A method for constructing a microbial single-cell genomics sequencing library

By using transposase complex adapter sequences and library construction methods in a microfluidic device, a microbial single-cell genome sequencing library compatible with Illumina next-generation sequencers was constructed, solving the problems of incompatibility and mixed sequencing of existing methods, improving amplification quality and reducing sequencing costs.

CN116892064BActive Publication Date: 2026-07-28MOBIDROP (ZHEJIANG) CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310801273.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-03
Publication Date
2026-07-28
Estimated Expiration
2043-07-03

AI Technical Summary

Technical Problem

Existing methods for constructing microbial single-cell genome sequencing libraries are incompatible with Illumina next-generation sequencers, leading to increased sequencing costs and the inability to perform mixed sequencing with other sample libraries.

Method used

Using transposase complex adapter sequences and library construction methods, single cells and lysis reagents were encapsulated into microdroplets for lysis and amplification via a microfluidic device. Designed transposases were used for fragmentation and barcoding to construct a microbial single-cell genome sequencing library compatible with Illumina next-generation sequencers.

Benefits of technology

It improves the quality and purity of microbial single-cell whole genome amplification, reduces sequencing costs, and enables mixed sequencing with other sample libraries.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116892064B_ABST
    Figure CN116892064B_ABST
Patent Text Reader

Abstract

The application belongs to the field of single cell sequencing, and discloses a method for constructing a microbial single cell genomics sequencing library, which comprises the following steps: 1) lysing microbial single cells; 2) adding an amplification reaction mixture to perform whole genome amplification; 3) adding a fragmentation reagent to obtain a fragmented amplification product; and 4) adding microbeads and an amplification reaction mixture to label the fragmented reaction product with a barcode, so as to obtain raw materials for constructing a microbial single cell whole genome sequencing library. The effective library molecules obtained by using the transposase complex linker sequence and the library construction method designed in the application can be compatible with an Illumina second-generation sequencer, and can be mixed with other sample libraries for sequencing, so that the sequencing cost is greatly reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of single-cell sequencing, specifically relating to a method for constructing a microbial single-cell genomics sequencing library. Background Technology

[0002] With the increasing maturity of sequencing technology, the rapid improvement of analytical techniques, and the continuous reduction of sequencing costs, research on microbial communities has become increasingly in-depth. Current research on microorganisms mainly includes amplicon sequencing, metagenomic sequencing, and the emerging single-cell genome sequencing of microorganisms. Amplicon sequencing of microbial diversity is a research method that uses high-throughput sequencing technology to amplify and sequence characteristic sequences of microorganisms such as 16S, 18S, and ITS, with 16S rDNA (i.e., the 16S rRNA gene) being widely used. Metagenomic sequencing technology is a technique for studying the genetic material of all microorganisms with DNA as their genome in environmental or human samples. Its development has ushered in a new era in microbial research. This technology does not rely on microbial isolation and culture; it can directly detect nucleic acids in environmental samples and analyze microbial communities and the relationships between microorganisms and their hosts. Metagenomic research takes the genomes of all microorganisms in the environment as its research object, obtaining saturated data from a single sample through high-throughput sequencing of the whole-genome DNA in environmental samples. Single-microorganism genome sequencing technology can obtain the strain-specific genome from complex microbial communities and amplify and barcode its whole genome, achieving high-throughput sequencing of single microorganisms. This technology no longer relies on extracted total DNA from environmental microorganisms for microbial research. Instead, it requires the isolation of microbial cells from complex environmental samples. It addresses the limitations of mainstream microbial sequencing methods, such as 16S amplicon sequencing, which cannot be used for viral genome sequencing and suffers from incomplete reference sequence databases. This will further advance the development of unknown microbial strains based on traditional sequencing methods. However, existing single-microorganism genome sequencing library construction methods yield libraries with unique molecular structures that are not routinely compatible with Illumina next-generation sequencers and cannot be pooled with other sample libraries, significantly increasing sequencing costs. Summary of the Invention

[0003] This invention provides a method for constructing microbial single-cell genomics sequencing libraries. This method can improve the quality of microbial single-cell whole-genome amplification, as well as genome purity and sequencing coverage. Using the transposase complex adapter sequence and library construction method designed in this invention, the resulting effective library molecules are compatible with Illumina next-generation sequencers and can be mixed with other sample libraries for sequencing, reducing sequencing costs.

[0004] The method for constructing a microbial single-cell genomics sequencing library provided by the present invention includes: 1) assigning microbial single cells to a single partition to obtain multiple independent partitions containing at most one microbial cell, and performing lysis of microbial single cells within the partitions; 2) adding an amplification reaction mixture to the partition containing the microbial single-cell genome to amplify the whole genome of the microbial single cell; 3) adding a fragmentation reagent to the partition containing the amplified whole genome product of the microbial single cell to obtain fragmented amplification products; 4) adding beads and an amplification reaction mixture to the partition containing the fragmented amplification products to barcode the fragmented amplification products, thereby obtaining the raw materials for constructing a microbial single-cell whole-genome sequencing library.

