Genetically engineered bacteria for producing a82846b and construction method and application thereof
By overexpressing GrtfA and Lfp genes in *Amycium orientalis*, a genetically engineered bacterium was constructed, which solved the problem of high impurity ratio in microbial fermentation, improved the yield and purity of A82846B, and reduced production costs.
Patent Information
- Application Number
- CN202210273259.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-18
- Publication Date
- 2026-06-23
- Estimated Expiration
- 2042-03-18
AI Technical Summary
In the existing microbial fermentation process for producing A82846B, the proportion of structural analog impurities A82846A and A82846C is too high, leading to difficulties in separation and purification and increased costs.
Recombinant expression plasmids containing GrtfA, Lfp, or a combination of GrtfA and Lfp were constructed and overexpressed in *Amycium orientalis* to form genetically engineered bacteria. Fermentation conditions were optimized to improve the yield and purity of A82846B.
It significantly increased the yield of A82846B, reduced the proportion of impurities A82846A and A82846C, improved production efficiency, and reduced costs.
Smart Images

Figure BDA0003554696180000041 
Figure BDA0003554696180000051 
Figure BDA0003554696180000101
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering, specifically relating to a genetically engineered bacterium that produces A82846B, its construction method, and its application. Background Technology
[0002] A82846B is a chemical precursor for the second-generation glycopeptide antibiotic orivantacin, with the molecular formula C. 86 H 97 C l2 N 10 O 26 The structure of A82846B is similar to that of most glycopeptide antibiotics, such as vancomycin. Currently, microbial fermentation is the main method for producing A82846B. Research reports (such as US005843437A, CN104805161A, CN107557415A) indicate that existing technologies primarily improve the yield of A82846B by optimizing the fermentation formula and process. Our laboratory's patent document CN108728390A reports that overexpression of the endogenous halogenase gene chaA can increase the yield of A82846B and its proportion in the total product; however, the two structural analog impurities A82846A and A82846C present in the fermentation broth account for more than 40%, posing certain difficulties for subsequent separation and purification. Therefore, developing a method that can significantly reduce the proportion of impurities A82846A and A82846C while increasing the proportion and yield of the target product A82846B is of positive significance for the more efficient production of A82846B. Summary of the Invention
[0003] To overcome the shortcomings of existing technologies in the production of A82846B via microbial fermentation, which results in excessively high proportions of structural analog impurities A82846A and A82846C, adding extra difficulties and costs to subsequent separation and purification, this invention provides a genetically engineered bacterium for producing A82846B, its construction method, and its application, so as to improve the production efficiency of A82846B and reduce production costs by utilizing genetic engineering technology.
[0004] To solve the above-mentioned technical problems, one of the technical solutions provided by the present invention is: a recombinant expression plasmid, wherein the recombinant expression plasmid includes a backbone plasmid and endogenous genes of the originating strain that produces A82846B: GrtfA, Lfp, or a combination of GrtfA and Lfp;
[0005] Preferably, the originating bacterium is *Amycolatopsis orientalis*; and / or, the endogenous gene is a combination of GrtfA and Lfp.
[0006] In some preferred embodiments, the backbone plasmid is pSET152.
[0007] In some preferred embodiments, the nucleotide sequence of the GrtfA is shown in SEQ ID NO:1.
[0008] In some preferred embodiments, the nucleotide sequence of the Lfp is shown in SEQ ID NO:2.
[0009] In some preferred embodiments, the nucleotide sequence of GrtfA is shown in SEQ ID NO:1; and the nucleotide sequence of Lfp is shown in SEQ ID NO:2.
[0010] In some other preferred embodiments, the backbone plasmid is pSET152; the nucleotide sequence of GrtfA is shown in SEQ ID NO:1; and the nucleotide sequence of Lfp is shown in SEQ ID NO:2.
[0011] The recombinant expression plasmid can be used to construct a genetically engineered bacterium that produces A82846B. Compared with existing technologies and starting bacteria, the yield and proportion of A82846B in the genetically engineered bacterium are improved.
[0012] The second technical solution provided by this invention is: a genetically engineered bacterium for producing A82846B, wherein the genetically engineered bacterium overexpresses the endogenous genes defined by the recombinant expression plasmid as described in the first technical solution: GrtfA, Lfp, or a combination of GrtfA and Lfp. Compared with existing technologies and starting bacteria, this genetically engineered bacterium can increase the yield and proportion of A82846B in production, and reduce the proportion of impurities A82846A and A82846C.
