A magnetically targeted engineered extracellular vesicle loaded with hepatocyte-responsive mRNA and its construction method and application

Abstract

The present invention provides a kind of magnetic targeting, engineered extracellular vesicle loaded with hepatocyte responsive mRNA and its construction method and application, which belongs to the field of biomedicine technology. A kind of engineered extracellular vesicle, including genetically engineered extracellular vesicles, the surface of which is coupled with transferrin-modified superparamagnetic iron oxide nanoparticles and loaded with an agonist of the pro-apoptotic protein BAX; PTGFRN (Δ687) ‑ MCP fusion protein is expressed on the extracellular vesicle membrane, and MCPRNA binding protein increases the loading capacity of the extracellular vesicle to iBaxmRNA containing miR ‑ 122 recognition site; The agonist of the pro-apoptotic protein BAX is embedded in the phospholipid bilayer of the extracellular vesicle. The preparation method of the engineered extracellular vesicle of the present invention is simple, has the advantages of aortic plaque magnetic targeting, efficient nucleic acid drug loading, low side effects, etc., and provides a reference for the treatment of atherosclerosis and other age-related diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an engineered extracellular vesicle that is magnetically targeted and loaded with hepatocyte-responsive mRNA, as well as a construction method and application thereof. Background Art

[0002] Atherosclerosis is a vascular disease that poses a serious threat to human life and health, characterized by abnormal lipid metabolism and chronic inflammation. Currently, the mainstream treatments for atherosclerosis mainly include preventive lipid-lowering therapy and therapeutic anti-inflammatory strategies, but more effective treatment options are still greatly needed. Recent studies have found that a large number of senescent cells are present in atherosclerotic plaques, which are positively correlated with plaque instability factors. Senescent cells in plaques can aggravate chronic inflammation and accelerate the progression of atherosclerosis by releasing matrix remodeling proteases, chemokines, cytokines, growth factors and other SASPs. Therefore, local cellular senescence is a common mechanism and key upstream driving factor for the occurrence and development of atherosclerotic plaques. Targeted elimination of this group of senescent cells is expected to reverse the process of atherosclerosis.

[0003] Cellular senescence is a condition characterized by permanent cell cycle arrest caused by cellular stress, often accompanied by the secretion of numerous proinflammatory phenotypes. Senescent cells resist apoptosis by upregulating pro-survival pathways, such as those in the B-cell lymphoma-2 (BCL-2) family of proteins. Currently, senolytics, anti-aging drugs, primarily eliminate senescent cells by inhibiting pro-survival pathways ("inhibitors"). However, senolytics, including dasatinib (D), quercetin (Q), and navitoclax (N), remain limited in their ability to eliminate specific types of senescent cells. To improve the efficacy of senescent cell clearance, multiple single-target drugs or drugs targeting multiple pro-survival targets may be needed. However, such drug combinations can result in significant side effects, including thrombocytopenia and neutropenia. Therefore, developing a pro-apoptotic gene expression system that effectively kills senescent cells is a potential strategy for efficient senescent cell elimination.

[0004] BCL-2 associated X protein (BAX) is a key pro-apoptotic protein that plays a crucial role in regulating the mitochondrial apoptosis pathway. Elevating intracellular levels of active BAX could trigger apoptosis in a broad spectrum of senescent cells, regardless of their cell origin. Therefore, delivering Bax mRNA together with the BAX agonist BTSA1 to senescent cells may represent a novel approach to clear senescent cells ("agonist").

[0005] Superparamagnetic iron oxide nanoparticles (SMNs) have recently garnered significant attention in the field of targeted drug delivery due to their advanced targeting capabilities, biodegradability, biocompatibility, and low toxicity. This magnetic targeting capability, independent of cell type but rather dependent on spatial localization within lesion tissue, makes it a suitable approach for delivering drugs to senescent cells within plaques. EVs, with diameters ranging from 30 to 150 nm, exhibit excellent biocompatibility and circulatory stability, making them ideal for carrying protein- and nucleic acid-based drugs. Therefore, engineered EVs internally loaded with Bax mRNA and coupled to SMNs on their membrane surface could represent a promising therapeutic strategy for atherosclerosis.

[0006] However, even with targeted delivery, nanoparticles, including EVs, inevitably accumulate in the liver, and when Bax mRNA is overdelivered, it can cause liver damage. Therefore, it is imperative to inhibit BAX translation in hepatocytes to avoid potential toxicity. MicroRNA (miRNA) is an important regulator of gene expression that can destabilize target mRNA or inhibit its translation. miR-122-5p (miR-122) is a liver-specific miRNA that can be abundant in adult hepatocytes at a level of 50,000 to 82,000 copies. This suggests that by engineering the addition of a miR-122 recognition site to the 3'-UTR of Bax mRNA (termed iBax mRNA), it is possible to engineer a hepatocyte-responsive mRNA that inhibits miR-122 translation. Summary of the Invention

[0007] In view of this, the purpose of the present invention is to provide a magnetically targeted engineered extracellular vesicle loaded with hepatocyte-responsive mRNA, which can not only efficiently eliminate senescent cells but also avoid hepatocyte damage, providing a new strategy for the treatment of atherosclerosis and other age-related diseases.

[0008] The present invention provides an engineered extracellular vesicle, comprising a genetically engineered extracellular vesicle, the surface of which is coupled with transferrin-modified superparamagnetic iron oxide nanoparticles and an agonist loaded with a pro-apoptotic protein BAX;

[0009] The genetically engineered extracellular vesicle membrane expresses PTGFRN (Δ687)-MCP fusion protein, and the MCP RNA binding protein improves the loading of the extracellular vesicle onto iBax mRNA containing the MS2 sequence and the miR-122 recognition site;

[0010] The agonist of the pro-apoptotic protein BAX is embedded in the phospholipid bilayer of genetically engineered extracellular vesicles.