[0005] Specifically, in a first aspect, a method for isolating and lysing microbial single cells is provided. Microbial single cells are assigned to single partitions to obtain multiple independent partitions containing at most one microbial cell each, and lysis of the microbial single cells is performed within each partition.

[0006] In some implementations, the partitions are microdroplets. Preferably, a microfluidic device is used to encapsulate a single microbial cell and a cell lysis reagent into droplets within a water-in-oil emulsion, and the cell is lysed within the droplets to obtain multiple droplets containing genomic DNA of at most one cell.

[0007] In some implementations, the lysis method for the microbial single cell is an enzymatic lysis method.

[0008] In some embodiments, the lysin is selected from Labiase lysin, lysozyme, egg protein-derived lysozyme, human lysozyme, or digestive peptidase, etc.

[0009] In some embodiments, the reagents for the enzymatic lysis method may include lysostaphin (Sigma), lysozyme (prepGEM Bacteria), Green+ buffer (prepGEM Bacteria), and prepGEM (prepGEM Bacteria).

[0010] In some embodiments, the enzyme lysis program is 37°C for 30 min; 75°C for 10 min, 95°C for 5 min; 4°C for ±∞.

[0011] Secondly, a method for amplifying the whole genome of a single microbial cell is provided. An amplification reaction mixture is added to a partition containing the lysed genome of a single microbial cell to amplify the whole genome of the single microbial cell.

[0012] In some embodiments, the partition is a microdroplet. Preferably, a microfluidic device is used to fuse multiple droplets containing the genomic DNA of at most one microbial cell with multiple droplets containing an amplification reaction mixture in a certain proportion, and the amplification of the whole microbial genome is performed within the fused droplets.

[0013] In some implementations, preferably, the droplet fusion ratio is 1:1.

[0014] In some implementations, the whole genome amplification method is selected from MDA (Multiple displacement amplification), PTA (Primary Template-directed Amplification), MALBAC (Multiple Annealing and Looping-Based Amplification Cycles), or LIANTI (Linearamplification via transposon insertion).

[0015] Thirdly, a method for fragmenting microbial single-cell whole-genome amplification products is provided. A fragmentation reagent is added to a region containing the microbial single-cell whole-genome amplification product to obtain fragmented amplification products.

[0016] In some implementations, the partition is a droplet. Preferably, a microfluidic device is used to fuse multiple droplets containing the amplified whole genome of at most one microbial cell with multiple droplets containing fragmentation reaction reagents in a certain proportion, and the microbial genome fragmentation reaction is carried out within the fused droplets.

[0017] In some implementations, preferably, the droplet fusion ratio is 1:1.

[0018] In some implementations, the fragmentation reaction method is an enzymatic digestion method.

[0019] In some implementations, the enzymatic digestion method uses a transposase to insert into the microbial single-cell genome amplification product and fragment it.

[0020] In some embodiments, the transposase is self-assembled. The adapter assembly for transposase assembly includes a ME-C sequence (5'- GTTACAGAGGCTGCAGATGTGTATAAGAGACAG-3'), a ME-B sequence (5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'), and a ME-reverse sequence (5'- phos-CTGTCTCTTATACACATCT-NH2-3').

[0021] Fourthly, a barcoding method for fragmented genomes of microbial single cells is provided. Beads and an amplification reaction mixture are added to a partition containing the fragmented amplification product, and the fragmented amplification product is barcoded to obtain the raw materials for constructing a microbial single-cell whole-genome sequencing library.

[0022] In some embodiments, the partition is a microdroplet. Preferably, a microfluidic device is used to fuse multiple droplets containing fragmented genomic DNA of at most one microbial cell with multiple droplets containing an amplification reaction mixture and at most one microbead in a certain proportion, and the fragmented molecules are barcoded within the fused droplets.

[0023] In some implementations, preferably, the droplet fusion ratio is 1:1.

[0024] In some embodiments, the microbeads comprise a plurality of nucleic acid barcode molecules linked thereto, wherein the nucleic acid barcode molecules on the same microbead have the same base sequence or the same base sequence containing non-N degenerate base symbols as barcode sequences, wherein N is any random nucleotide that can base-pair with natural nucleic acids.

[0025] In some embodiments, the microbeads are non-degradable polyacrylamide gel beads.

[0026] In some implementations, the connection between the beads and the plurality of nucleic acid barcode molecules is cut by light (such as UV).