[0013] Preferably, the genetically engineered bacteria overexpress the combination of GrtfA and Lfp. Similarly, in production, the yield and proportion of A82846B were increased, while the proportions of impurities A82846A and A82846C were reduced. Specifically, the yield of A82846B accounted for 88.40% of the total product, increasing to 3.26 times that of the starting bacteria; the proportion of impurity A decreased by 53.05%; and impurity C was almost completely eliminated.
[0014] In some preferred embodiments, the originating strain of the genetically engineered bacteria is Amycolatopsis orientalis, for example, the natural strain NRRL 18099.
[0015] The third technical solution provided by this invention is: a method for constructing genetically engineered bacteria as described in the second technical solution, wherein the construction method includes the following steps:
[0016] 1) PCR amplification of GrtfA and Lfp;
[0017] 2) Construct recombinant expression plasmids containing GrtfA, Lfp, or a combination of GrtfA and Lfp;
[0018] 3) Transform the recombinant expression plasmid into the intermediate host bacteria;
[0019] 4) The intermediate host bacteria carrying the recombinant expression plasmid and the starting bacteria that produce A82846B are conjugated and cultured to obtain the genetically engineered bacteria.
[0020] In some preferred embodiments, the construction method includes one or more of the following features:
[0021] (1) The intermediate host bacterium mentioned above is Escherichia coli ET12567 / pUZ8002;
[0022] (2) The volume ratio of the starting bacterial culture to the intermediate host bacterial culture in the conjugation culture is 1:1;
[0023] (3) The conjugation culture is carried out on MS agar medium at a temperature of 28°C; the MS agar medium contains, for example, 20 g / L of hot-pressed soybean meal, 20 g / L of mannitol and 20 g / L of agar.
[0024] The fourth technical solution provided by this invention is: a method for preparing A82846B, comprising fermenting the genetically engineered bacteria as described in technical solution two to obtain A82846B from the fermentation medium. Compared with the existing methods for preparing A82846B, the yield of A82846B prepared by this invention and its proportion in the product are both improved.
[0025] In some preferred embodiments, the fermentation medium contains 8 g / L glucose, 0.6 g / L yeast powder, 5.0 g / L maltodextrin, 0.54 g / L KCl, 0.5 g / L CaCO3, 0.017 g / L KH2PO4, and 0.1 g / L foaming agent, and the pH of the fermentation medium is controlled between 6.4 and 6.7 and the residual sugar content is between 0.1 and 0.3 g / L.
[0026] In some preferred embodiments, the reaction conditions of the preparation method are: the fermentation time is 6 days, and / or the fermentation temperature is 32℃~35℃.
[0027] The fifth technical solution provided by the present invention is the application of the recombinant expression plasmid as described in the first technical solution or the genetically engineered bacteria as described in the second technical solution in the production of A82846B.
[0028] The positive and progressive effects of this invention are as follows:
[0029] This invention improves the yield of A82846B and its proportion in the total product by overexpressing GrtfA, Lfp, or a combination of GrtfA and Lfp (i.e., GrtfA+Lfp) in the A82846B producing bacterium, *Amycium orientalis*. This results in improved production efficiency of the target product A82846B, reduced production costs, and reduced environmental pollution. Attached Figure Description
[0030] Figure 1A The GrtfA gene was expressed in the pSET52 plasmid.
[0031] Figure 1B The Lfp gene is expressed in the pSET52 plasmid.
[0032] Figure 1C The GrtfA+Lfp gene was expressed in the pSET52 plasmid.
[0033] Figure 2 HPLC chromatogram of fermentation products from the originating strain NRRL 18099. In the figure, A represents A82846A, B represents A82846B, and C represents A82846C.
[0034] Figure 3 HPLC chromatogram of fermentation products of genetically engineered bacterium NRRL 18099 / pSET152-GrtfA+Lfp. In the figure, A represents A82846A, B represents A82846B, and C represents A82846C. Detailed Implementation
[0035] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.