[0011] Preferably, the nucleotide sequence of the scaffold protein PTGFRN (Δ687) is as shown in SEQ ID NO: 5;

[0012] The nucleotide sequence of the MCPRNA binding protein is as shown in SEQ ID NO: 6;

[0013] The DNA sequence of Bax in the iBax mRNA molecule is as shown in SEQ ID NO: 7;

[0014] The nucleotide sequence of the miR-122 recognition site in the iBax mRNA molecule is as shown in SEQ ID NO: 8;

[0015] The DNA sequence of the MS2 sequence in the iBax mRNA molecule is shown in SEQ ID NO:9.

[0016] Preferably, TfR is overexpressed in the genetically engineered extracellular vesicles;

[0017] The genetically engineered extracellular vesicles are coupled to superparamagnetic iron oxide nanoparticles via TfR-Tf;

[0018] The nucleotide sequence of TfR is shown in SEQ ID NO: 10.

[0019] Preferably, the diameter of the superparamagnetic iron oxide nanoparticles is preferably 5 to 15 nm.

[0020] The present invention provides a method for constructing the engineered extracellular vesicles, comprising the following steps:

[0021] The Bax CDS fragment, miR-122 recognition site, and MS2 sequence were cloned into a plasmid to form the iBax vector;

[0022] The TfR CDS fragment was cloned into a plasmid to form a TfR vector;

[0023] The PTGFRN (Δ687) CDS fragment and the MCPCDS fragment were cloned into a plasmid to obtain the PTGFRN-MCP vector;

[0024] The PTGFRN-MCP vector, iBax vector and TfR vector were co-transfected into mammalian cells, and iBax@EV was obtained by cell culture and isolation of extracellular vesicles. TfR ;

[0025] iBax@EV TfRThe first co-incubation with transferrin-modified superparamagnetic iron oxide nanoparticles resulted in iBax@EV SMN ;

[0026] The iBax@EV SMN A second co-incubation with an agonist of the pro-apoptotic protein BAX was performed to obtain engineered extracellular vesicles (EVs). iTx .

[0027] Preferably, in the iBax vector, the exogenous inserted fragment is a fusion fragment formed by the Bax CDS fragment, the miR-122 recognition site fragment and the MS2 sequence, and the nucleotide sequence is shown in SEQ ID NO: 1;

[0028] In the TfR vector, the exogenous insert is a TfR CDS fragment carrying an enzyme cleavage site, and the nucleotide sequence is shown in SEQ ID NO: 3;

[0029] In the PTGFRN-MCP vector, the exogenous insertion fragment is a fusion fragment formed by the PTGFRN (Δ687) CDS fragment and the MCPCDS fragment, and the nucleotide sequence is shown in SEQ ID NO:4.

[0030] Preferably, during the co-transfection, the copy numbers of the PTGFRN-MCP vector, iBax vector and TfR vector are 1:1:1.

[0031] Preferably, the first co-incubation condition is 4° C., and the first co-incubation time is 4 h;

[0032] The second co-incubation condition is an ice bath, and the co-incubation time is 1 hour.

[0033] The present invention provides use of the engineered extracellular vesicles or the engineered extracellular vesicles obtained by the construction method in preparing a reagent for eliminating senescent cells.

[0034] The present invention provides use of the engineered extracellular vesicles or the engineered extracellular vesicles obtained by the construction method in preparing a drug for preventing and or treating atherosclerosis.

[0035] The present invention provides an engineered extracellular vesicle, comprising a genetically engineered extracellular vesicle, wherein the surface of the genetically engineered extracellular vesicle is coupled with Tf-SMN and an agonist loaded with the pro-apoptotic protein BAX; the PTGFRN (Δ687)-MCP fusion protein is expressed on the membrane of the genetically engineered extracellular vesicle, and the MCP RNA binding protein increases the extracellular vesicle's loading capacity for iBax mRNA containing an MS2 sequence and a miR-122 recognition site; and the agonist of the pro-apoptotic protein BAX is embedded in the phospholipid bilayer of the extracellular vesicle. The present invention combines transferrin (Tf)-modified superparamagnetic iron oxide nanoparticles (Tf-SMN) with extracellular vesicles (EVs) overexpressing transferrin receptor (TfR) through the Tf-TfR interaction to produce magnetic EVs. By guiding the external magnetic field (MF), the targeting of the engineered EVs to aortic plaques is significantly improved. The present invention connects the MCPRNA binding protein to the inner membrane end of the EVs scaffold protein PTGFRN (Δ687), which can achieve efficient loading of target mRNA molecules carrying the MS2 sequence, reduce the loading of EVs on endogenous cellular RNA, minimize the entry of undesired RNA into EVs, and achieve efficient loading of target mRNA. The present invention adds a miR-122 recognition sequence to the 3'-UTR of iBax, which is different from the native Bax mRNA. This iBax mRNA is delivered to liver tissue. Due to the abundant content of miR-122 in hepatocytes, it will mediate the degradation or translation block of the target iBax mRNA, which can reduce potential liver cell damage caused by off-target effects. The engineered extracellular vesicles constructed by the present invention can deliver pro-apoptotic iBax mRNA and its agonist BTSA1 to senescent cells, directly killing senescent cells by upregulating the "pro-apoptotic pathway" and having a higher efficiency in clearing senescent cells, thus providing a new approach for the prevention and treatment of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the construction process of SMN-Tf;

[0037] Figure 2 For EV SMN The construction and characterization results of the graph, A is EV SMN Schematic diagram of the synthesis of EVs; B is a representative TEM image of EVs, scale bar: 100 nm, C is EV Ctrl EV TfR or EV SMN D is Western blot analysis to examine the markers of EVs in isolated EVs and donor cells; E is EV SMNDigital photographs before and after in vitro exposure to MF.