[0027] Each type of barcode bead has a different nucleic acid barcode sequence. This ensures that the fragmented amplification products in the same droplet all originate from the same single cell and are linked to the same nucleic acid barcode molecule; that is, the fragmented amplification products in different droplets all originate from different single cells and are linked to different nucleic acid barcode molecules, allowing for labeling and differentiation during sequencing.

[0028] The assembly of the transposase complex used in the fragmentation reagent is designed to replace the ME-A sequence of the conventional transposase complex with the ME-C sequence. The nucleic acid barcode molecular structure linked on the microbeads consists of 5'-TruseqR1-barcode- and / or UMI-C sequence-3', where the UMI sequence is not required. The library constructed after barcoding the fragmentation product using the nucleic acid barcode molecular sequence on the microbeads can be used for mixed sequencing, reducing sequencing costs.

[0029] In some implementations, it further includes breaking the droplet to recover and purify the single-cell barcoded labeled molecular product within the droplet.

[0030] In some implementations, the purification method is selected from magnetic bead purification, column purification, and gel purification.

[0031] In some embodiments, the reagent used to break the droplets is fluorinated oil HFE-7500 containing 1% perfluorooctanoic acid.

[0032] In some implementations, it further includes amplifying barcoded marker molecules using adapter primers containing index tags, with P5 / P7 sequences that can bind to sequencing chips, R1SP / R2SP sequences for binding sequencing primers, and index tag sequences that can distinguish different samples at both ends of the molecule.

[0033] In some implementations, the method further includes fragment purification or sorting of the products obtained after tag amplification to obtain an efficient sequencing library of the whole genome of a single microbial cell. This efficient sequencing library is compatible with Illumina next-generation sequencers and allows for pooled sequencing, reducing sequencing costs. Attached Figure Description

[0034] The above and other features of this application will be more fully described with reference to the accompanying drawings. These drawings only depict a few embodiments of the application and should not be considered as limiting the scope of the application. The application will be described more clearly and in more detail with the aid of the drawings.

[0035] Figure 1 This is a flowchart illustrating a method for constructing a microbial single-cell genomics sequencing library according to the present invention.

[0036] Figure 2 This is a comparison of flowcharts for constructing single-cell genomics sequencing libraries of two different microorganisms.

[0037] Figure 3These are fluorescent images of amplified whole genomes of single microbial cells. The green fluorescent droplets in the image are droplets encapsulating a single microbial cell and having undergone whole genome amplification.

[0038] Figure 4 Bioanalyzer 2100 analysis of amplification results of genomic fragmentation products under different transposase input levels.

[0039] Figure 5 Bioanalyzer 2100 analysis of the amplification results of the self-assembling enzyme and Nextera transposase fragmentation products.

[0040] Figure 6 It is an image of droplets with barcoded genomes of microorganisms.

[0041] Figure 7 This is a Bioanalyzer 2100 analysis graph of a sequencing library that has not been sorted by magnetic beads.

[0042] Figure 8 This is a Bioanalyzer 2100 analysis graph of the sequencing library after magnetic bead sorting. Detailed Implementation

[0043] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0044] This invention provides a method for constructing microbial single-cell genomics sequencing libraries. This method can improve the quality of microbial single-cell whole-genome amplification, as well as genome purity and sequencing coverage. Using the transposase complex adapter sequence and library construction method designed in this invention, the resulting effective library molecules are compatible with Illumina next-generation sequencers and can be mixed with other sample libraries for sequencing, reducing sequencing costs.

[0045] The method for constructing a microbial single-cell genomics sequencing library provided by the present invention includes: 1) assigning microbial single cells to a single partition to obtain multiple independent partitions containing at most one microbial cell, and performing lysis of microbial single cells within the partitions; 2) adding an amplification reaction mixture to the partition containing the microbial single-cell genome to amplify the whole genome of the microbial single cell; 3) adding a fragmentation reagent to the partition containing the amplified whole genome product of the microbial single cell to obtain fragmented amplification products; 4) adding beads and an amplification reaction mixture to the partition containing the fragmented amplification products to barcode the fragmented amplification products, thereby obtaining the raw materials for constructing a microbial single-cell whole-genome sequencing library.

[0046] In some implementations, the partitions are microdroplets. Preferably, as shown below... Figure 1 As shown, a method for constructing a microbial single-cell genomics sequencing library includes: 1) using a microfluidic device to encapsulate a single microbial cell and cell lysis reagent into an aqueous droplet within a water-in-oil emulsion, and lysing the cell within the droplet to obtain multiple droplets containing the genomic DNA of at most one cell; 2) using a microfluidic device to fuse the multiple droplets containing the genomic DNA of at most one microbial cell with multiple droplets containing an amplification reaction mixture at a certain ratio, and amplifying the whole genome of the microorganism within the fused droplet; 3) using a microfluidic device to fuse the multiple droplets containing the amplified whole genome of at most one microbial cell with multiple droplets containing a fragmentation reaction reagent at a certain ratio, and performing a microbial genome fragmentation reaction within the fused droplet; 4) using a microfluidic device to fuse the multiple droplets containing the fragmented genomic DNA of at most one microbial cell with multiple droplets containing an amplification reaction mixture and at most one microbead at a certain ratio, and barcoding the fragmented molecules within the fused droplet to obtain the raw materials for constructing a microbial single-cell whole-genome sequencing library. Figure 2 (A) and (B) are flowcharts for library construction using the transposase complex assembled using the method of this patent and the conventional transposase complex, respectively. Libraries constructed using the conventional transposase complex cannot be used for pooled sequencing on an Illumina next-generation sequencer, increasing sequencing costs.

