Pharmaceutical composition for inhibiting inflammation and use thereof
By combining hyaluronic acid synthesis inhibitors and ascorbyl palmitate, the synthesis and metabolism of hyaluronic acid were regulated, which solved the problem of inflammatory response in SARS-CoV-2 infection and achieved effective inhibition of inflammation caused by SARS-CoV-2, especially the abnormal increase of IL-6 and IL-8.
Patent Information
- Application Number
- CN202310900039.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-20
- Publication Date
- 2026-06-02
- Estimated Expiration
- 2043-07-20
AI Technical Summary
The role of hyaluronic acid in COVID-19 infection has not been clearly defined by current technology, and existing drugs are difficult to effectively inhibit the inflammatory response caused by COVID-19, especially the abnormal increase of IL-6 and IL-8.
By employing a combination of hyaluronic acid synthesis inhibitors and ascorbyl palmitate, this study aims to suppress inflammatory responses, including the prevention, relief, and treatment of inflammation associated with COVID-19 infection, by regulating the synthesis and metabolism of hyaluronic acid.
It significantly reduces the activity of hyaluronic acid synthase and the level of inflammatory factors, effectively inhibits inflammation caused by SARS-CoV-2 infection, especially the abnormal increase of IL-6 and IL-8, and provides therapeutic effects for systemic pneumonia.
Smart Images

Figure HDA0004353694390000011 
Figure HDA0004353694390000021 
Figure HDA0004353694390000031
Abstract
Description
Technical Field
[0001] This invention primarily relates to the pharmaceutical field, and more specifically, to a combination of a hyaluronic acid synthesis inhibitor and ascorbyl palmitate and its application in the preparation of drugs for inflammation (including COVID-19 caused by SARS-CoV-2 infection). Background Technology
[0002] With the rapid development of life sciences, more and more virus-related diseases, especially COVID-19, are attracting attention. It is well known that viruses cannot replicate and multiply outside the body; they typically require a host cell and their complete transcriptional and translational systems to complete replication and multiply, thus causing corresponding diseases. Viruses can be classified into naked viruses and enveloped viruses based on their structure. Compared to naked viruses, enveloped viruses possess an outer lipid envelope in addition to their capsid and nucleic acid. Currently, viral infection mechanisms are divided into two main categories: one is viral entry into cells via pinocytosis, and the other is viral entry into cells via membrane fusion with the assistance of receptors and adhesion factors. The former can well explain the cell infection of naked viruses, while the latter, although theoretically able to explain how almost all viruses enter cells, is too general, and the specific mechanisms of action are not yet fully understood.
[0003] The novel coronavirus, named severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) by the World Health Organization (WHO), is a novel beta-coronavirus with a genome of approximately 30 kb, encoding at least 29 proteins, including four structural proteins: spike protein, small envelope glycoprotein, membrane glycoprotein, and capsid protein. The prevailing view is that the SARS-CoV-2 spike protein induces viral infection of cells by binding to human angiotensin-converting enzyme 2 (ACE2), meaning the virus invades cells through receptor binding. Correspondingly, other SARS-CoV-2 receptors, such as NRP1 and CD147, have been discovered. Recent studies have found that the SARS-CoV-2 spike protein enhances its binding to ACE2 by binding to heparin on the cell membrane, promoting infection and suggesting that cell membrane adhesion factors play a crucial role in SARS-CoV-2 infection. Structurally, hyaluronic acid, similar to heparin, is a disaccharide unit glycosaminoglycan composed of D-glucuronic acid and N-acetylglucosamine, but whether it mediates SARS-CoV-2 infection remains unknown. In addition, severe COVID-19 patients are prone to cytokine storms, with elevated levels of cytokines such as IL-6, IL-8, and TNFα, and significantly elevated plasma hyaluronic acid. However, whether the release of inflammatory factors in COVID-19 patients is related to hyaluronic acid remains to be confirmed by further research.
[0004] Hyaluronic acid (HA) is an important component of the extracellular matrix, playing a crucial role in normal tissue function and development. This includes providing support and anchoring for cells, promoting intercellular signaling, and facilitating cell movement and migration. Its cell membrane localization provides favorable conditions for mediating SARS-CoV-2 infection. Based on molecular weight, it is classified into high molecular weight (>500 kDa) and low molecular weight (<500 kDa). The former has anti-inflammatory, damage-promoting, and anti-angiogenic effects, while the latter has pro-inflammatory and angiogenic effects. Hyaluronic acid is in a dynamic state, and its synthesis is accomplished by hyaluronic acid synthases (HAS). In humans, these are HAS1, HAS2, and HAS3. HAS1 is responsible for synthesizing low molecular weight hyaluronic acid, while HAS2 and HAS3 are responsible for synthesizing high molecular weight hyaluronic acid. These enzymes elongate HA by repeatedly adding glucuronic acid and N-acetylglucosamine to the nascent polysaccharide, allowing it to be squeezed out of the cell membrane and enter the extracellular space. The degradation of hyaluronic acid is mainly accomplished by hyaluronidase. In the human body, various hyaluronidases such as HYAL-1, HYAL-2, and HYAL-3 can degrade hyaluronic acid on the cell membrane surface and in free form. Summary of the Invention
[0005] The purpose of this invention is to provide a combination of a hyaluronic acid synthesis inhibitor and ascorbyl palmitate and its application in the preparation of drugs for inflammation (including COVID-19 caused by SARS-CoV-2 infection).
[0006] In a first aspect of the invention, the use of hyaluronic acid synthesis inhibitors and ascorbyl palmitate or their analogues is provided for the preparation of anti-inflammatory mixtures, pharmaceutical compositions or cassettes.
[0007] In one or more embodiments, the inhibition of inflammation includes: preventing, alleviating and / or treating inflammation.
[0008] In one or more embodiments, the inflammation includes systemic inflammation.