[0038] Figure 3 For EV SMN The results of the validation of the efficiency of plaque magnetic targeting, A is a schematic diagram of the experimental process; B is an IVIS image showing DiR-labeled EVs Ctrl / EV SMN Distribution results in the aorta and important organs; C is the quantitative results of Figure B; D is the confocal image showing EV Ctrl / EV SMN P21 in atherosclerotic plaques at the aortic root + Co-localization results in cells; E is a fluorescence microscopy image showing EV Ctrl / EV SMN Localization of DiI-labeled cells in vital organs; data shown are representative images from three different experiments; statistical significance was determined by student's t-test; ***p < 0.001; ns, no statistically significant difference;

[0039] Figure 4Figure 2: Validation results of the efficiency of engineered iBax mRNA inhibition by miR-122. A is a schematic diagram of the plasmid design of the iBax plasmid and the control Bax plasmid (without the miR-122 recognition site); B is a schematic diagram of the specific process of iBax transcripts synthesized after iBax vector transfection into HEK293T / Huh7 cells being regulated by miR-122; C is the qPCR analysis results of Bax mRNA in HEK293T cells after different treatments; D is the Western blot analysis results of BAX protein expression in HEK293T cells after different treatments; E is the qPCR analysis of Bax mRNA in Huh7 cells after different treatments; F is the Western blot analysis results of BAX protein expression in transfected Huh7 cells; G is the expression of Bax in HEK293T cells after co-transfection of Bax / iBax vector with miR-122 mimics or NC. qPCR analysis results of mRNA; H is the Western Blot analysis result of BAX protein expression in HEK293T cells after co-transfection of Bax / iBax vector with miR-122mimics or NC; I is the qPCR analysis result of Bax mRNA in Huh7 cells after co-transfection of Bax / iBax vector with miR-122inhibitor or miR-122inhibitorNC; J is the Western blot analysis result of BAX protein expression in Huh7 cells after co-transfection of Bax / iBax vector with miR-122inhibitor or miR-122inhibitor NC; Data are expressed as the mean ± SEM of three independent experiments; statistical significance was determined by one-way ANOVA with Tukey's post hoc test; ***p < 0.001.ns, no statistical difference;

[0040] Figure 5 To verify the efficiency of EVs loading iBax mRNA, A is a schematic diagram illustrating the process of EVs functionalized with PTGFRN-MCP fusion protein to encapsulate iBax mRNA; B is qPCR analysis of Bax mRNA expression in HEK293T cells; C is qPCR analysis of Bax mRNA content in HEK293T cell-derived EVs; D is Western blot analysis of EV surface markers; E is a representative TEM image of EVs, scale bar: 100 nm; F is EV none EV iBax+emptyvector or EV iBax+PTGFRN-MCPSize distribution results; Data are shown as the mean ± SEM of three independent experiments; Statistical differences were determined by one-way ANOVA with Tukey's post hoc test; **p < 0.01, ***p < 0.001;

[0041] Figure 6 For EV iTx The construction and characterization results of EV iTx Schematic diagram of the synthesis of EV; B is EV iTx Representative TEM images of EVs. Scale bar: 100 nm. C: Western blot analysis of markers in isolated EVs and EVs from donor cells. D: qPCR analysis of iBax mRNA loading efficiency in EVs. Data are presented as the mean ± SEM of three independent experiments. Statistical differences were determined by student's t-test, ***P < 0.001.

[0042] Figure 7 For EV iTx Verification results of induction of apoptosis efficiency of senescent cells in vitro; A is EV iTx Figure 5. Mechanism of apoptosis of senescent foam macrophages mediated by EVs; B is a schematic diagram of co-culture of EVs and senescent foam macrophages; C is the uptake of EVs by senescent foam macrophages, Note: DiI-labeled EVs (red), SA-β-gal (green), cell nuclei (blue); D is the qPCR analysis results of Bax mRNA in senescent foam macrophages; E is the expression of BAX protein and cleaved caspase-3 protein in senescent foam macrophages after treatment with different EVs; F is the flow cytometer detection of apoptosis in senescent foam macrophages; Data are expressed as the mean ± SEM of three independent experiments; Statistical differences were determined by one-way ANOVA with Tukey's post hoctest; ***p < 0.001; ns, no statistical difference;

[0043] Figure 8 For EV iTx There is no significant pro-apoptotic effect on Huh7 cells in vitro; A is EV iTxMechanism of non-apoptosis of Huh7 cells after treatment; B is a schematic diagram of co-culture of EVs and Huh7 cells; C is the uptake of EVs by Huh7 cells, Note: DiI-labeled EVs (red), SA-β-gal (green), cell nucleus (blue); D is the qPCR analysis results of Bax mRNA in Huh7 cells; E is the expression results of BAX protein and cleaved caspase-3 protein in Huh7 cells after treatment with different EVs; F is the flow cytometer detection of apoptotic Huh7 cells; Data are expressed as the mean ± SEM of three independent experiments. Statistical differences were determined by one-way ANOVA with Tukey's post hoc test; **p < 0.01; ns, no statistical difference;

[0044] Figure 9 To engineer EVs for ApoE - / - Evaluation of therapeutic efficacy in atherosclerosis model mice; A represents EV iTx Schematic diagram of the in vivo experimental process; B is qPCR analysis of Bax mRNA expression levels in diseased aortas; C is Western blot analysis of BAX protein expression levels in diseased aortas treated with various EVs; D is the effect of engineered EVs on ApoE - / - Schematic diagram of the efficacy evaluation process of atherosclerosis model mice; E represents ApoE after different treatments - / - Representative gross photographs of aortic arches with atherosclerotic lesions in mice; F is a representative image of aortic sinus cross-section stained with ORO and H&E; scale bar: 200 μm; G is the statistical data of ORO-positive plaque area in F; H is the ApoE-treated - / - Gross image of mouse aorta stained with ORO; I is the percentage analysis result of atherosclerotic plaque area in H; J is immunofluorescence staining showing ApoE in high-fat diet - / - P21 expression in the mouse aortic root. Scale bar: 50 μm; K represents the expression level of p21 mRNA in the aortic root analyzed by qPCR; AA, ascending aorta; DA, descending aorta; BA, brachiocephalic artery; LCCA, left common carotid artery; LSA, left subclavian artery. Data are presented as mean ± SEM, n = 6 per group; statistical significance was determined by one-way ANOVA with Tukey's posthoc test; *p < 0.05, **p < 0.01, ***p < 0.001; ns, not significant.