[0047] Example 1: Obtaining and Amplifying Microbial Single-Cell Genomes

[0048] This embodiment utilizes a droplet microfluidic device to encapsulate single cells within droplets for biological reactions, achieving high-throughput separation of microbial single cells.

[0049] Fabrication of microfluidic devices

[0050] To fabricate the microfluidic device, poly(dimethylsiloxane) (Dow Corning, Sylgard 184) was poured onto a negative photoresist (MicroChem, catalog number SU-83025) patterned on a silicon wafer using UV lithography. The PDMS device was cured in an oven for 4 hours, extracted with a metal doctor blade, and perforated with a 0.7 mm punch to create microchannel inlets and outlets. After treating the PDMS device with oxygen plasma cleaner (Harrick Plasma), the device was bonded to a glass substrate and baked at 60°C for at least 4 hours to ensure tight bonding. The channels were treated with Aquapel (PPGIndustries) and baked at 60°C for 10 minutes to make them hydrophobic.

[0051] Preparation of cell suspension

[0052] Take 500 μL each of monoclonal *E. coli* and *Bacillus subtilis* cultured in LB liquid medium, mix 1:1, and centrifuge at 10,000 g, 4°C for 5 min. After centrifugation, discard 900 μL of supernatant, add 900 μL of PBS buffer to wash the bacteria, and gently pipette to mix. Centrifuge again at 10,000 g, 4°C for 5 min. Repeat the above washing steps twice. After each washing, discard 900 μL of supernatant, add 900 μL of PBS buffer to resuspend the bacteria, and gently pipette to mix. Determine cell concentration manually under a microscope and dilute to an appropriate concentration for single-cell encapsulation. Store the cell suspension at 4°C or on ice before proceeding to the next reaction.

[0053] Single-cell lysis

[0054] Cell suspension: After cell counting, the calculated cell solution volume was transferred to a 1.5 mL centrifuge tube (Sangon Biotech). 15% of a microbial suspension additive (optiprep) was added to the total cell suspension volume, and the mixture was vortexed to obtain the cell suspension. The prepared cell suspension was stored at 4°C or on an ice box before proceeding to the next reaction.

[0055] Cell lysis buffer: Prepare 320 μL of cell lysis buffer in a 1.5 mL centrifuge tube according to the microbial lysis reagent formula shown in Table 1, and vortex to mix. Store the prepared cell lysis buffer at 4°C or on an ice box before proceeding to the next reaction.

[0056] Microfluidic cell encapsulation and lysis buffer: The prepared cell suspension, cell lysis buffer, and HFE-7500 fluorinated oil (3M) containing surfactant were loaded into separate 3mL syringes (BD) and injected into the microfluidic device at flow rates of 60, 240, and 400 μL / hr, respectively. The emulsion was collected in a PCR tube pre-filled with approximately 50 μL of mineral oil. The fluorinated oil at the bottom of the emulsion was removed by pipetting, and HFE-7500 fluorinated oil with a higher concentration of surfactant was added. After incubation at 4°C for 5 min, some fluorinated oil was removed by pipetting, ensuring the total volume of the emulsion and fluorinated oil was 50 μL or less. The PCR tube was placed in a PCR instrument, and bacterial cells were lysed according to the lysis procedure shown in Table 2. The lysed emulsion was stored at 4°C before proceeding to the next reaction.

[0057] Table 1 Formulation of Microbial Lysis Reagent Green+ buffer prepGEM Bacteria 5 Lysozyme prepGEM Bacteria 0.5 Prepgem prepGEM Bacteria 0.5 Lysostaphin Sigma 0.5 Bovine Serum Albumin Thermofisher 1 Nuclease-Free Water Thermofisher 32.5 Total 40μL

[0058] Table 2 Pyrolysis Procedure

[0059] Amplification of the whole genome of a single microbial cell

[0060] Cell lysis emulsion: Remove the mineral oil from the top of the emulsion and the fluorinated oil from the bottom of the emulsion in the PCR tube. Carefully transfer the emulsion into a 3 mL syringe containing fluorinated oil with surfactant using a pipette and a low-absorption pipette tip.