[0009] In one or more embodiments, the inflammation includes inflammation associated with SARS-CoV-2 infection.
[0010] In one or more embodiments, the inflammation includes pneumonia.
[0011] In one or more embodiments, the inflammation includes inflammation associated with elevated (including abnormally elevated) IL-6 or IL-8 levels.
[0012] In one or more embodiments, the hyaluronic acid synthesis inhibitor includes: hydroxycoumarin, metformin, choleretic acid, choleretic acid, and oxymethylamine hydrochloride.
[0013] In one or more embodiments, the ascorbyl palmitate analogue includes: sodium vitamin C (VcNa); preferably, the ascorbyl palmitate or its analogue is preferably ascorbyl palmitate (VcPAL) itself.
[0014] In one or more embodiments, the molar ratio of the hyaluronic acid synthesis inhibitor to the ascorbate palmitate or its analogue in the mixture or pharmaceutical composition is 20–20,000:5–30,000; preferably 40–15,000:8–25,000.
[0015] In one or more embodiments, the hyaluronic acid synthesis inhibitor in the mixture or pharmaceutical composition is hydroxycoumarin, used in combination with the ascorbate palmitate; the molar ratio of hydroxycoumarin to the ascorbate palmitate is 1 to 100:1; preferably 2 to 60:1 (e.g., 3 to 50:1, 4 to 40:1, 5 to 30:1, 6 to 25:1, 7 to 20:1, 8 to 15:1, 9 to 12:1; 10:1).
[0016] In one or more embodiments, the ratio of the hyaluronic acid synthesis inhibitor to the ascorbate palmitate or its analogue is 50–15000 (e.g., 80, 100, 200, 500, 600, 800, 1000, 2000, 5000, 6000, 8000, 10000, 12000): 9–24000 (e.g., 10, 15, 20, 30, 50, 80, 100, 200, 500, 600, 800, 1000, 2000, 5000, 600, 800, 10000, 12000, 15000, 18000, 20000, 22000).
[0017] In one or more preferred embodiments, the amount of hydroxycoumarin used in the hyaluronic acid synthesis inhibitor is 62.5 μM to 500 μM, and the amount of metformin used is 10 ± 5 mM.
[0018] In one or more preferred embodiments, ascorbyl palmitate or its analogues are used: VcPAL is 12.5 μM to 50 μM, VcNa is 50 μM to 1 mM, and VC is 2.5 mM to 20 mM.
[0019] In another aspect of the invention, a mixture or pharmaceutical composition for inhibiting inflammation is provided, the mixture or pharmaceutical composition comprising: a hyaluronic acid synthesis inhibitor and ascorbyl palmitate or an analogue thereof; or, the mixture or pharmaceutical composition is composed of a hyaluronic acid synthesis inhibitor and ascorbyl palmitate or an analogue thereof.
[0020] In one or more embodiments, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.
[0021] In one or more embodiments, the medicine box further includes: an instruction manual explaining a method for suppressing inflammation.
[0022] In another aspect of the invention, a kit for inhibiting inflammation is provided, the kit comprising: a container 1 or package 1 containing a hyaluronic acid synthesis inhibitor; and a container 2 or package 2 containing ascorbyl palmitate or an analogue thereof.
[0023] In another aspect of the invention, a kit for inhibiting inflammation is provided, the kit comprising: a container 1 or a package 1 containing the mixture or pharmaceutical composition for inhibiting inflammation.
[0024] In one or more embodiments, the molar ratio of hyaluronic acid synthesis inhibitor to ascorbate palmitate or its analogue in the mixture, pharmaceutical composition or kit is 20-20000:5-30000; preferably 40-15000:8-25000.
[0025] In one or more embodiments, the hyaluronic acid synthesis inhibitor is hydroxycoumarin, used in combination with the ascorbate palmitate; the molar ratio of hydroxycoumarin to the ascorbate palmitate is 1 to 100:1; preferably 2 to 60:1 (e.g., 3 to 50:1, 4 to 40:1, 5 to 30:1, 6 to 25:1, 7 to 20:1, 8 to 15:1, 9 to 12:1; 10:1).
[0026] In one or more embodiments, the dosage form of the pharmaceutical composition is: injection, infusion, tablet, capsule, pill; preferably, injection.
[0027] In one or more embodiments, the container may be, but is not limited to, an infusion bottle, a syringe, etc.
[0028] In another aspect of the present invention, a method for establishing a novel coronavirus inflammation model is provided, comprising introducing a key polynucleotide of the novel coronavirus or a construct containing the polynucleotide into cells; wherein the key polynucleotide is derived from the novel coronavirus genome and its nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:2.
[0029] In one or more embodiments, the construct is a viral vector (such as a lentiviral vector, adenovirus vector, or adeno-associated virus).
[0030] In another aspect of the invention, an isolated polynucleotide or a construct containing the polynucleotide is provided for use in preparing novel coronavirus inflammation models (such as cell models, animal models (such as cell-derived animals)); wherein the isolated polynucleotide is isolated from the novel coronavirus genome, and its nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:2.
[0031] In one or more embodiments, the novel coronavirus inflammation model shows a significant increase in hyaluronic acid synthase (significant accumulation); and / or a significant increase in inflammatory factors.
[0032] In one or more embodiments, the inflammatory factors include IL-6 and / or IL-8.
[0033] In one or more embodiments, the cells (cultures) include subcellular (cultures).
[0034] In one or more embodiments, the animal includes: tissue (culture) or animal.
[0035] In one or more embodiments, the cells include (but are not limited to): HEK293T cells, A549 cells, or Vero cells, etc.
[0036] In one or more embodiments, the animal is a non-human animal, preferably a non-human mammal, such as a rodent, and more specifically, a mouse or rat.