[0045] Figure 10 For EV iTx Animal level toxicity and side effect evaluation results, A is EV iTx Schematic diagram of the toxicity and side effect evaluation process; ApoE- / - EV injection into the tail vein of mice iTx MF was applied to the aorta at the same time. The liver was then isolated for qPCR and Western Blot analysis. B is the expression level of Bax mRNA in the liver of mice by qPCR; C is the expression level of BAX protein in liver tissue by Western blot analysis; D is the expression level of ApoE after different treatments - / - Representative images of TUNEL staining in mouse liver tissue; E stands for ApoE - / - Schematic diagram of the experimental process for evaluating toxic and side effects in mice; F represents ApoE - / - Body weight change curve of mice during treatment; GI is ApoE after different treatments - / - Liver function of mice: AST (G), ALT (H), and ALP (I) levels; the above data are expressed as mean ± SEM, 6 mice per group; statistical significance was determined by one-way ANOVA with Tukey's post hoc test; *p < 0.05, **p < 0.01, ***p < 0.001; ns, no statistical difference;

[0046] Figure 11 ApoE receiving different treatments - / - Changes in liver and kidney function indicators in mice; AG is ApoE in different treatment groups - / - GGT (A), TBIL (B), DBIL (C), ALB (D), TBA (E), BUN (F), and CREA (G) levels in mice; Note: GGT, γ-glutamyl transpeptidase; TBIL, total bilirubin; DBIL, direct bilirubin; ALB, albumin; TBA, total bile acid; BUN, blood urea nitrogen; CREA, creatinine; Data are expressed as mean ± SEM; n = 6 per group; statistical significance was determined by one-way ANOVA with Tukey's post hoc test; ns, not significant;

[0047] Figure 12 ApoE treated with different EVs - / - H&E staining images of important mouse organs (heart, liver, spleen, lung, and kidney). DETAILED DESCRIPTION

[0048] The present invention provides an engineered extracellular vesicle, comprising a genetically engineered extracellular vesicle, wherein the surface of the genetically engineered extracellular vesicle is coupled with transferrin-modified superparamagnetic iron oxide nanoparticles and an agonist loaded with a pro-apoptotic protein BAX; the PTGFRN (Δ687)-MCP fusion protein is expressed on the membrane of the genetically engineered extracellular vesicle, and the MCP RNA binding protein increases the loading capacity of the extracellular vesicle for iBax mRNA containing an MS2 sequence and a miR-122 recognition site; and the agonist of the pro-apoptotic protein BAX is embedded in the phospholipid bilayer of the genetically engineered extracellular vesicle.

[0049] In the present invention, the nucleotide sequence of the scaffold protein PTGFRN(Δ687) is preferably as shown in SEQ ID NO:5 (GGTCCTATATTTAATGCTTCTGTGCATTCAGACACACCATCAGTAATTCGGGGAGATCTGATCAAATTGTTCTGTATCATCACTGTCGAGGGAGCAGCACTGGATCCAGATGACATGGCCTTTGATGTGTCCTGGTTTGCGGTGCACTCTTTTGGCCTGGACAAGGCTCCTGTGCTCCTGTCTTCCCTGGATCGGAAGGGCATCGTGACCACCTCCCGGAGGGACTGGAAGAGCGACCTCAGCCTGGAGCGCGTGAGTGTGCTGGAATTCTTGCTGCAAGTGCATGGCTCCGAGGACCAGGACTTTGGCAACTACTACTGTTCCGTGACTCCATGGGTGAAGTCACCAACAGGTTCCTGGCAGAAGGAGGCAGAGATCCACTCCAAGCCCGTTTTTATAACTGTGAAGATGGATGTGCTGAACGCCTTCAAGTATCCCTTGCTGATCGGCGTCGGTCTGTCCACGGTCATCGGGCTCCTGTCCTGTCTCATCGGGTACTGCAGCTCCCACTGGTGTTGTAAGAAGGAGGTTCAGGAGACACGGCGCGAGCGCCGCAGGCTCATGTCGATGGAGATGGAC);The nucleotide sequence of the MCP RNA binding protein is as shown in SEQ ID NO:6 (GCTTCAAACTTTACTCAGTTCGTGCTCGTGGACAATGGTGGGACAGGGGATGTGACAGTGGCTCCTTCTAATTTCGCTAATGGGGTGGCAGAGTGGATCAGCTCCAACTCACGGAGCCAGGCCTACAAGGTGACATGCAGCGTCAGGCAGTCTAGTGCCCAGAAGAGAAAGTATACCATCAAGGTGGAGGTCCCCAAAGTGGCTACCCAGACAGTGGGCGGAGTCGAACTGCCTGTCGCCGCTTGGAGGTCCTACCTGAACATGGAGCTCACTATCCCAATTTTCGCTACCAATTCTGACTGTGAACTCATCGTGAAGGCAATGCAGGGGCTCCTCAAAGACGGTAATCCTATCCCTTCCGCCATCGCCGCTAACTCAGGTATCTAC).;

[0050] In the present invention, the molecules specifically loaded with the MCP RNA-binding protein preferably include iBax mRNA molecules carrying an MS2 sequence and miR-122 recognition sites. The iBax mRNA has three miR-122 recognition sites added to its 3'UTR. Since iBax mRNA is delivered to liver tissue, miR-122 is abundant in hepatocytes. MiR-122 binds to the miR-122 recognition sites of the iBax mRNA, forming an RNA-induced silencing complex (RISC), which mediates degradation or translational blockade of the target iBax mRNA, thereby reducing potential hepatocyte damage caused by off-target effects. The DNA nucleotide sequence of Bax is shown in SEQ ID NO: 7 ().The nucleotide sequence of the miR-122 recognition site in the iBax mRNA molecule is shown in SEQ ID NO: 8 (CAAACACCATTGTCACACTCCA). The iBax mRNA molecule also includes an MS2 sequence; the DNA sequence of the MS2 sequence is shown in SEQ ID NO: 9 (ACATGAGGATCACCCATGT). The MS2 sequence is linked to the 3' end of the iBax mRNA molecule via a double tandem approach to enable efficient loading of the iBax mRNA via the PTGFRN-MCP fusion protein. The miR-122 recognition sequence is linked to the 3' end of the iBax mRNA molecule via a triple tandem approach and separated by a spacer sequence, enabling its translation to be inhibited by miR-122, thereby reducing the potential toxic side effects caused by excessive accumulation of iBax mRNA in the liver.