[0061] Amplification reaction mixture: Prepare 100 μL of the MDA amplification reaction mixture in a 1.5 mL centrifuge tube according to the MDA amplification reaction mixture system shown in Table 3, and vortex to mix. Store the prepared amplification reaction mixture at 4°C or on an ice box before proceeding to the next reaction step.

[0062] Table 3 MDA amplification reaction mixture system 10x Phi29 DNA polymerase buffer 16 dNTP mix (2.5mM) 2 BSA (20mg / ml) 2 Phi29 DNA polymerase 8 Random primer (100µM) 1.25 Nuclease-Free Water 70.75 Total 100μL

[0063] The random hexamer sequence is 5'- d(NNNNNN) -3' -P.

[0064] Microfluidic encapsulation of cell lysates and amplification reaction mixture: The prepared amplification reaction mixture and HFE-7500 fluorinated oil (3M) containing surfactant were loaded into separate 3mL syringes (BD). In a microfluidic device, droplets encapsulating the amplification reaction mixture were first formed, and then the droplets containing cell lysates were fused with the droplets encapsulated with the amplification reaction mixture at a certain ratio using electrodes. The emulsion was collected in a PCR tube pre-filled with approximately 50μL of mineral oil, and the fluorinated oil at the bottom of the emulsion was removed by pipetting. HFE-7500 fluorinated oil with a higher concentration of surfactant was added, and after incubation at 4°C for 5 min, some fluorinated oil was removed by pipetting, so that the total volume of the emulsion and fluorinated oil was 50μL or less. The PCR tube was placed in a PCR instrument, and the cell lysates were amplified according to the amplification program shown in Table 4. The amplified emulsion was stored at 4°C before proceeding to the next reaction.

[0065] Additionally, when visualization of microbial single-cell whole genome amplification results is required, 1X EVAGREEN can be added to the MDA amplification system. The amplified DNA products can then be stained with 1X EVAGREEN and imaged under a fluorescence microscope. Figure 3 As shown.

[0066] Table 4 MDA Amplification Procedure

[0067] Example 2: Fragmentation and Barcoding of Microbial Single-Cell Genomes

[0068] Assembly and activity assay of transposase complex

[0069] The sequence structure of the multiple nucleic acid barcode molecules linked by the beads in the existing method is: 5'-TruseqR1-barcode-UMI-Nextera R1-3', and the corresponding fragmentation transposase used is the commercially available Nextera transposase from Illumina. The final sequencing library structure is: 5'-P5-index2- Truseq R1 -barcode-UMI- Nextera R1 --- DNA Insert --- Nextera R2-index1-P7-3'. When the P5 end of a library molecule contains binding sites for both R1 sequencing primers (Truseq R1 primer and Nextera R1 primer), the library cannot function properly with an Illumina next-generation sequencer. While it's possible to replace the sequencing reagents to include only the Truseq R1 primer, this method prevents the library from being pooled with other libraries, significantly increasing sequencing costs.

[0070] In this invention, the adapter sequence used for assembly is redesigned. The sequence structure of the multiple nucleic acid barcode molecules linked on the microbeads is: 5'-Truseq R1-barcode-UMI-Nextera RC-3'. The final sequencing library structure is: 5'-P5-index2-Truseq R1-barcode-UMI-Nextera RC --- DNA Insert ---Nextera R2-index1-P7-3'. The Nextera RC and Nextera R1 sequences are different, thus avoiding the situation where two different R1 sequencing primer binding sites appear simultaneously at the P5 end of the library.

[0071] Compared to existing adapters: The adapter sequence and library preparation method designed in this invention can produce effective library molecules that are compatible with Illumina next-generation sequencers and can be mixed with other sample libraries for sequencing, eliminating the need for flow cell sequencing or user-defined sequencing reagents, thus greatly reducing sequencing costs.

[0072] The adapter assembly used for transposase assembly includes a ME-C sequence, a ME-C sequence, and a ME-reverse sequence. The ME-reverse sequence is annealed with ME-C and ME-B, respectively, to form a partially ME, partially double-stranded C-linker and a B-linker, wherein the B-linker is identical to the B-linker on the currently commercially available Illumina Nextera transposase.

[0073] Connector sequence for assembly: ME-C sequence: 5'- GTTACAGAGGCTGCAGATGTGTATAAGAGACAG -3' ME-B sequence: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'; ME-reverse sequence: 5'-phos-CTGTCTCTTATACACATCT-NH2-3'.

[0074] Joint preparation:

[0075] Sangon Biotech (Shanghai) Co., Ltd. synthesized the above ME-C, ME-B and ME-reverse sequences and used Nanjing Novizan Biotechnology Co., Ltd.'s TruePrep Tagment Enzyme (S601-01) to perform transposase self-assembly.