[0037] In another aspect of the present invention, a novel coronavirus inflammation model is provided, which is a cell model, including an exogenously (heterogeneously) introduced isolated polynucleotide or a construct containing the polynucleotide; the isolated polynucleotide is isolated from the novel coronavirus genome, and its nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:2.
[0038] In one or more embodiments, the construct is a viral vector (such as a lentiviral vector, adenovirus vector, or adeno-associated virus).
[0039] In one or more embodiments, the novel coronavirus inflammation model shows a significant increase in hyaluronic acid synthase (significant accumulation); and / or a significant increase in inflammatory factors; more preferably, the inflammatory factors include IL-6 and / or IL-8.
[0040] In another aspect of the present invention, a method for screening potential substances that inhibit novel coronavirus infection is provided, comprising: (1) providing the novel coronavirus inflammation model; and (2) treating the novel coronavirus inflammation model (1) with a candidate substance and observing changes in the model, wherein if the inflammatory phenotype can be alleviated or inhibited, the candidate substance is a potential substance for inhibiting novel coronavirus infection.
[0041] In one or more embodiments, the inflammatory phenotype includes: hyaluronic acid synthase levels; and / or, inflammatory factor levels.
[0042] In one or more embodiments, in (2), if the candidate substance causes a decrease in the level of the hyaluronic acid synthase, then the candidate substance is a potential substance for inhibiting novel coronavirus infection.
[0043] In one or more embodiments, in (2), if the candidate substance reduces the level of the inflammatory factor, then the candidate substance is a potential substance for inhibiting novel coronavirus infection.
[0044] In one or more embodiments, the inflammatory factors include IL-6 and / or IL-8.
[0045] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions, and these combinations are also included in this invention. Attached Figure Description
[0046] Figure 1 A. SARS-CoV-2 infection of Vero cells leads to increased expression of hyaluronic acid synthases HAS1, HAS2, and HAS3.
[0047] Figure 1 B. In HEK293T cells, HIS-SARS2-3 can significantly activate the expression of hyaluronic acid synthases HAS1, HAS2, and HAS3.
[0048] Figure 1 In C and HEK293T cells, HIS-SARS2-4 can significantly activate the expression of hyaluronic acid synthases HAS1, HAS2, and HAS3.
[0049] Figure 1In D and A549 cells, HIS-SARS2-3 can significantly activate the expression of hyaluronic acid synthases HAS1, HAS2, and HAS3.
[0050] Figure 1 In E and A549 cells, HIS-SARS2-3 can significantly activate the expression of hyaluronic acid synthases HAS1, HAS2, and HAS3.
[0051] Figure 2 A. Plasma hyaluronic acid levels and plasma inflammatory factor IL-6 levels in COVID-19 patients.
[0052] Figure 2 B. In HEK293T cells, HA treatment (100 μg / mL) significantly increased the levels of inflammatory factors IL-6 and IL-8.
[0053] Figure 2 In C and A549 cells, HA treatment (100 μg / mL) significantly increased the levels of inflammatory factors IL-6 and IL-8.
[0054] Figure 3 A. Effects of different concentrations of 4-MU on the expression of hyaluronidases HAS1, HAS2, HAS3 and inflammatory factors IL-6 and IL-8 in HEK293T cells.
[0055] Figure 3 Effects of different concentrations of 4-MU on the expression of hyaluronidases HAS1, HAS2, and HAS3, as well as inflammatory factors IL-6 and IL-8, in B and A549 cells.
[0056] Figure 3 C. In BEAS-2B cells, 500 μM 4-MU reduced the expression of HAS1, HAS2, HAS3 and inflammatory cytokines IL-6 and IL-8.
[0057] Figure 3 D. Metformin (10mM) significantly reduced the expression of hyaluronic acid synthase.
[0058] Figure 4 A. HEK293T-hACE2 cells were pretreated with 4-MU and then infected with SARS-CoV-2 pseudovirus (MOI = 0.05). The effect of 4-MU on viral infection was evaluated by measuring luciferase activity.
[0059] Figure 4 B. Vero cells were pretreated with 4-MU, then infected with SARS-CoV-2 (MOI = 0.05), and finally RNA was extracted. The inhibitory effect of 4-MU on viral infection was assessed by absolute quantification.
[0060] Figure 5 A. HEK293T cells were treated with hyaluronidase, and the expression of IL-8 gene induced by HIS was detected.
[0061] Figure 5 B. HEK293T cells were treated with VcPAL (12.5μM, 25μM, 50μM) and the expression of hyaluronidase HYAL3 was detected.
[0062] Figure 5 HEK293T cells were treated with C and Vc (2.5 mM and 20 mM) to detect the expression of hyaluronidase HYAL3.
[0063] Figure 5 D. HEK293T cells were treated with sodium vitamin C (VCNa, 50μM, 100μM, 200μM) and the expression of hyaluronidase HYAL3 was detected.
[0064] Figure 5 E. Effects of different concentrations of VCNa (200uM, 1mM) on IL-8 induced by hyaluronidase.
[0065] Figure 6 A. In HEK293T cells, the simultaneous use of 4-MU (500 μM) and VcPAL (50 μM) significantly reduced IL-6 expression compared with 4-MU alone.
[0066] Figure 6 B. In A549 cells, the simultaneous use of 4-MU (500 μM) and VcPAL (50 μM) reduced IL-6 expression levels more effectively than the use of 4-MU alone. Detailed Implementation
[0067] Through extensive and in-depth research and screening, the inventors discovered that the combined use of hyaluronic acid synthesis inhibitors and ascorbate palmitate or their analogues can synergistically inhibit inflammation and significantly improve the therapeutic effect of inflammation; the inflammation mentioned can include systemic inflammation and SARS-CoV-2 infection-related inflammation, including pneumonia. This invention also discloses a novel coronavirus inflammation model, obtained by stimulating cells with specially isolated polynucleotides derived from the novel coronavirus genome. The model exhibits a typical inflammatory phenotype, is stable and controllable, and is intuitive and easy to observe.