[0036] Example 1:
[0037] Construction of pSET152-GrtfA engineered bacteria :
[0038] (1) Genome extraction and GrtfA gene amplification of Amycolatopsis orientalis strain NRRL 18099 (purchased from NRRL):
[0039] NRRL 18099 was inoculated into 25 mL of TSB (purchased from Shanghai Yuanju Biotechnology Co., Ltd.) medium and cultured at 28°C with shaking at 220 rpm (shaker purchased from Shanghai Zhichu Instrument Co., Ltd.) for 48 h. The culture was centrifuged at 12000 rpm (centrifuge purchased from Hunan Xiangyi Instrument Development Co., Ltd.) for 5 min, the supernatant was discarded, and the bacterial cells were recovered. Genomic DNA was extracted using a rapid bacterial genomic DNA extraction kit, following the extraction method provided by the supplier (Shanghai Jierui Biotechnology Co., Ltd.).
[0040] The primers were synthesized by Shanghai Bailige Biotechnology Co., Ltd., and their design is as follows:
[0041] Orf1-F:5'-CATATGATGCGCGTGTTGATTACGGGGTGTGGATCGCGC-3' (SEQ ID NO: 3);
[0042] Orf1-R: 5'-GGATCCTCAGGCGGGAACAGTCG-3' (SEQ ID NO: 4).
[0043] Add NdeI and BamHI restriction sites (both endonucleases purchased from Thermo Fisher Scientific) to the 5' end of the primers, respectively.
[0044] The PCR system is shown in Table 1 below:
[0045] Table 1: Components and volumes of the GrtfA amplification system
[0046]
[0047]
[0048] The working concentration of each primer was 50 μM / L, and the working concentration of dNTPs was 2.5 mM / L. The PCR amplification kit was purchased from Takara Bio Inc. (Dalian). The PCR reaction conditions were as follows: pre-denaturation at 96℃ for 5 min; denaturation at 96℃ for 10 s, annealing at 65℃ for 10 s, extension at 72℃ for 1.5 min, for a total of 30 cycles; and extension at 72℃ for 10 min. Results: A 1191 bp DNA fragment was specifically amplified. The PCR product was subjected to 0.8% agarose gel electrophoresis (electrophoresis apparatus purchased from Shanghai Tianneng Technology Co., Ltd.), voltage 120V, for 45 min. The gel was excised and recovered using a SanPrep column-based DNA gel recovery kit (purchased from Sangon Biotech Co., Ltd.), and finally dissolved in 30 μL of pure water. The purified DNA fragment was ligated into a Pmd18-T plasmid containing the target DNA fragment using the Pmd18-T Vector Cloning Kit (purchased from Takara Bio Inc., Dalian). This plasmid was then transformed into DH5α Escherichia coli competent cells (purchased from Kangwei Century Biotechnology Co., Ltd.). After plasmid extraction, the target DNA fragment sequence was sequenced (Shanghai Bioengineering Technology Co., Ltd.), and the result, shown in SEQ ID NO:1, identified it as the GrtfA gene. The resulting plasmid containing GrtfA, Pmd18-T-GrtfA, was obtained.
[0049]
[0050] (2) Construction of recombinant expression plasmid pSET152-GrtfA:
[0051] The plasmid Pmd18-T-GrtfA obtained in (1) above was digested with NdeI / BamHI, and the target fragment GrtfA was recovered by gel extraction. This fragment was inserted into the integrative plasmid pSET152 (purchased from Changsha Youbao Biotechnology Co., Ltd.) of the erythromycin resistance gene promoter ermE*, digested with NdeI and BamHI, and ligated with GrtfA to obtain the recombinant expression plasmid pSET152-GrtfA. The recombinant expression plasmid pSET152-GrtfA was transformed into the intermediate host Escherichia coli ET12567 / pUZ8002 (purchased from Changsha Youbao Biotechnology Co., Ltd.).
[0052] (3) Construction of genetically engineered bacteria
[0053] Inoculate the starting strain NRRL 18099 onto fresh slant agar medium and incubate at 28°C for 5-6 days. Once white bacterial cells have grown, use an inoculation spatula to collect approximately 1 cm of the culture. 3 The bacterial cells were inoculated into 25 mL of TSB liquid medium (purchased from Shanghai Bowei Microbial Technology Co., Ltd.) and cultured at 28℃ and 200 rpm for 2 days. Then, the inoculum was transferred to 25 mL of TSB medium at a 1% inoculation rate and cultured at 28℃ and 200 rpm for 1 day. The supernatant was removed by centrifugation to obtain mycelia, which were washed twice with LB liquid medium and finally suspended in 2 mL of LB liquid medium. This was the starting bacterial culture.