[0076] Dissolve ME-C, ME-B, and ME-reverse to 10 μM using Annealing Buffer. Mix equal volumes of ME-C and ME-reverse, and ME-B and ME-reverse, vortex to mix, and briefly centrifuge. Place in a PCR instrument and perform the reaction program shown in Table 5. After the reaction is complete, mix equal volumes of the two reactions to obtain the prepared adapter mixture.

[0077] Table 5 Connector preparation procedure 75 15 min 1 60 10 min 1 50 10 min 1 40 10 min 1 25 30 min 1

[0078] Transposase assembly:

[0079] Add the reaction components shown in Table 6 to a sterile PCR tube in sequence, and mix thoroughly by gently pipetting 20 times. Place the reaction tube at 30°C for 1 hour. The reaction product is the assembled transposase complex.

[0080] Table 6 Transposase Assembly Reaction System TruePrep Tagment Enzyme (500 ng / μl) 4 Connector Mixture 7 Coupling Buffer 39 Total 50μL

[0081] Enzyme activity verification:

[0082] Prepare the fragmentation reaction system in the PCR tube as shown in Table 7, vortex to mix, and incubate at 55℃ for 10 min for fragmentation reaction. Amplify the fragmented products, and detect the amplified products using a Bioanalyzer 2100. Figure 4 As shown. Figure 4 A), B), C), and D) are the PCR results of fragmentation systems 1, 3, 4, and 5, respectively. As the amount of transposase in the system increases, the fragments obtained by breaking down the substrate DNA become shorter.

[0083] Table 7 Fragmented reaction system ddH2O 6.4ul 4.4ul 3.4ul 2.4ul 5x Tagment buffer L 2ul 2ul 2ul 2ul MDA purified product (50 ng / ul) 0.6ul 0.6ul 0.6ul 0.6ul transposase complex 1ul 3ul 4ul 5ul total 10ul 10ul 10ul 10ul

[0084] The activity of self-assembled transposase was compared with that of commercially available Illumina Nextera transposase: In the same fragmentation system, equal amounts of self-assembled transposase or Illumina Nextera transposase were added for fragmentation, followed by amplification of the fragmented products. The amplified products were then detected using a Bioanalyzer 2100. Figure 5 As shown. Figure 5 A) and C), B) and D) are the fragmentation amplification results of the two transposases with equal amounts of transposase, respectively. The self-assembled transposase activity is basically consistent with that of the commercially available Illumina Nextera transposase.

[0085] Example 3 Fragmentation reaction of whole genome of microbial single cell

[0086] MDA Post-Emulsion: Remove the mineral oil from the top of the emulsion and the fluorinated oil from the bottom of the emulsion in the PCR tube. Carefully transfer the emulsion into a 3 mL syringe containing fluorinated oil with surfactant using a pipette and a low-absorption pipette tip.

[0087] Fragmentation reaction reagent: Prepare 90 μL of the fragmentation reaction mixture in a 1.5 mL centrifuge tube according to the fragmentation reaction system shown in Table 8, and vortex to mix. Store the prepared amplification reaction mixture at 4°C or on ice before proceeding to the next reaction step.

[0088] Table 8 Fragmented reaction mixture system 5x Fragmentation Buffer 24 transposase complex 12 BSA (20mg / ml) 1.8 Nuclease-Free Water 52.2 Total 90μL

[0089] Microfluidic encapsulation of whole-genome amplification products and fragmentation reaction mixtures: The prepared fragmentation reaction mixture and HFE-7500 fluorinated oil (3M) containing surfactant were loaded into separate 3mL syringes (BD). In a microfluidic device, droplets of oil-encapsulated fragmentation reaction mixtures were first formed. Then, droplets containing single-cell whole-genome amplification products were fused with droplets encapsulated with fragmentation reaction mixtures at a certain ratio using electrodes. The emulsion was collected in a PCR tube pre-filled with approximately 50μL of mineral oil. The fluorinated oil at the bottom of the emulsion was removed by pipetting. HFE-7500 fluorinated oil with a higher concentration of surfactant was added. After incubation at 4°C for 5 min, some fluorinated oil was removed by pipetting, ensuring the total volume of the emulsion and fluorinated oil was 50μL or less. The PCR tube was placed in a PCR instrument and reacted at 55°C for 10 min to fragment the genome amplification products. The fragmented emulsion was stored at 4°C before proceeding to the next reaction.

[0090] Example 4: Barcoding of Single-Cell Genome Fragmentation Reaction Products

[0091] Fragmented emulsion: Remove the mineral oil from the top of the emulsion and the fluorinated oil from the bottom of the emulsion in the PCR tube. Carefully transfer the emulsion into a 3 mL syringe containing fluorinated oil with surfactant using a pipette and a low-absorption pipette tip.