[0068] Hyaluronic acid synthesis inhibitor
[0069] In this invention, the "hyaluronic acid synthesis inhibitor" can be a selective inhibitor of hyaluronic acid biosynthesis, a hyaluronic acid synthase inhibitor, a hyaluronic acid receptor inhibitor, etc. The hyaluronic acid receptor inhibitor can be a hyaluronic acid receptor competitive binder or a hyaluronic acid receptor binding inhibitor, etc. The prerequisite is that they can inhibit the synthesis of hyaluronic acid. They can be compounds (small chemical molecules) or biomolecules. The biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level.
[0070] The hyaluronic acid synthesis inhibitors described herein can be various substances that can reduce the activity of the hyaluronic acid synthesis pathway (including proteins involved in this pathway), reduce the stability of the hyaluronic acid synthesis pathway, downregulate the expression of genes involved in the hyaluronic acid synthesis pathway, and reduce the effective duration of action of functional proteins involved in the hyaluronic acid synthesis pathway. These substances can all be used in this invention as useful substances for inhibiting hyaluronic acid synthesis, thereby enabling them to inhibit (including prevent, alleviate, or treat) inflammation. For example, the hyaluronic acid synthesis inhibitors can be: compounds, nucleic acid inhibitors, protein inhibitors, antibodies, ligands, nucleases, nucleic acid binding molecules, etc., provided that they can inhibit hyaluronic acid synthesis.
[0071] In a preferred embodiment of the present invention, the hyaluronic acid synthesis inhibitor is a small molecule compound that specifically inhibits hyaluronic acid synthesis, including: hydroxycoumarin, metformin, choleretic acid, hydroxymethylamine hydrochloride, oxymethylamine hydrochloride, etc. Through extensive screening and comparison, the inventors have found that small molecule compounds, represented by hydroxycoumarin, exhibit particularly ideal effects when used in combination with ascorbate palmitate or its analogues. The present invention may also include analogues, isomers, solvates, precursors, or salts of these small molecule compounds.
[0072] As used in this invention, "solvent" refers to a compound carrying solvent molecules, for example, the solvate may be a hydrate.
[0073] The isomers include, but are not limited to: optical isomers, such as enantiomers and diastereomers, mixtures of enantiomers including racemic mixtures, mixtures of diastereomers, and other mixtures that can be synthesized by those skilled in the art through conventional experiments.
[0074] The present invention also includes precursors of the small molecule compound, wherein a "precursor" refers to a precursor of the compound that, when taken by an appropriate method, is metabolized or chemically reacted in the patient's body to become the active compound.
[0075] In this invention, the small molecule compound may be a compound existing in pure form, or a compound with a purity greater than 85% (preferably greater than 90%, for example greater than 95%, 98%, 99%).
[0076] Knowing its chemical structure, the small molecule compound can be obtained through chemical synthesis.
[0077] Ascorbyl palmitate or its analogues
[0078] The inventors have discovered that ascorbyl palmitate or its analogues exhibit particularly ideal effects when used in combination with small molecule compounds, such as hydroxycoumarin.
[0079] Ascorbyl palmitate is a compound synthesized from palmitic acid and ascorbic acid. It has been used in the field for nutritional fortification applications, but little is known about its therapeutic effects.
[0080] This invention may also include analogs, isomers, solvates, precursors, or salts of ascorbate palmitate. The isomers, solvates, precursors, or salts are defined as described above.
[0081] In some embodiments, the ascorbate palmitate analogues include sodium vitamin C (VcNa).
[0082] Combined use of hyaluronic acid synthesis inhibitors and ascorbyl palmitate
[0083] This invention provides a method of combined drug administration, including a method of administration using a hyaluronic acid synthesis inhibitor in combination with ascorbyl palmitate (or its analogue).
[0084] In their research, the inventors first discovered that hydroxycoumarin can inhibit inflammation. Furthermore, after in-depth screening of many candidates, the inventors found that the combined use of hyaluronic acid synthesis inhibitors and ascorbyl palmitate (or its analogues) has an extremely excellent inhibitory effect on inflammation. The combination of the two has a significant synergistic effect.
[0085] Therefore, the present invention provides the use of hyaluronic acid synthesis inhibitors and ascorbyl palmitate (or its analogues) for the preparation of mixtures, pharmaceutical compositions or cassettes for treating inflammation.
[0086] During administration, the two can be administered separately or sequentially; or they can be administered simultaneously. It should be understood that multiple administration methods are included in this invention.
[0087] This invention provides a mixture of small molecule compounds containing: a hyaluronic acid synthesis inhibitor and ascorbyl palmitate (or its analogue) as active components. Preferably, in the mixture, the molar ratio of the hyaluronic acid synthesis inhibitor to the ascorbyl palmitate (or its analogue) can be 20–20000:5–30000; more preferably, it is 40–15000:8–25000.
[0088] The present invention provides a pharmaceutical composition comprising: (a) an effective amount of a hyaluronic acid synthesis inhibitor; (b) an effective amount of ascorbyl palmitate (or an analogue thereof); and (c) a pharmaceutically acceptable carrier or excipient.
[0089] In this invention, the term "containing" indicates that various ingredients may be used together in the mixtures or compositions of this invention. Therefore, the terms "consistent with..." and "composed of..." are included in the term "containing".
[0090] Although the mixtures or compositions of the present invention may include multiple components, unless otherwise stated, the active ingredients are primarily or solely the hyaluronic acid synthesis inhibitor and the ascorbyl palmitate (or its analogue).
[0091] In this invention, a "pharmaceuticalally acceptable" ingredient is a substance that is suitable for humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., has a reasonable benefit / risk ratio.