[0051]

[0052] In the present invention, the diameter of the superparamagnetic iron oxide nanoparticles is preferably 5 to 15 nm, more preferably 10 nm. In the embodiment of the present invention, the superparamagnetic iron oxide nanoparticles are purchased from Nanjing Donna Biotechnology Co., Ltd.

[0053] The present invention provides a method for constructing the engineered exosomes, comprising the following steps:

[0054] The Bax CDS fragment was cloned into a plasmid to form the iBax vector;

[0055] The TfR CDS fragment was cloned into a plasmid to form a TfR vector;

[0056] The PTGFRN (Δ687) CDS fragment and the MCPCDS fragment were cloned into a plasmid to obtain the PTGFRN-MCP vector;

[0057] The PTGFRN-MCP vector, iBax vector and TfR vector were co-transfected into mammalian cells, and iBax@EV was obtained by cell culture and isolation of extracellular vesicles. TfR ;

[0058] iBax@EV TfR The first co-incubation with transferrin-modified superparamagnetic iron oxide nanoparticles resulted in iBax@EV SMN ;

[0059] The iBax@EV SMN A second co-incubation with an agonist of the pro-apoptotic protein BAX was performed to obtain engineered extracellular vesicles (EVs). iTx .

[0060] In the present invention, in the iBax vector, the exogenous insert is the Bax CDS fragment, the miR-122 recognition site fragment, and the MS2 sequence, and the nucleotide sequence is shown in SEQ ID NO: 1; in the control Bax vector, the exogenous insert is preferably a fusion gene formed by the Bax CDS fragment and the MS2 sequence, and the nucleotide sequence is shown in SEQ ID NO: 2. In the TfR vector, the exogenous insert is a TfR CDS fragment carrying an enzyme cleavage site, and the nucleotide sequence is preferably shown in SEQ ID NO: 3; in the PTGFRN-MCP vector, the exogenous insert is preferably a fusion fragment formed by the PTGFRN (Δ687) CDS fragment and the MCP CDS fragment, and the nucleotide sequence is preferably shown in SEQ ID NO: 4. The present invention has no particular limitation on the cloning method, and cloning methods well known in the art can be used, such as homologous recombination methods.

[0061] In the present invention, during the co-transfection, the copy numbers of the PTGFRN-MCP vector, iBax vector, and TfR vector are preferably 1:1:1. The present invention has no particular limitation on the method of co-transfection, and a co-transfection method well known in the art can be used. The mammalian cells are preferably HEK293T cells. The present invention has no particular limitation on the method of cell culture and isolation of extracellular vesicles, and a method of cell culture and isolation of extracellular vesicles well known in the art can be used, such as ultracentrifugation to collect extracellular vesicles.

[0062] In the present invention, the iBax@EV TfR The co-incubation condition with transferrin-modified superparamagnetic iron oxide nanoparticles is preferably 4°C, and the co-incubation time is preferably 4 h to obtain iBax@EV SMN ;

[0063] In the present invention, the iBax@EV SMN The co-incubation condition with the BAX agonist is preferably an ice bath, and the co-incubation time is preferably 1 hour. The BAX agonist is preferably BTSA1. BTSA1 is lipid-soluble, and after co-incubation, BTSA1 is embedded in the phospholipid bilayer of the extracellular vesicle to achieve loading.

[0064] In the present invention, the detection of magnetic targeting, miR-122 responsiveness and target mRNA loading efficiency found that superparamagnetic iron oxide nanoparticles modified extracellular vesicles (EVs) SMN ) is a biconcave disc with black dots surrounding its surface, which represent SMN-Tf and EV TfR Nanoparticle tracking analysis (NTA) results showed that EV Ctrl (EVs secreted by HEK293T cells transfected with empty vector plasmid), EV TfR and EV SMN EVs have similar size distribution, with diameters ranging from 30 to 150 nm. Western blot analysis showed that SMN The expression patterns of inclusive and exclusive EV markers in donor cells and derived EVs were similar to those in control EVs. SMN These data indicate that magnetized EVs with good magnetic targeting properties were successfully constructed. SMN Magnetic EV SMN The enrichment of EVs in plaques was significantly enhanced, but their inherent distribution characteristics in vivo led to their high enrichment in other organs, especially the liver, which was confirmed by IVIS imaging and confocal microscopy analysis. SMNThe associated liver toxicity is crucial. Compared with the control Bax vector (Bax vector without the miR-122 recognition sequence), the transcription and translation efficiency of the iBax vector (Bax vector carrying the miR-122 recognition sequence) in Huh7 cells (human well-differentiated hepatocellular carcinoma cells, a natural cell model with high miR-122 expression) was significantly reduced. This differential expression may be due to the fact that Huh7 cells have higher levels of miR-122 than HEK293T cells, which inhibits the translation of iBax mRNA or causes its degradation.

[0065] Based on the biological functions of the engineered extracellular vesicles, the present invention provides the use of the engineered extracellular vesicles or the engineered extracellular vesicles obtained by the construction method in preparing a reagent for eliminating senescent cells.

[0066] The present invention has no particular limitation on the type of the preparation, and any preparation known in the art may be used.

[0067] The present invention provides use of the engineered extracellular vesicles or the engineered extracellular vesicles obtained by the construction method in preparing a drug for preventing and or treating atherosclerosis.

[0068] The present invention has no particular limitation on the dosage form and preparation method of the drug, and the dosage form and preparation method of the drug well known in the art can be adopted.