[0054] Intermediate host Escherichia coli ET12567 / pUZ8002 carrying the recombinant expression plasmid pSET152-GrtfA was inoculated into 5 mL of LB liquid medium (1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.0-7.2, autoclaved at 121°C for 20 min) containing chloramphenicol, kanamycin, and apramycin (purchased from Sangon Biotech Co., Ltd.) at concentrations of 25 μg / mL, 25 μg / mL, and 50 μg / mL, respectively (chloramphenicol and kanamycin resistance were derived from the intermediate host bacterium pUZ8002). The medium was then incubated overnight at 37°C and 200 rpm. Transfer 1% of the inoculum to 25 mL of the same medium, incubate at 37°C and 200 rpm for about 4 h until the OD value is 0.4-0.6, wash twice with LB liquid medium, and finally suspend in 2 mL of LB liquid medium. This is the E. coli liquid containing pSET152-GrtfA plasmid.
[0055] The starting bacterial culture prepared above was mixed with the intermediate host *E. coli* culture at a volume ratio of 1:1 in a centrifuge tube. After thorough mixing, the mixture was spread onto MS agar medium (20 g / L hot-pressed soybean meal, 20 g / L mannitol, and 20 g / L agar). After incubation at 28°C for 15 h, the plate was covered with 1 mL of sterile water containing 450 μg / mL apramycin and 50 μg / mL nalidixic acid, and further incubated at 28°C for one week to obtain an apramycin-resistant strain.
[0056] (4) Validation of genetically engineered bacteria
[0057] The resistance of the apramycin-resistant strain obtained in step (3) above was verified by inoculating the starting bacteria and the obtained apramycin-resistant genetically engineered strains onto slant culture medium containing apramycin (50 μg / mL) and culturing at 28°C for 6 days. It was observed that only the starting bacteria did not grow on the slant containing apramycin, while the genetically engineered bacteria with transformants could grow.
[0058] Further verification was performed by extracting the genomes of transformants using bacterial genome extraction methods and designing primers for the apramycin resistance gene:
[0059] Amp-F:5'-GTGCAATACGAATGGCGAAAAGCC-3' (SEQ ID NO:5);
[0060] Amp-R: 5'-TCAGCCAATCGACTGGCGAGC-3' (SEQ ID NO: 6).
[0061] Using Amp-F / Amp-R primers and recombinant genomic DNA as a template, the PCR reaction system described in Example 1 was followed by the following conditions: pre-denaturation at 96°C for 5 min; denaturation at 96°C for 10 s, annealing at 62°C for 10 s, and extension at 72°C for 1 min, for a total of 30 cycles; and extension at 72°C for 10 min. After amplification, an approximately 700 bp band was observed by agarose gel electrophoresis. Analysis confirmed that the pSET152-GrtfA plasmid integrated into the originating bacterial chromosome via its attP integration site and the attB site on the actinomycete chromosome under the action of integrase.
[0062] (5) Fermentation by genetically engineered bacteria
[0063] The seed culture medium can be prepared by referring to patent document "CN104805161A", and its composition is as follows: 3 g / L yeast extract, 11 g / L peptone, 3 g / L malt extract, and 17 g / L glucose, with a pH of 6.8. The genetically engineered bacteria obtained above are inoculated into the seed culture medium and cultured in a shaker at 28°C for 48 hours to obtain the seed culture solution.
[0064] The fermentation medium and fermentation process can be found in the applicant's patent document "CN107557415A". The composition of the medium is as follows: glucose 8g / L, yeast powder 0.6g / L, maltodextrin 5.0g / L, KCl 0.54g / L, CaCO3 0.5g / L, KH2PO4 0.017g / L, and foaming agent 0.1g / L. The pH of the fermentation medium is controlled between 6.4 and 6.7, and the residual sugar content is controlled between 0.1 and 0.3g / L. 200mL of seed culture is transferred to a 5L glass fermenter (purchased from Shanghai Baoxing Bio-equipment Engineering Co., Ltd.), the medium volume is 2L, the fermentation time is 6 days, and the fermentation temperature is 32℃ to 35℃.