[0092] In this invention, a "pharmaceutically acceptable carrier" is a pharmaceutically acceptable solvent, suspending agent, or excipient used to deliver the active ingredient of this invention to animals or humans. A "pharmaceutically acceptable carrier" can be a liquid or a solid.
[0093] The pharmaceutical compositions or mixtures of the present invention can be formulated into any conventional dosage form using conventional methods. Dosage forms can be diverse, as long as they enable the active ingredient to effectively reach the mammalian body. Examples include: injections, infusions, tablets, capsules, and pills. The active ingredient can be contained in a suitable solid or liquid carrier or diluent.
[0094] The mixture or pharmaceutical composition of the hyaluronic acid synthesis inhibitor and the ascorbyl palmitate (or its analogue) described in this invention may also be stored in a sterile instrument suitable for injection or infusion. As a common application method, in the pharmaceutical compositions of this invention, the hyaluronic acid synthesis inhibitor and ascorbyl palmitate (or its analogue) may constitute 0.01-20% of the total weight of the pharmaceutical composition as active ingredients, with the remainder being a pharmaceutically acceptable carrier.
[0095] The effective doses of the hyaluronic acid synthesis inhibitors and ascorbyl palmitate (or their analogues) used may vary depending on the mode of administration and the severity of the disease being treated. When necessary, the hyaluronic acid synthesis inhibitors and ascorbyl palmitate (or their analogues) may also be administered in combination with other active ingredients or drugs.
[0096] The present invention also provides a medicine box for treating inflammation, the medicine box comprising: a container 1, and a hyaluronic acid synthesis inhibitor disposed in the container 1; and a container 2, and ascorbyl palmitate (or its analogue) disposed in the container 2.
[0097] The hyaluronic acid synthesis inhibitor and ascorbyl palmitate (or its analogues) mentioned above are both small molecule compounds. Therefore, the medicine box may also contain a mixture of the hyaluronic acid synthesis inhibitor and ascorbyl palmitate (or its analogues), wherein the content of the hyaluronic acid synthesis inhibitor and ascorbyl palmitate (or its analogues) is as described above.
[0098] In addition, the medicine box may also contain some auxiliary medication materials, such as syringes for injection.
[0099] In addition, the medicine box may also contain instructions for use, explaining the method of suppressing inflammation using the combined drug method of the present invention.
[0100] Inflammation models, their preparation and application
[0101] This invention also establishes a novel coronavirus inflammation model, obtained by stimulating cells with specially isolated polynucleotides derived from the novel coronavirus genome. The model exhibits a typical inflammatory phenotype, is stable and controllable, and is intuitive and easy to observe. The inflammatory phenotype includes a significant increase in hyaluronic acid synthase (significant accumulation); and / or a significant increase in inflammatory factors.
[0102] As used in this invention, "exogenous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein / gene and its host. For example, although the host itself may contain the corresponding gene or produce the corresponding protein, when a synthesized / recombined gene / protein is introduced into a host cell through genetic engineering methods, it is "exogenous" to that host cell. The term "exogenous" includes "heterogeneous." Heterogeneous nucleic acids or proteins are usually not present in the host cell itself.
[0103] This invention discloses for the first time the use of isolated polynucleotides, as shown in SEQ ID NO:1 or SEQ ID NO:2, for constructing a novel coronavirus inflammation model. The inventors found that using the full length of SEQ ID NO:1 or SEQ ID NO:2 as a whole to build the model yields the most ideal inflammation model; further truncated fragments are insufficient. For example, the sequences at both ends are beneficial for better representing the inflammatory phenotype of the inflammation model.
[0104] In a preferred embodiment of the present invention, the polynucleotide is introduced into an expression vector to obtain a suitable construct. Preferably, the expression vector is a viral vector.
[0105] In a preferred embodiment of the present invention, the viral vector carrying multiple nucleotides is introduced into cells to exert a stimulating effect and form cells with a typical phenotype.
[0106] The inflammation model constructed in this invention can be used for the screening and testing of specific drugs. During drug screening, candidate substances or therapeutic agents refer to substances known to possess certain pharmacological activities or substances currently being tested that may possess certain pharmacological activities, including but not limited to nucleic acids, proteins, carbohydrates, chemically synthesized small or large molecular compounds, and cells. The administration routes for candidate substances or therapeutic agents can be oral, intravenous, intraperitoneal, subcutaneous, spinal, or direct intracerebral injection.
[0107] The inflammation model constructed in this invention can serve as a powerful tool for scientific research and new drug evaluation.
[0108] Those skilled in the art will understand that due to the complexity of the body's genes, the influence of multiple signaling pathways on diseases, and the existence of the body's own compensatory or repair mechanisms, it is difficult to obtain inflammatory models that present typical disease symptoms. This invention, through optimized design, overcomes these technical challenges.
[0109] In the study of disease mechanisms, the inflammation model constructed using this invention can be used to investigate disease mechanisms, explore key factors leading to inflammatory phenotypes, and discover intermediate mechanisms that can prevent or delay the development of such diseases. The model system of this invention helps to better understand inflammatory symptoms and to explore / identify candidate substances / therapeutic agents that can prevent, delay, or reverse disease processes.
[0110] The inflammation model described is physiologically similar to the human body and supports long-term sampling, detection, and tracking, which is beneficial for advancing new drug development. In this invention, there are no particular limitations on the types of candidate substances used for drug testing; they can be obtained from a variety of sources, including synthetic or natural compound libraries. For example, there are various methods for the random and directed synthesis of a variety of organic compounds and biomolecules, including the expression of random oligonucleotides and oligopeptides; or, natural compound libraries in the form of bacterial, fungal, plant, and animal extracts can be obtained or readily generated. Furthermore, libraries and compounds generated by natural or synthetic methods can be readily modified by conventional chemical, physical, and biochemical methods and can be used to generate combinatorial libraries. Known pharmacological reagents can be chemically modified (e.g., acylation, alkylation, esterification, amidation, etc.) to generate structural analogs.