[0069] The following examples provide a detailed description of the magnetically targeted, hepatocyte-responsive mRNA-loaded engineered extracellular vesicles provided by the present invention, as well as their construction method and application. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0070] Example 1

[0071] Constructing engineered EVs that are magnetically targeted and efficiently loaded with hepatocyte-responsive mRNA;

[0072] (1) Plasmid construction:

[0073] ①iBax expression vector:

[0074] Using pcDNA3.1 (+) as a vector, the mouse Bax CDS fragment and the mouse miR-122 recognition site fragment were inserted, EcoRI was added upstream and XhoI was added downstream. The VectorNTI software was used to detect that there were no restriction enzyme sites in the entire sequence. Finally, by genetic engineering, the Bax CDS fragment, miR-122 recognition site and MS2 sequence fragment were cloned into an expression plasmid to obtain a recombinant plasmid containing the above sequence, named iBax plasmid. The specific sequence of the exogenous insert is shown in SEQ ID NO: 1 (the bold underlined part is the restriction enzyme site, the bold base is the Kozak sequence, the unidentified sequence is the mouse BaxCDS sequence, the underlined sequence is the mouse miR-122 recognition site, the double underlined base is the spacer sequence, the background gray base is the MS2 recognition sequence, and the italics are the start / stop codons):

[0075]

[0076] ②Control Bax expression vector (without miR-122 recognition site):

[0077] As a control, a Bax CDS fragment without the miR-122 recognition site was cloned into the pcDNA3.1(+) vector. The specific sequence of the exogenous insert fragment of the Bax plasmid without the miR-122 recognition site is as follows (the bold underlined part is the restriction enzyme cutting site, the bold font part is the Kozak sequence, the unmarked part is the Bax CDS sequence, the gray background part is the MS2 recognition sequence, and the italics are the start / stop codons):

[0078]

[0079] ③TfR expression vector:

[0080] Using pcDNA3.1(+) as a vector, the human TfR CDS fragment was inserted, EcoRI was added upstream and Xho I was added downstream. Using VectorNTI software to detect, there were no above two restriction sites in the entire sequence. Finally, the TfR CDS fragment with restriction sites at both ends was cloned into the expression plasmid by genetic engineering to obtain a recombinant plasmid containing the above sequence, named TfR plasmid. The specific sequence of the exogenous insert is as follows (the bold underlined part is the restriction site, the bold sequence is the Kozak sequence, the unmarked sequence is the TfR CDS sequence, and the italics are the start / stop codons):

[0081]

[0082]

[0083] ④PTGFRN-MCP expression vector

[0084] Using pcDNA3.1(-) as a vector, the PTGFRN(Δ687) CDS fragment and the MCP CDS fragment were inserted, Nhel was added upstream and EcoRV was added downstream. Using VectorNTI software, the entire sequence was found to contain no restriction enzyme sites. Finally, the PTGFRN(Δ687)-MCP fusion fragment was cloned into an expression plasmid by genetic engineering to obtain an expression plasmid containing the above sequence. The specific sequence of the PTGFRN(Δ687)-MCP fusion expression vector is as follows (the bold underlined part is the restriction enzyme site, the bold font part is the Kozak sequence, the italicized part is the start / stop codon, the gray background is the signal peptide sequence, the unmarked part is the PTGFRN(Δ687) sequence, the double underlined part is the linker sequence, and the underlined part is the MCP CDS sequence):

[0085]

[0086]

[0087] (2) Magnetic targeting engineered EVs (EVs iTx )Build

[0088] ① Construction of SMN-Tf (see Figure 1 )

[0089] A solution of SMN (20 μL, 4 mg / mL) was mixed with EDAC and sulfo-NHS in a molar ratio of 1:2:3 (pH = 5.5). The resulting mixture was incubated at room temperature for 1 h, and then 1 μL of 2-mercaptoethanol was added to terminate the reaction. The surface carboxyl-activated SMN was magnetically separated and then resuspended in 200 μL of borate buffer (20 mM, pH = 8.5). Subsequently, 10 μg of Tf was introduced into the solution, and the mixture was incubated at 4 ° C under nitrogen for 12 h. The SMN-Tf was magnetically separated, washed three times with PBS, and resuspended in 200 μL of PBS.

[0090] ②EV iTx Construction

[0091] First, HEK293T cells were co-transfected with PTGFRN-MCP vector, iBax vector, and TfR vector (1:1:1). After 48 h, the cell supernatant was collected and engineered iBax@EVs were obtained by ultracentrifugation. TfR Next, 100 μL of protein with a concentration of 1 μg / μL -1 iBax@EV TfRThe solution was mixed with 100 μL of SMN-Tf solution and incubated on a shaker at 4°C for 4 h. Subsequently, iBax@EVs were obtained by magnetic separation. SMN , and resuspended in PBS. Then 100 μg of purified iBax@EV SMN (0.5 μg μL -1 ) were incubated with 2 μL BTSAl (5 mM) in an ice bath for 1 h. Afterwards, EVs loaded with BTSA1 were obtained by magnetic separation. iTx , washed and resuspended in cold PBS for subsequent experiments.

[0092] Example 2

[0093] Verification of magnetic targeting performance, miR-122 responsiveness, and target mRNA loading efficiency

[0094] (1) SMN-modified EVs (EVs SMN ) construction and characterization;

[0095] In order to endow EVs with magnetic targeting ability, TfR plasmid was transfected into HEK293T cells, and the secreted EVs were collected 48 h later to obtain engineered EVs with high expression of TfR on the membrane surface (EV TfR ), SMN-Tf and EV TfR Co-incubation allows SMN-Tf to be coupled to EVs through the interaction between TfR and Tf. TfR The surface ( Figure 2 The specific steps are as follows: First, the method of Example 1 was used to construct SMN-modified EVs (EV SMN ). Only EVs with high expression of transferrin receptor (TfR) (EV TfR ) were co-incubated with transferrin (Tf)-modified SMN (Tf-SMN) at 4°C to obtain magnetized EVs through TfR-Tf interaction. SMN At the same time, the present invention also prepared EVs prepared by empty vector transfected cells as control EVs.

[0096] TEM images show EVs SMN It is a biconcave disc with black dots surrounding its surface, which are SMN-Tf and EV. TfR The successful combination of Figure 2 Middle B).

[0097] Nanoparticle tracking analysis (NTA) results showed that EV Ctrl (EVs secreted by HEK293T cells transfected with empty vector plasmid), EV TfR and EV SMNhave similar size distribution, with diameters ranging from 30 to 150 nm ( Figure 2 Middle C).