[0065] Example 2:
[0066] Construction of pSET152-Lfp engineered bacteria :
[0067] (1) Amplification of the Lfp gene
[0068] The primers were synthesized by Shanghai Bailige Biotechnology Co., Ltd., and their design is as follows:
[0069] Orf15-F1:5'-CATATGGTGATCGCCATGTCGCA-3' (SEQ ID NO:7);
[0070] Orf15-R1:5'-GGATCCTCAGCTGTTGTCTTCGC-3' (SEQ ID NO:8).
[0071] Add NdeI and BamHI restriction sites to the 5' end of the primers, respectively.
[0072] The PCR system and PCR amplification process are as described in Example 1. The Lfp gene sequence is shown in SEQ ID NO:2.
[0073] Lfp gene: GTGATCGCCATGTCGCAAAACCTTGGCGCGGGCCGGCTTCTGGCGATATCCCCGCATTTGGACGACGCGGTCCTGTCGTTCGGAGCCGGCCTCGCCCGGGCGGCGCAGGACGGTGCGAAGGTGACCGTCTACACGGTATTCGCCGGTACGGCGACGCCCCCTTACTCACCGGCGGCGGAGCGATTGCACGGGATCTGGGGCCTTTCGCCGGATCAAGACGCGTCGCTGCATCGCCGAAATGAAGACATCGCCGCGCTCGACCACCTGGGGGTCGACTACCGGCACGGCCGATTCCTCGACGCCATTTATCGCACGTTGCCGGATGGGCGATGGCTGGCTGACAACGTGCCAGGCAGGCAAAAGCTGGCAATCAGCCGGCTGTCGCCGCAGACCGATCCGGATCTGTTCGCCGCGGTCAGGGATGACATCAAATCGGTCGTCGAAGAGTGTGATCCAACGCTGATCCTCACTTGTGCGGCAGGCAACGGTCATATCGACAACGAGATCACGCGGGATGCGGCACTGCTCGTCGCGCACGAGAAAGATCTCCCGGTGCGACTGTGGGAAGACCTTCCGCACGCGATGTTCGGGGCAGGTCCCGCCGAACTGCCGGAGGGCTTCGATCTCGGTACTGGAGATTTCGGCTCCGTCACGACGGACATGCGGGACCGGAAATTCGAGGCTCTGCGGCTCTATCCGTCGCAAATGTTGATGCTCCACGGGCCTGGCAAGGATTTTTTCGCCCAGCTGGACGAGCATGCCCGGAAGAACTCGCCACAGGGCGGATACGGCGAAACGACCTGGCCTGTGGTCTCTCGCGAAGACAACAGCTGA (SEQ ID NO.2).
[0074] (2) Construction of pSET152-Lfp recombinant expression plasmid:
[0075] The plasmid construction is similar to that of pSET152-GrtfA in Example 1. The plasmid Pmd18-T-Lfp containing Lfp is digested with NdeI and BamHI to obtain the target gene fragment, which is then inserted between NdeI and BamHI in the pSET152 plasmid to obtain the recombinant expression plasmid pSET152-Lfp.
[0076] (3) Construction of genetically engineered bacteria: The recombinant expression plasmids obtained in step (2) are constructed using the same method as in step (3) of Example 1.
[0077] (4) Verification of genetically engineered bacteria: The apramycin-resistant strains obtained in step (3) above were subjected to resistance verification, and the method was the same as step (4) in Example 1.
[0078] (5) Fermentation of genetically engineered bacteria: The genetically engineered bacteria obtained in step (4) above are fermented in the same way as step (5) in Example 1.
[0079] Example 3:
[0080] Construction of pSET152-GrtfA+Lfp engineered bacteria :
[0081] (1) Amplification of the Lfp gene
[0082] The primers were synthesized by Shanghai Bailige Biotechnology Co., Ltd., and their design is as follows:
[0083] Orf15-F2:5'-GGATCCGTGATCGCCATGTCGCA-3' (SEQ ID NO:9);
[0084] Orf15-R2: 5'-GCGGCCGCTCAGCTGTTGTCTCGC-3' (SEQ ID NO: 10).