[0111] The method for preparing the inflammatory model presented in this invention is simple to operate, and the resulting inflammatory model has good stability. It can well simulate the inflammatory phenotype of human / animals and the phenotypic changes are easy to observe, providing a new approach for the study of the pathogenesis mechanism of this type of inflammation, drug screening, and clinical treatment.
[0112] Based on the method of this invention, this invention also provides a kit for preparing inflammatory models of inflammatory diseases, comprising: isolated polynucleotides or constructs containing such polynucleotides. Preferably, it may also include suitable cells, preferably human cells, such as, but not limited to, HEK293T cells, A549 cells, or Vero cells.
[0113] The kit may also include an instruction manual describing the method for preparing the inflammation model of the present invention, so as to facilitate application by those skilled in the art.
[0114] Having obtained the inflammation model of the present invention, substances of interest can be screened based on this model, which can (or potentially can) alleviate or treat inflammatory diseases. After screening, truly useful drugs can be found from the substances of interest.
[0115] Therefore, the present invention also provides a method for screening potential substances (potential drugs), the method comprising: (1) preparing the inflammation model using the method described above or a kit; (2) administering the candidate substance to the inflammation model of (1) and observing whether the candidate substance has an alleviating or therapeutic effect on the inflammatory disease; if the inflammatory phenotype of the inflammation model is observed to be alleviated, then the candidate substance is a substance for alleviating or treating the inflammatory disease.
[0116] According to the inflammatory model of the present invention, the observation of whether the candidate substance has a mitigating or inhibitory effect on inflammatory diseases includes (but is not limited to) analyzing the following phenotypes: hyaluronic acid synthase level; and / or, inflammatory cytokine level. Wherein, if the candidate substance reduces the hyaluronic acid synthase level, it indicates that the candidate substance is a potential substance for inhibiting novel coronavirus infection. Alternatively, if the candidate substance reduces the inflammatory cytokine level (statistically significant reduction), it indicates that the candidate substance is a potential substance for inhibiting novel coronavirus infection; more preferably, the inflammatory cytokines include IL-6 and / or IL-8.
[0117] In a preferred embodiment of the present invention, during screening, a control group may be set up to make it easier to observe changes in the inflammatory phenotype. The control group may be the inflammatory model without the addition of the candidate substance.
[0118] As a preferred embodiment of the present invention, the method further includes: conducting further cell experiments and / or animal experiments and / or clinical trials on the obtained potential substances (potential drugs) to further select and identify truly useful substances (drugs).
[0119] On the other hand, the present invention also provides potential substances of interest obtained using the aforementioned screening method. These initially screened substances can form a screening library, from which relatively ideal, safe substances that can ultimately be screened out can be identified as having a real effect on alleviating or treating inflammatory diseases.
[0120] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, or according to the manufacturer's recommendations.
[0121] Materials and methods
[0122] 1. Cell Culture
[0123] HEK293T, HEK293T-hACE2, BEAS-2B, and A549 cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum and 1% penicillin-dextrose antibiotics. HUVEC cells were cultured in commercially available complete medium, and Vero cells were cultured in MEM complete medium. hACE2 (GenBank accession number NM_021804.3) was recombinantly expressed in HEK293T cells to obtain HEK293T-hACE2.
[0124] Cells were cultured at 37°C and 5% CO2, and appropriate amounts of cells were seeded into different well plates according to the experimental purpose.
[0125] 2. Virus infection of cells
[0126] Lentivirals overexpressing EC-SARS2-1 and EC-SARS2-2 were constructed.
[0127] The EC-SARS2-1 sequence fragment of the novel coronavirus (RefSeq:NC_045512.2; genome positions 6701-6851; this sequence is generally conserved across different SARS variants):
[0128] CTTAACAAAGTTGTTAGTACAACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGA(SEQ ID NO:1)
[0129] The lentiviral vector pCDH was introduced.
[0130] The EC-SARS2-2 sequence fragment of the novel coronavirus (GenBank: NC_045512.2; genome positions 29812-29894):
[0131] AAAATTAATTTTAGTAGTGCTATCCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 2)
[0132] The lentiviral vector pCDH was introduced.
[0133] HEK293T and A549 cells were infected separately, and cells were collected at 72h or 96h depending on the lentivirus infection status.
[0134] In addition, gene expression was detected in Vero cells 48 hours after infection with the novel coronavirus (GenBank:MT121215.1).
[0135] 3. Cell treatment with hyaluronic acid and hyaluronidase
[0136] Low molecular weight hyaluronic acid (200-400kDa) was used to treat HEK293T and A549 cells at 100μg / mL for 2-4 hours before the samples were collected.
[0137] HEK293T cells were treated with hyaluronidase at a final concentration of 25 U / mL for 4 h, and the expression of inflammation-related genes was detected by RT-qPCR.
[0138] 4. Cell treatment with 4-MU and metformin
[0139] HEK293T cells and A549 cells were treated with 4-MU at concentrations of 62.5 μM, 125 μM, 250 μM, and 500 μM, respectively, and gene expression was detected after 24 h or 48 h.
[0140] HEK293T cells were treated with 10mM metformin, and samples were collected and gene expression was detected after 48 hours.
[0141] A549 and BEAS-2B cells were treated with 500 μM 4-MU, and gene expression was detected at 24 h or 48 h.
[0142] HEK293T and A549 cells overexpressing EC-SARS2-1 and EC-SARS2-2 were treated with 500 μM 4-MU, and gene expression was detected after 48 h.
[0143] HEK293T-hACE2 and Vero cells were pretreated with 500 μM 4-MU for 24 h, and then infected with SARS-CoV-2. The viral load of SARS-CoV-2 was assessed by RFU detection and RT-qPCR 48 h post-infection.
[0144] 5. Treatment of cells with vitamin C, vitamin C, and sodium vitamin C.
