providing a reference for the diagnosis of viral myocarditis.

[0038] The present invention will be further described below with reference to specific embodiments and accompanying drawings. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0039] In embodiments of the present invention, unless otherwise specified, the experimental operating temperature generally refers to room temperature (10-40°C).

[0040] This article involves the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the weight percentage.

[0041] Example 1: Reagent Kit Construction

[0042] The RNA extraction reagent used in this example was TRNzol Universal Total RNA Extraction Reagent (DP424) from Tiangen Biotech (Beijing) Co., Ltd. The RNA reverse transcription reagent was from Yisheng Biotechnology (Shanghai) Co., Ltd. II 1st Strand cDNA Synthesis SuperMix for qPCR (gDNAdigester plus) reagent. The test strip is the Cas12 / 13 dedicated nucleic acid test strip from Beijing Libotai Technology Co., Ltd.

[0043] The MIRA isothermal amplification system, which includes recombinase, single-stranded DNA binding protein, and DNA polymerase, is the basic DNA isothermal rapid amplification kit WLB8201KIT (Libo Taiye).

[0044] The CRISPR-Cas12a detection system contains the nuclease Cas12a, which is the LbaCas12a protein (provided by Shenzhen Yizhi Biotechnology).

[0045] Follow the kit instructions. The required DNA sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0046] Example 2: Test strip sensitivity test

[0047] First, the flanking sequence of the target was amplified and cloned into a vector containing the T7 promoter. It was then transcribed into RNA in vitro. Based on the base number and concentration, the copy number in 1 ml of solution was assessed using the formula: copies / ml = (6.02 × 10²³ copies / mol) x (concentration) / (MWg / mol). The solution was then sequentially diluted to 10000 copies / ul, 1000 copies / ul, 100 copies / ul, 10 copies / ul, and 1 copy / ul. A 1 × 10⁻⁶ mcg / mol solution was used. 11 The recombinant plasmid was copied as a positive control, and purified water was used as a negative control.

[0048] Next, add 1 μL of the substrate to solution A in EP tubes 1-7 sequentially, and react for 2 minutes. Then, add the reverse transcription system from the pipette to solution A in EP tubes, and react for 20 minutes. Pipette 10 μL of solution A from EP tubes into solution B in EP tubes, and react for 30 minutes. Add solution B to the conjugate pad end of the test strip, react for 1 minute, and then read the test result.

[0049] Test results are as follows Figure 2 As shown, the T line (test line, bottom) and C line (control line, top) of test strip 1, which detects 10,000 copies of substrate solution, are clearly visible. Test strips 2-4, which detect 1,000 copies, 100 copies, and 10 copies of substrate solution respectively, show clearly visible C lines (effective detection), but the T line color gradually fades as the CVB3 gene copy number decreases. Test strip 5, which detects 1 copy of substrate solution, shows clearly visible C lines (effective detection), but the T line is colorless (substrate not detected). Test strip 6, the negative control, shows clearly visible C lines (effective detection), but the T line is colorless (substrate not detected). Test strip 7, the positive control, shows clearly visible T lines (successful detection). This demonstrates that the kit of the present invention has high sensitivity in detecting the CVB3 gene and can be used for detecting CVB3 gene expression in clinical biological samples.

[0050] The above embodiments are provided to facilitate understanding and use of the present invention by those skilled in the art. It will be apparent to those skilled in the art that modifications can be easily made to the embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. A kit for detecting Coxsackie B3 virus, characterized in that, include: RNA extraction and reverse transcription system; MIRA isothermal amplification system containing recombinase, single-stranded DNA-binding protein, and DNA polymerase; CRISPR-Cas12a detection system containing Cas12a nuclease, crRNA specifically targeting the CVB3 gene, and probes containing 6-carboxyfluorescein at the 5' end and biotin at the 3' end; test strips, The crRNA mentioned above is UAAUUUCUACUAAGUGUAGAUACCUCACCAGGUAUCCUCAUCUC, which is represented in DNA form as TAATTTCTACTAAGTGTAGATACCTCACCAGGTATCCTCATCTC. The probe structure is 5'- / 6-FAM / TTATTATT / Bio / -3'; In the MIRA isothermal amplification system, the amplification primers used to amplify cDNA include forward primers and reverse primers, wherein... Forward primer CVB3_F: ATATGAGTCACACCAGAGATGAGGATACC, Reverse primer CVB3_R: AATAGTCAAGATCTCTCCTAGGAGCGTCC.

2. The reagent kit according to claim 1, characterized in that, The kit is used to diagnose viral myocarditis.

3. The reagent kit according to claim 1, characterized in that, The test strip is a chromatographic double-antibody sandwich DNA test strip used to detect the cleavage of the CVB3 gene amplification fragment and probe by Cas12.

4. The reagent kit according to claim 3, characterized in that, The test strip displays the detection line and control line of the CRISPR signal probe cutting product.

5. The reagent kit according to claim 1, characterized in that, The RNA extraction and reverse transcription system includes RNA extraction reagents and RNA reverse transcription reagents.

6. The reagent kit according to claim 5, characterized in that, The RNA extraction reagent and the MIRA isothermal amplification system are both in EP tube form, and the RNA reverse transcription reagent is in EP tube, pipette, or reagent bottle form.

7. The reagent kit according to claim 6, characterized in that, The procedure involves the following steps: Add the collected biological sample to the first EP tube containing RNA extraction reagent; add the reverse transcription reagent from the pipette or reagent bottle to the first EP tube and react at 37°C for a certain time; add the reaction solution from the first EP tube to the second EP tube containing the MIRA isothermal amplification system and react at 37°C for a certain time; insert the test strip conjugate end into the second EP tube and react for a certain time to read the test result.

8. The reagent kit according to claim 7, characterized in that, The biological samples were selected from the following group: whole blood, plasma, serum, saliva, oral mucosa, nasopharyngeal secretions, tissue fluid, and body fluids.

9. The reagent kit according to claim 1, characterized in that, The instruction manual for the kit includes a computer program for establishing a standard curve, a program for comparing the sample with the standard curve to calculate the viral load of Coxsackie B virus per unit volume, and installation and usage instructions.

Citation Information

Patent Citations

  • CRISPR (clustered regularly interspaced short palindromic repeats) system-based detection method and kit for 71-type enterovirus

    CN115216562A