[0085] Add BamHI and NotI restriction sites to the 5' end of the primers, respectively.
[0086] The PCR system and PCR amplification process are as described in Example 1.
[0087] (2) Construction of pSET152-GrtfA+Lfp recombinant expression plasmid:
[0088] The plasmid construction was similar to that of pSET152-GrtfA in Example 1. The plasmid Pmd18-T-Lfp containing Lfp was double-digested with BamHI and NotI to obtain the target gene fragment, which was then inserted between the BamHI and NotI enzymes of the pSET152-GrtfA plasmid to obtain the recombinant expression plasmid pSET152-GrtfA+Lfp.
[0089] (3) Construction of genetically engineered bacteria: The recombinant expression plasmids obtained in step (2) are constructed using the same method as in step (3) of Example 1.
[0090] (4) Verification of genetically engineered bacteria: The apramycin-resistant strains obtained in step (3) above were subjected to resistance verification, and the method was the same as step (4) in Example 1.
[0091] (5) Fermentation of genetically engineered bacteria: The genetically engineered bacteria obtained in step (4) above are fermented in the same way as step (5) in Example 1.
[0092] Example 4:
[0093] Analysis of fermentation products of engineered bacteria: The three genetically engineered bacteria obtained in Examples 1-3, and the wild-type NRRL 18099 starting strain without recombinant plasmids, were fermented separately, and the contents of various analogues of A82846 were analyzed by HPLC. The HPLC analysis method is briefly described as follows: Pretreatment of fermentation broth: 1 mL of fermentation broth was taken, 2 times the volume of methanol was added, vortexed to mix, sonicated for 30 min, centrifuged (4000×g) for 10 min, and the resulting supernatant was analyzed by HPLC. Chromatographic conditions: ZORBAX SB-C8 column (4.6×150 mm, 3.5 μm); mobile phase 1% ammonium dihydrogen phosphate solution (A): acetonitrile (B), gradient elution, 0→25 min, A:B=95:5→50:50; flow rate 1.0 mL / min; detection wavelength 225 nm; column temperature 30℃; injection volume 10 μL. The results are shown in Table 2 below:
[0094] Table 2. Fermentation products of genetically engineered bacteria
[0095]
[0096] The experimental results above lead to the conclusion that, compared to the starting strain NRRL 18099, overexpression of either the GrtfA or Lfp gene in the starting strain increases the yield and proportion of the target product A82846B and reduces its structural analog impurities A82846A and A82846C. Furthermore, overexpression of the GrtfA and Lfp gene combination (i.e., the GrtfA+Lfp combination mentioned above) in the starting strain has a highly significant effect on increasing the yield and proportion of A82846B and reducing impurities A82846A and A82846C. Specifically, after overexpression of the GrtfA and Lfp gene combination in the starting strain, the yield of A82846B accounted for 88.40% of the total product, increasing 3.26 times compared to the wild-type strain (27.12%). The proportion of impurity A decreased by 53.05%, and impurity C was almost completely eliminated. SEQUENCE LISTING <110> Shanghai Pharmaceutical Industry Research Institute Co., Ltd. China National Pharmaceutical Industry Research Institute Co., Ltd. <120> A genetically engineered bacterium for producing A82846B, its construction method and application <130> P22010564C <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 1191 <212> DNA <213> Artificial Sequence <220> <223> GrtfA gene <400> 1 atgcgcgtgt tgattacggg gtgtggatcg cgcggagata ccgaaccgtt ggtggcattg 60 gcggcacggt tgcgggaact cggtgcggac gcgcggatgt gcctgccgcc ggactacgtg 