[0145] An appropriate amount of HEK293T cells were seeded into a six-well plate, and the HEK293T cells were treated with VcPAL at concentrations of 12.5 μM, 25 μM, and 50 μM the next day.
[0146] HEK293T cells were treated with vitamin C at 2.5 mM and 20 mM, respectively.
[0147] HEK293T cells were treated with sodium vitamin C (VcNa) at 50 μM, 100 μM, and 200 μM, and gene expression was detected after 24 h or 48 h.
[0148] 6. Treatment of cells with a combination of 4-MU and VcPAL
[0149] HEK293T and A549 cells were seeded in six-well plates. The next day, the cells were treated with 500 μM 4-MU, 50 μM VcPAL, and a combination of the two drugs, respectively. The cells were lysed and RNA was extracted after 24 h. The expression of inflammatory genes was detected by RT-qPCR.
[0150] 7. Quantitative Real-Time PCR (RT-qPCR)
[0151] For cell samples, RNA was directly lysed with Trizol and extracted. For tissue samples, RNA was extracted using Trizol after grinding with liquid nitrogen. Total RNA was treated with DNase for reverse transcription and quantitative PCR. GAPDH was used as an internal control to assess gene expression or viral load.
[0152] Example 1: Activation of hyaluronic acid synthase expression induced by SARS-CoV-2 fragments
[0153] Under P3 laboratory conditions, Vero cells were infected with SARS-CoV-2 (MOI = 0.05). Cells were collected after infection, RNA was extracted, and RNA expression was analyzed. Results are as follows: Figure 1 A. SARS-CoV-2 infection of Vero cells caused an increase in the expression of hyaluronic acid synthases HAS1, HAS2, and HAS3.
[0154] In addition, the inventors packaged lentiviruses for expressing the viral fragments EC-SARS2-1 and EC-SARS2-2 into HEK293T cells and collected the viral fluid. After infecting HEK293T and A549 cells for 72 hours, RNA was extracted, and hyaluronic acid synthase expression was detected by RT-qPCR. Similar to the results of SARS-CoV-2 infection, in HEK293T cells, such as... Figure 1 BC, EC-SARS2-1, and EC-SARS2-2 can all significantly activate the expression of hyaluronic acid synthases HAS1, HAS2, and HAS3.
[0155] In A549 cells, EC-SARS2-1 significantly activated the expression of hyaluronic acid synthases HAS1 and HAS2, such as Figure 1 D. EC-SARS2-2 significantly activated the expression of hyaluronic acid synthases HAS1, HAS2, and HAS3 in A549 cells, such as Figure 1 E.
[0156] Therefore, the increase in hyaluronic acid synthase caused by SARS-CoV-2 infection is due to the activating effect of SARS-CoV-2 fragments.
[0157] Example 2: Hyaluronic acid accumulation induced by SARS-CoV-2 fragments leads to SARS-CoV-2 inflammatory response.
[0158] Hyaluronic acid synthases HAS1, HAS2, and HAS3 are responsible for synthesizing hyaluronic acid.
[0159] The inventors treated HEK293T and A549 cells with 100 μg / mL of low molecular weight hyaluronic acid (HA, 200-400 kDa) to simulate elevated hyaluronic acid levels. According to literature reports, inflammatory factors such as IL-6 and IL-8 are significantly elevated in COVID-19 patients.
[0160] The inventors discovered a close correlation between plasma hyaluronic acid (HA) levels and plasma IL-6 levels in COVID-19 patients. Using 120 ng / mL as a cutoff point, COVID-19 patients with HA levels greater than 120 ng / mL showed significantly elevated levels of the inflammatory factor IL-6. Figure 2 A.
[0161] like Figure 2 B. In HEK293T, HA treatment significantly increased the levels of inflammatory factors IL-6 and IL-8.
[0162] Similarly, HA treatment also caused an increase in the levels of inflammatory factors IL-6 and IL-8 in A549 cells, such as Figure 2 C.
[0163] Therefore, the accumulation of hyaluronic acid leads to an inflammatory response in COVID-19.
[0164] According to Example 1, the SARS-CoV-2 fragment induces an increase in hyaluronic acid synthase, which in turn increases the accumulation of hyaluronic acid. Therefore, SARS-CoV-2 fragment-induced hyaluronic acid accumulation can lead to the inflammatory response associated with SARS-CoV-2.
[0165] Example 3: Substances that reduce the expression of hyaluronic acid synthase and COVID-19-related inflammatory factors
[0166] 1, 4-MU
[0167] 4-MU is an inhibitor of hyaluronic acid synthesis. The inventors evaluated the effects of 4-MU on the expression of hyaluronidase and COVID-19-related inflammatory factors in HEK293T and MRC5 cells, respectively.
[0168] In HEK293T cells, as low as 62.5 μM of 4-MU could inhibit the expression of hyaluronidase HAS2 and reduce the expression of the inflammatory cytokine IL-6, while 500 μM of 4-MU could significantly inhibit the expression of hyaluronidases HAS1, HAS2, and HAS3, as well as the expression of inflammatory cytokines IL-6 and IL-8. Figure 3 A.
[0169] In A549 cells, as low as 62.5 μM of 4-MU could inhibit the expression of hyaluronidase HAS1 and reduce the expression of inflammatory cytokines IL-6 and IL-8. Conversely, 500 μM of 4-MU significantly inhibited the expression of hyaluronidases HAS1, HAS2, and HAS3, as well as the expression of inflammatory cytokines IL-6 and IL-8. Figure 3 B.
[0170] The inventors treated BEAS-2B lung epithelial cells with 500 μM 4-MU. In BEAS-2B cells, 500 μM 4-MU also reduced the expression of HAS1, HAS2, HAS3, and the inflammatory factors IL-6 and IL-8. Figure 3 C.