[0098] Western blot analysis of EV Ctrl EV TfR and EV SMN The results showed that EV SMN The expression patterns of inclusive and exclusive EV markers in donor cells and derived EVs were similar to those in control EVs ( Figure 2 Middle D).

[0099] Visual observation, 1 μg / μL EV SMN It showed good monodispersity in PBS and was effectively enriched in the surrounding area of ​​MF ( Figure 2 These data indicate that magnetized EVs with good magnetic targeting properties were successfully constructed. SMN .

[0100] (2)EV SMN Verification of the efficiency of magnetic targeting of plaques;

[0101] Since EVs were observed in vitro SMN We next further verified whether it can more accurately target atherosclerotic plaques in vivo. SMN and injected into ApoE via tail vein - / - In order to visually demonstrate that EV SMN In vivo imaging system (IVIS) and confocal microscopy were used to track the distribution of labeled EVs in vivo. Figure 3 Middle A).

[0102] IVIS imaging analysis showed that unmodified EVs Ctrl (EV Ctrl +MF group) showed moderate accumulation within the aortic plaque area, which is consistent with the results reported previously. SMN In the +MF group, the intensity and area of ​​the fluorescence signal in the aorta region were significantly enhanced ( Figure 3 Middle B and Figure 3 These results provide compelling evidence that magnetized EVs SMN The magnetic navigation system has a good targeting ability for atherosclerotic plaques. Confocal microscopy analysis further confirmed that the magnetized EV SMN P21 in atherosclerotic plaques +Cells (these cells may be senescent foamy macrophages or other senescent cell types) co-localize with EVs. SMN The enrichment level in these cells is significantly higher than that in EVs. Ctrl The enrichment degree ( Figure 3 These data provide a strong basis for the development of targeted drug delivery vehicles that can effectively eliminate senescent cells in AS.

[0103] Although the magnetic EV SMN The enrichment of EVs in plaques was significantly enhanced, but their intrinsic distribution properties in vivo led to their high enrichment in other organs, especially the liver, as demonstrated by IVIS imaging and confocal microscopy analysis ( Figure 3 B and E). Therefore, the reduction of drug-loaded EV SMN The associated hepatotoxicity is critical.

[0104] (3) Verification of the miR-122 inhibition efficiency of the engineered iBax mRNA;

[0105] miR-122 is a mammalian liver-specific noncoding polyadenylated RNA with an average of 50,000-82,000 copies per cell in adult liver. It can serve as a potential candidate for constructing miRNA-inhibited iBax mRNA to circumvent BAX-related hepatotoxicity.

[0106] In order to construct the iBax mRNA expression system inhibited by miR-122, three sequences complementary to miR-122 were inserted into the cloning expression plasmid (iBax vector). As a control, we also constructed a Bax expression vector without miR-122 recognition site (named Bax vector) ( Figure 4 We hypothesized that when miR-122 levels are elevated, engineered iBax mRNA would be degraded or translationally inhibited, while Bax mRNA expression would remain unaffected ( Figure 4 After transfection, the expression of Bax mRNA and protein in the Bax / iBax-treated group was significantly increased compared with the control group of HEK293T cells ( Figure 4 In contrast to HEK293T cells, the expression of Bax mRNA and protein in Huh7 cells transfected with the iBax vector was significantly reduced compared to those transfected with the Bax vector ( Figure 4 (E and F) The results showed that the transcription and translation efficiency of the iBax vector in Huh7 cells was significantly reduced compared to the control Bax vector. This differential expression may be due to the higher levels of miR-122 in Huh7 cells compared to HEK293T cells.

[0107] To test the above hypothesis, we co-transfected iBax and miR-122 mimics into HEK293T cells. Compared with the co-transfection group of iBax vector and negative control (NC), the expression of Bax at both mRNA and protein levels was significantly decreased ( Figure 4 G and Figure 4 H). In Huh7 cells, compared with the control group, iBax co-transfected with miR-122 inhibitor showed that the expression of Bax at both mRNA and protein levels was significantly increased ( Figure 4 These results indicate that iBax mRNA can be translationally repressed by miR-122.

[0108] (4) Verification of the efficient loading of EVs with iBax mRNA;

[0109] According to the method of Example 1, in order to achieve efficient loading of iBax mRNA, two repeated MS2 sequences were added downstream of the coding sequence of iBax mRNA, and the C-terminus of PTGFRN (Δ687) was fused with MCP to construct a PTGFRN-MCP fusion expression vector. The combination of MCP and MS2 promoted the sorting of iBax mRNA in engineered EVs ( Figure 5 Middle A).

[0110] First, this study examined whether the PTGFRN-MCP fusion protein could enhance the encapsulation of iBax mRNA in EVs produced by packaging cells. To this end, HEK293T cells were co-transfected with the iBax vector and the PTGFRN-MCP vector / empty vector. Bax mRNA expression was measured using qPCR (Bax primer-F: 5'-TGCTACAGGGTTTCATCCA-3', SEQ ID NO: 11; Bax primer-R: 5'-AAGTAGAAGAGGGCAACCAC-3', SEQ ID NO: 12; reaction volume: 10 μL).

[0111] According to qPCR analysis, PTGFRN-MCP fusion protein significantly increased the abundance of iBax mRNA in EVs under the condition of iBax overexpression in donor cells. Correspondingly, the expression level of iBax mRNA in parental cells decreased slightly ( Figure 5 B and C).

[0112] Next, to investigate whether iBax mRNA loading and PTGFRN-MCP surface functionalization affect the size and morphology of EVs, the modified EVs were further characterized. Compared with unmodified control EVs, iBax mRNA loading and PTGFRN-MCP functionalization did not significantly change the expression of markers, morphology, and size ( Figure 5 (in DF).