[0092] Beads: Remove beads linked to multiple nucleic acid barcode molecules at 4℃, wash three times with DNA buffer, centrifuge at 5000g for 1 min, and remove the supernatant. Transfer the beads to PE2 tubes using a syringe for later use. The nucleic acid barcode molecule sequence structure linked to the beads includes a primer sequence (Truseq R1) at the 5' end for connecting the sequencing adapter, a barcode sequence, a molecular tag sequence, and an adapter sequence at the 3' end for amplifying fragmented products.

[0093] Amplification reaction mixture: Prepare 280 μL of the pre-amplification reaction mixture in a 1.5 mL centrifuge tube according to the pre-amplification reaction mixture system shown in Table 9, and vortex to mix. Store the prepared amplification reaction mixture at 4°C or on an ice box before proceeding to the next reaction step.

[0094] Table 9 Pre-amplification reaction mixture system 2x pre-amplification buffer 200 Amplification primers (10 μM) 16 BSA (20mg / ml) 4 Nuclease-Free Water 60 Total 280μL

[0095] Microfluidic encapsulation of fragmentation reaction products, beads, and pre-amplification reaction mixture: The prepared pre-amplification reaction mixture and HFE-7500 fluorinated oil (3M) containing surfactant were loaded into separate 3mL syringes (BD). In a microfluidic device, droplets containing oil encapsulating the amplification reaction mixture and at most one bead were first formed. Then, electrodes were used to fuse the droplet containing the fragmentation reaction product with the droplet encapsulating the beads and pre-amplification reaction mixture at a certain ratio. The emulsion was collected in a PCR tube pre-filled with approximately 50μL of mineral oil, and the fluorinated oil at the bottom of the emulsion was removed by pipetting. HFE-7500 fluorinated oil with a higher concentration of surfactant was added, and after incubation at 4°C for 5 min, some fluorinated oil was removed by pipetting, so that the total volume of the emulsion and fluorinated oil was 50μL or less. The PCR tube was placed in a PCR instrument, and the single-cell genome fragmentation reaction products were amplified and barcoded according to the amplification program shown in Table 10 to obtain a single-cell sequencing library. The barcoded emulsion was stored at 4°C before proceeding to the next reaction. The microscopic image of the emulsion is shown below. Figure 6 As shown.

[0096] Table 10 Pre-amplification reaction procedure

[0097] Example 5: Construction of Microbial Single-Cell Genome Sequencing Libraries

[0098] Recovery of single-cell genome barcoding products: Carefully remove the mineral oil at the top and the fluorinated oil at the bottom of the PCR tube using a pipette. Then add 100 μL of recovery reagent (HFE-7500 containing 1% PFO) to the PCR tube, vortex for 30 seconds, and centrifuge for 1 minute. The droplets will be clearly broken, and the solution will separate into an upper layer of contents and a lower layer of fluorinated oil. Carefully remove the fluorinated oil at the bottom using a pipette. Then transfer the upper layer of contents to a centrifuge tube with a filter cartridge, centrifuge at 10000xg for 5 minutes, and remove the beads from the contents through the filter membrane to recover the DNA product.

[0099] Purification of single-cell genome barcoding products: Add 1X magnetic beads to the recovered DNA product, vortex to mix, and incubate at room temperature for 5 min to allow DNA to bind to the magnetic beads; after brief centrifugation, place on a magnetic rack and let stand for about 3 min to allow the solution to become clear, then carefully remove the supernatant; keep the sample on the magnetic rack, add 200 μL of freshly prepared 80% ethanol solution to rinse the magnetic beads, incubate at room temperature for 30 s, and carefully remove the supernatant; repeat the rinsing step once, for a total of two times; keep the sample on the magnetic rack and leave the magnetic beads open at room temperature to dry for about 3-5 min; remove the sample from the magnetic rack, add an appropriate amount of DNA elution buffer, vortex or pipette to mix thoroughly, and let stand at room temperature for 2 min; place the sample back on the magnetic rack and let stand for 3 min until the solution becomes clear, then carefully aspirate the supernatant into a new nuclease-free centrifuge tube. Quantify the purified DNA concentration using a Qubit centrifuge.

[0100] Library tag amplification of single-cell genome barcoding products: Barcoding marker molecules were amplified using P5 and P7 primers containing index tags to obtain sequencing libraries of the entire genome of microbial single cells. The libraries were then purified using 0.5X + 0.3X magnetic beads to remove primers or primer dimers. The concentration of purified DNA was quantified using a Qubit analyzer. Library molecules were quantified using an Agilent 2100 bioanalyzer and a high-sensitivity DNA chip, such as... Figure 7 This is a bioanalyzer analysis plot of a library that has not been sorted by magnetic beads. Figure 8 This is a bioanalyzer analysis diagram of the library after magnetic bead sorting. The library was then sent for next-generation sequencing.