[0171] 2. Metformin
[0172] The inventors evaluated the effects of metformin on the expression of hyaluronidase and COVID-19-related inflammatory factors in HEK293T cells.
[0173] The results showed that metformin could also significantly reduce hyaluronic acid synthase expression, such as Figure 3 D.
[0174] Therefore, 4-MU and metformin can inhibit the increase of hyaluronic acid-related inflammatory factors caused by hyaluronic acid by reducing the expression of hyaluronic acid synthase in different cells, suggesting that hyaluronic acid synthesis inhibitors are effective drugs for the cytokine storm caused by COVID-19 infection.
[0175] Example 4: Hyaluronic acid synthesis inhibitor 4-MU inhibits SARS-CoV-2 infection in cells.
[0176] The inventors analyzed the structure of hyaluronic acid, which is composed of D-glucuronic acid and N-acetylglucosamine. However, the mechanism by which it interacts with viruses, particularly SARS-CoV-2, remains unclear. Based on their analysis of the structure and cellular distribution of hyaluronic acid, the inventors further analyzed the structural and functional proteins of the SARS-CoV-2 virus itself, speculating that hyaluronic acid can interact with the S protein, mediating the infection of the novel coronavirus.
[0177] The inventors pretreated HEK293T-hACE2 cells with 500 μM 4-MU for 48 h, then infected them with SARS-CoV-2 pseudovirus (MOI = 0.05). The effect of 4-MU on viral infection was assessed by measuring luciferase activity. The results showed that luciferase activity was significantly reduced after 4-MU treatment, suggesting that 4-MU can inhibit SARS-CoV-2 infection. Figure 4 A.
[0178] Similarly, Vero cells were pretreated with 500 μM 4-MU for 48 h, then infected with SARS-CoV-2 (MOI = 0.05), and finally RNA was extracted. The inhibitory effect of 4-MU on viral infection was assessed by absolute quantification. The results showed that 4-MU treatment significantly reduced the copy number of SARS-CoV-2. Figure 4 B.
[0179] Therefore, 4-MU treatment can inhibit SARS-CoV-2 infection or may be used to prevent SARS-CoV-2 infection.
[0180] Example 5: Screening of substances that reduce the release of inflammatory factors induced by fragments of the novel coronavirus.
[0181] Although 4-MU treatment can inhibit SARS-CoV-2 infection, its effectiveness needs further improvement. Through extensive research, screening, and experimentation, the applicant discovered that vitamin C, sodium vitamin C, or VcPAL have a significant synergistic effect with 4-MU.
[0182] The inventors treated HEK293T cells with 25 U / mL hyaluronidase and simultaneously detected HIS-induced IL-8 gene expression. Figure 5 A. Hyaluronidase treatment significantly increased the inflammatory factor IL-8 induced by COVID-19 HIS, suggesting that hyaluronidase activity affects the increase of inflammatory factors.
[0183] The inventors treated HEK293T cells with vitamin C, sodium vitamin C, or VcPAL, respectively, and simultaneously detected the expression of hyaluronidase HYAL3 and inflammatory factors. Figure 5 B. The expression level of HYAL3 is inversely proportional to the concentration of VcPAL, that is, as the concentration of VcPAL increases, the expression of HYAL3 decreases significantly.
[0184] Similarly, 20 mM vitamin C can also significantly reduce the expression of hyaluronidase, such as Figure 5 C.
[0185] Although low concentrations of sodium vitamin C (VCNa) did not inhibit the expression of hyaluronidase, such as Figure 5 D. However, 1 mM VMCNa can significantly inhibit the increase in IL-8 induced by hyaluronidase, such as Figure 5 E. This indicates that high concentrations of VCNa (≥1 mM) can significantly reduce the inflammatory response.
[0186] Example 6: The combination therapy is more effective in reducing the inflammatory response.
[0187] To compare the effects of the combined use of hyaluronic acid synthesis inhibitor 4-MU and VcPAL versus their individual use in reducing inflammatory factors induced by SARS-CoV-2 infection, the inventors treated HEK293T cells and A549 cells with the corresponding drugs and simultaneously detected the expression of SARS-CoV-2-related inflammatory factor IL-6.
[0188] like Figure 6 In HEK293T cells, the combined use of 4-MU and VcPAL significantly reduced IL-6 expression compared to 4-MU alone.
[0189] In A549 cells, the simultaneous use of 4-MU and VcPAL significantly reduced IL-6 expression levels compared to 4-MU alone, with remarkably significant effects. Figure 6 B.
[0190] Therefore, vitamin C, sodium vitamin C, or VcPAL have a very significant synergistic effect with 4-MU.
[0191] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims. Furthermore, all documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference.
Claims
1. Uses of hyaluronic acid synthesis inhibitors and ascorbyl palmitate in the preparation of anti-inflammatory mixtures, pharmaceutical compositions or kits; The inflammation described is associated with elevated IL-6 levels. In the mixture or pharmaceutical composition, the hyaluronic acid synthesis inhibitor is hydroxycoumarin, and its molar ratio with the ascorbate palmitate is 20-20000 : 5-30000; The inflammation described is inflammation associated with SARS-CoV-2 infection.
2. The use as described in claim 1, characterized in that, The inflammation includes pneumonia.
3. The use as described in claim 1, characterized in that, In the mixture or pharmaceutical composition, the molar ratio of hydroxycoumarin to ascorbyl palmitate is 40–15000 : 8–25000.
4. The use as described in claim 3, characterized in that, The molar ratio of the hydroxycoumarin to the ascorbate palmitate is 1 to 100:
1.
5. The use as described in claim 4, characterized in that, The molar ratio of the hydroxycoumarin to the ascorbate palmitate is 2 to 60: 1.
Citation Information
Patent Citations
Medicine for treating atypical pneumonia and complications thereof caused by coronavirus, and application of medicine
CN112007158A