120 gagcggtgcg ccgaggtcgg tgtgccgatg gtgccggtcg gtcgggcggt gcgcgcaggg 180 gcacgcgagc cgggagaact gccgccgggg gcggccgaag tcgtgaccga ggtggtcgcc 240 gaatggttcg acaaggtccc ggcggccatc gaggggtgtg acgcggtggt gacgaccggc 300 ttgctgcccg ccgcggtcgc tgtccggtcg atggccgaga agctgggcat cccgtaccgc 360 tacaccgtgc tgtctccgga ccatctgccg tcggagcaaa gccaggcgga gcgggacatg 420 tacaaccagg gcgccgacag gcttttcggt gacgcggtca acagccaccg ggcctcgatc 480 ggcctgccac cggtggagca cctctacgac tacggctaca ccgatcagcc ctggctggcg 540 gcggacccgg tgctgtcccc gctgcggccg acggacctcg gcactgtgca gaccggtgcg 600 tggatcctgc ccgacgaacg gccgctttcc gcggagctgg aggcgtttct ggctgccggg 660 tcgacgccgg tgtacgtggg tttcggcagc tcgtcccgac cggcaaccgc tgacgccgcg 720 aagatggcca tcaaggcggt ccgtgccagt ggccgccgga tcgttctctc ccgcggctgg 780 gccgatttgg tcctgccgga cgacggggcc gactgcttcg tggtcggcga agtgaacctt 840 caggagctgt tcggccgggt ggccgccgcc atccaccacg acagcgcggg cacgacgctg 900 ctggccatgc gggcgggcat cccccagatc gtggtgcgcc gcgtagtgga caacgtggtg 960 gagcaggcgt accacgccga ccgggtggcc gagctgggtg tcggtgtggc ggtcgacggt 1020 ccggtcccga ccatcgactc cttgtcggcc gcgctcgaca cggctctggc cccggagatc 1080 cgtgcgcgag cgacgaccgt ggcagacacg attcgcgccg atgggacaac ggtggccgcg 1140 cagctgctgt tcgacgcggt cagcctggaa aagccgactg ttcccgcctg a 1191 <210> 2 <211> 834 <212> DNA <213> Artificial Sequence <220> <223> Lfp gene <400> 2 gtgatcgcca tgtcgcaaaa ccttggcgcg ggccggcttc tggcgatatc cccgcatttg 60 gacgacgcgg tcctgtcgtt cggagccggc ctcgcccggg cggcgcagga cggtgcgaag 120 gtgaccgtct acacggtatt cgccggtacg gcgacgcccc cttactcacc ggcggcggag 180 cgattgcacg ggatctgggg cctttcgccg gatcaagacg cgtcgctgca tcgccgaaat 240 gaagacatcg ccgcgctcga ccacctgggg gtcgactacc ggcacggccg attcctcgac 300 gccatttatc gcacgttgcc ggatgggcga tggctggctg acaacgtgcc aggcaggcaa 360 aagctggcaa tcagccggct gtcgccgcag accgatccgg atctgttcgc cgcggtcagg 420 gatgacatca aatcggtcgt cgaagagtgt gatccaacgc tgatcctcac ttgtgcggca 480 ggcaacggtc atatcgacaa cgagatcacg cgggatgcgg cactgctcgt cgcgcacgag 540 aaagatctcc cggtgcgact gtgggagac cttccgcacg cgatgttcgg ggcaggtccc 600. gccgaactgc cggagggctt cgatctcggt actggagatt tcggctccgt cacgacggac 660 atgcgggacc ggaattcga ggctctgcgg ctctatccgt cgcaaatgtt gatgctccac 720 gggcctggca aggatttttt cgcccagctg gacgagcatg cccggaga ctcgccacag 780 ggcggatacg gcgaaacgac ctggcctgtg gtctctcgcg aagacaacag ctga 834 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> GrtfA inducer Orf1‐F <400> 3 catatgatgc gcgtgttgat tacggggtgt ggatcgcgc <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GrtfA Introduction Orf1‐R <400> 4 ggatcctcag gcgggaacag tcg <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> High-performance snowflake snowflakes Amp‐F <400> 5 gtgcaatacg aatggcgaaa agcc 24 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Amp-R primer for Apramycin resistance gene <400> 6 tcagccaatc gactggcgag c 21 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Lfp gene primer Orf15-F <400> 7 catatggtga tcgccatgtc gca 23 <210> 8 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Lfp gene primer Orf15-R <400> 8 ggatcctcag ctgttgtctt cgc 23 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Lfp gene primer Orf15-F <400> 9 ggatccgtga tcgccatgtc gca 23 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Lfp gene primer Orf15-R <400> 10 gcggccgctc agctgttgtc ttcgc 25
Claims
1. A recombinant expression plasmid, characterized in that, The recombinant expression plasmid includes a backbone plasmid and an endogenous gene from the originating strain that produces A82846B: Lfp ,or GrtfA and Lfp combination; Among them, the GrtfA The nucleotide sequence is shown in SEQ ID NO: 1; Lfp The nucleotide sequence is shown in SEQ ID NO:
2.