Claims

1. A method for constructing a microbial single-cell genomics sequencing library, the method comprising: 1) Single-cell lysis: Microbial single cells are assigned to a single partition to obtain an independent partition containing at most one microbial cell, and the lysis of microbial single cells is carried out in the independent partition; 2) Whole genome amplification: Add the genome amplification reaction mixture to the lysed partitions described in 1) to amplify the whole genome of a single microbial cell; 3) Fragmentation reaction: Fragmentation reagent is added to the amplified partition described in 2) to obtain fragmented products; 4) Barcoding: Microbeads and amplification reaction mixture are added to the partition after the fragmentation reaction described in 3) to barcode the fragmentation products, thereby obtaining the raw materials for constructing a microbial single-cell whole genome sequencing library; The assembly of the transposase complex used in the fragmentation reagent is designed, replacing the ME-A sequence of the conventional transposase complex with the ME-C sequence, and the nucleic acid barcode molecule structure connected on the microbeads consists of 5'-Truseq R1-barcode- and / or UMI-C sequence-3'. The library constructed after barcoding the fragmentation reaction products using the nucleic acid barcode molecule sequence on the microbeads can be used for mixed sequencing, reducing sequencing costs; The transposase complex is self-assembled, and its linker assembly includes a ME-C sequence, a ME-B sequence, and a ME-reverse sequence, wherein the ME-C sequence replaces the ME-A sequence of a conventional transposase complex. The ME-C sequence is 5'- GTTACAGAGGCTGCAGATGTGTATAAGAGACAG-3', the ME-B sequence is 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3', the ME-A sequence is 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3', and the ME-reverse sequence is 5'-phos-CTGTCTCTTATACACATCT-NH2-3'.

2. The method according to claim 1, wherein the partition is selected from one or more of microplates, microdroplets, and microgels.

3. The method according to claim 1, wherein the lysis method is an enzymatic lysis method.

4. The method according to claim 3, wherein the reagents selected for the enzyme lysis method include lysozyme, lysozyme, Green+ buffer, and prepGEM.

5. The method according to claim 1, wherein the whole genome amplification method is selected from one or more of MDA, PTA, MALBAC, and LIANTI.

6. The method according to claim 1, wherein the microbead comprises a plurality of nucleic acid barcode molecules connected thereto, the nucleic acid barcode molecules on the microbead having the same base sequence or the same base sequence containing non-N degenerate base symbols as barcode sequences, wherein N is any random nucleotide that can base-pair with natural nucleic acids.

7. The method according to claim 2, wherein when the partition is a microdroplet, it comprises: 1) Single-cell lysis: A microfluidic device is used to encapsulate a single microbial cell and cell lysis reagent into an aqueous droplet in a water-in-oil emulsion, and the cell is lysed within the droplet to obtain multiple droplets containing the genomic DNA of at most one cell. 2) Whole genome amplification: Using a microfluidic device, multiple droplets containing the genomic DNA of at most one microbial cell are fused with multiple droplets containing an amplification reaction mixture in a certain proportion, and the whole genome of the microorganism is amplified in the fused droplets; 3) Fragmentation reaction: Using a microfluidic device, multiple droplets containing the amplified whole genome of at most one microbial cell are fused with multiple droplets containing fragmentation reaction reagents in a certain proportion, and the microbial genome fragmentation reaction is carried out in the fused droplets; 4) Barcode labeling: Using a microfluidic device, multiple droplets containing fragmented genomic DNA of up to one microbial cell are fused with multiple droplets containing an amplification reaction mixture and up to one microbead in a certain proportion, and the fragmented molecules are barcoded and labeled within the fused droplets.

8. The method according to claim 7, wherein the droplet fusion ratio is 1:

1.

9. The method of claim 7, wherein 4) further comprises releasing nucleic acid barcode molecules attached to the microbeads into the fused droplets by UV cleavage for barcode labeling of the fragmented molecules.

10. The method of claim 9, further comprising breaking the droplet to recover the single-cell barcoded marker molecule product within the purified droplet.

11. The method according to claim 10, wherein the purification method is selected from magnetic bead purification, column purification, or gel purification.

12. The method of claim 10, further comprising amplifying the barcoded marker molecule using adapter primers containing index tags, wherein the molecule is end-to-end bound with P5 / P7 sequences capable of binding to a sequencing chip, R1 SP / R2 SP sequences for binding to sequencing primers, and index tag sequences capable of distinguishing different samples.

13. The method according to claim 12, further comprising performing fragment purification or sorting on the product obtained after tag amplification to obtain an effective sequencing library of the whole genome of a single microbial cell.

14. The method according to claim 13, wherein the effective sequencing library is compatible with Illumina next-generation sequencers and is capable of mixed sequencing.