2. The recombinant expression plasmid as described in claim 1, characterized in that, The originating bacterium is *Pseudomonas orientalis* (…). Amycolatopsis orientalis ); and / or, the endogenous gene is GrtfA and Lfp combination.
3. The recombinant expression plasmid as described in claim 1 or 2, characterized in that, The backbone plasmid is pSET152.
4. A genetically engineered bacterium for producing A82846B, characterized in that, The genetically engineered bacteria overexpress the endogenous gene defined by the recombinant expression plasmid as described in claim 1 or 2: GrtfA , Lfp ,or GrtfA and Lfp combination; The originating strain of the genetically engineered bacteria is *Amylopectinus orientalis* (…). Amycolatopsis orientalis ); The aforementioned GrtfA The nucleotide sequence is shown in SEQ ID NO: 1; Lfp The nucleotide sequence is shown in SEQ ID NO:
2.
5. The genetically engineered bacteria as described in claim 4, characterized in that, The genetically engineered bacteria overexpression GrtfA and Lfp combination.
6. The genetically engineered bacteria as described in claim 4 or 5, characterized in that, The origin of the genetically engineered bacteria is the natural strain NRRL18099.
7. A method for constructing a genetically engineered bacterium as described in any one of claims 4-6, characterized in that, The construction method includes the following steps: 1) PCR amplification GrtfA and Lfp ; 2) Constructing GrtfA , Lfp ,or GrtfA and Lfp Recombinant expression plasmids; 3) Transform the recombinant expression plasmid into the intermediate host bacteria; 4) The intermediate host bacteria carrying the recombinant expression plasmid and the starting bacteria that produce A82846B are conjugated and cultured to obtain the genetically engineered bacteria described above. The originating strain of the genetically engineered bacteria is *Amylopectinus orientalis* (…). Amycolatopsis orientalis ); The aforementioned GrtfA The nucleotide sequence is shown in SEQ ID NO: 1; Lfp The nucleotide sequence is shown in SEQ ID NO:
2.
8. The method for constructing genetically engineered bacteria as described in claim 7, characterized in that, The construction method includes one or more of the following features: (1) The intermediate host bacterium mentioned above is Escherichia coli ET12567 / pUZ8002; (2) The volume ratio of the starting bacterial culture to the intermediate host bacterial culture in the conjugation culture is 1:1; (3) The conjugation culture is carried out on MS agar medium at a temperature of 28°C.
9. The method for constructing genetically engineered bacteria as described in claim 7 or 8, characterized in that, The MS agar medium contains 20 g / L hot-pressed soybean meal, 20 g / L mannitol, and 20 g / L agar.
10. A method for preparing A82846B, characterized in that, This includes fermenting the genetically engineered bacteria as described in any one of claims 4-6 to obtain A82846B from the fermentation medium.
11. The preparation method according to claim 10, characterized in that, The fermentation medium contains 8 g / L glucose, 0.6 g / L yeast powder, 5.0 g / L maltodextrin, 0.54 g / L KCl, 0.5 g / L CaCO3, 0.017 g / L KH2PO4, and 0.1 g / L foaming agent. The pH of the fermentation medium is controlled between 6.4 and 6.7, and the residual sugar content is controlled between 0.1 and 0.3 g / L.
12. The preparation method according to claim 10 or 11, characterized in that, The reaction conditions for the preparation method are: the fermentation time is 6 days; and / or the fermentation temperature is 32℃~35℃.
13. The use of the recombinant expression plasmid as described in any one of claims 1-3 or the genetically engineered bacteria as described in any one of claims 4-6 in the production of A82846B.
Citation Information
Patent Citations
Oritavancin precursor A82846B production method and mediums
CN104805161A
Fermentation medium and production process for producing oritavancin precursor A82846B
CN107557415A
Genetically engineered bacterium for producing A82846B as well as preparation method and application of genetically engineered bacterium
CN108728390A
A82846 antibiotics
US5843437A
Glycosyltransferase gene GtfA from Amycolatopsis orientalis
US5821099A