[0113] (5)EV iTx The construction and representation of

[0114] BTSA1 is a BAX agonist that converts dormant cytoplasmic BAX monomers into active conformers that can translocate to the mitochondrial membrane. Delivery of iBax mRNA together with BTSA1 to senescent cells may represent a new approach to clear senescent cells. Therefore, this experiment constructed EVs according to the method described in Example 1. iTx (Tx: therapeutics) to deliver functional iBax mRNA and BTSA1 into senescent cells. Briefly, HEK293T cells were co-transfected with iBax vector, PTGFRN-MCP vector, and TfR vector to obtain engineered iBax@EVs. TfR , and then co-incubated with SMN-Tf to create iBax@EV SMN BTSA1 was then loaded into iBax@EV by co-incubation. SMN Inside the membrane, forming EV iTx ( Figure 6 Middle A).

[0115] EV iTx It has typical features of extracellular vesicles. The black dots surrounding the spherical vesicles are SMN-Tf ( Figure 6 Middle B). Western blot analysis showed that EV iTx There was no change in the expression of markers, while qPCR analysis showed that Ctrl In comparison, EV iTx The abundance of Bax mRNA increased significantly ( Figure 6 C and D).

[0116] Example 3

[0117] In vitro validation of the senescent cell clearance efficacy of engineered EVs and their hepatocyte protection properties;

[0118] (1)EV iTx Verification of the efficiency of inducing apoptosis of senescent cells in vitro;

[0119] In the following experiments, we explored the iTxWhether it can induce apoptosis of senescent cells to different degrees in vitro ( Figure 7 A). RAW264.7 cells were treated with ox-LDL to construct a senescent foamy macrophage model (specifically, RAW264.7 cells (less than 10 passages) were cultured in the presence of 50 μg mL -1 ox-LDL culture medium for 24 h to construct a senescent foam macrophage model). Ctrl EV Tx (Therapeutic EVs loaded with control Bax mRNA) and EV iTx were all internalized by senescent foamy macrophages, but compared with the control group, only EV Tx and EV iTx The expression of Bax mRNA in the treatment group was significantly increased ( Figure 7 In addition, in the use of EV Tx or EV iTx After treatment, BAX protein expression was also significantly increased. Tx / EV iTx A significant increase in the expression of cleaved caspase-3 was observed in co-cultured senescent foam macrophages ( Figure 7 Middle E). Flow cytometric analysis showed that EV Tx / EV iTx The proportion of apoptotic cells in the treatment group also increased significantly ( Figure 7 In summary, the above data show that EV Tx or EV iTx Apoptosis of senescent foamy macrophages can be successfully induced in vitro.

[0120] (2)EV iTx It has no significant pro-apoptotic effect on Huh7 cells in vitro;

[0121] Since EVs inevitably accumulate in the liver after intravenous administration, we next tested the Tx / EV iTx Effects on Huh7 cells (a natural cell model with high expression of miR-122) to speculate on EV iTx Will it induce apoptosis of hepatocytes? Figure 8 First, EV iTx and other control EVs were labeled with DiI and then co-cultured with Huh7 cells ( Figure 8 Middle B). Although EV Ctrl EV Tx and EV iTx were all taken up by Huh7 cells, but compared with the control group, only EV Tx The expression of Bax mRNA and protein in the treatment group increased significantly ( Figure 8 In addition, EV Tx The treated group showed strong cell apoptosis, such as the increase in the expression of cleaved caspase-3 and the proportion of apoptotic cells, while EV iTx There was no obvious apoptotic cells in the treated group ( Figure 8 (E and F). These differences may be due to EV iTx These data together indicate that EVs are involved in the degradation of iBax mRNA by miR-122 in Huh7 cells. iTx It is a safe senolytics strategy that can efficiently kill senescent cells and prevent liver cell damage.

[0122] Example 4

[0123] Engineered EVs animal experiments: Engineered EVs against ApoE - / - Evaluation of therapeutic efficacy and side effects in atherosclerosis model mice.

[0124] (1) Effects of engineered EVs on ApoE - / - Evaluation of therapeutic efficacy in atherosclerosis model mice:

[0125] Atherosclerotic plaques contain a large number of senescent cells. Targeted removal of senescent cells in plaques may be a potential therapeutic strategy for treating atherosclerosis. We first verified that EV iTx Is it possible to deliver iBax mRNA to atherosclerotic plaques? - / - Mice were injected with EVs via the tail vein iTx (4 μg / g), and MF was applied to the aorta for 1 h, and then the aorta was isolated for qPCR and Western blot analysis of Bax mRNA and protein expression ( Figure 9 The results showed that EV Tx and EV iTx In the aorta of treated mice, the expression of Bax mRNA and protein was significantly increased ( Figure 9 B and C). Subsequently, we systematically evaluated EV iTx Specifically, we first constructed ApoE - / - Atherosclerosis mouse model, followed by weekly injection of designated EVs for 8 consecutive weeks ( Figure 9 Middle D).

[0126] After the experiment, we euthanized the mice and examined the aorta. We found that the aorta was Ctrl Compared with the control group, the EV Tx +MF and EV iTx+MF-treated mice showed a significant reduction in atherosclerotic plaques ( Figure 9 Middle E).

[0127] In addition, Oil Red O (ORO) and H&E staining of cross-sections of the aortic root showed that EV Tx +MF and EV iTx Atherosclerotic plaques, especially the lipid core, were significantly reduced in the +MF group ( Figure 9 These findings were further confirmed by ORO staining of the aorta in gross and aortic root ( Figure 9 H and I).

[0128] In addition, EV Tx +MF and EV iTx After +MF treatment, the senescent cell population in the plaques was also assessed by P21 immunostaining. The results showed that the plaques in the control group showed a large number of P21 + cells, while in EV Tx +MF and EV iTx In the +MF treatment group, the infiltration of senescent cells was significantly reduced ( Figure 9 This was further confirmed by qPCR analysis of the aorta ( Figure 9 Taken together, these results strongly support the idea that EV iTx As a new type of senolytics, it has a significant effect on the treatment of atherosclerosis.

[0129] (2) Effects of engineered EVs on ApoE - / - Evaluation of toxic and side effects in atherosclerosis model mice;

[0130] Due to the inherent distribution pattern of EVs in the body, they will inevitably be enriched in the liver after tail vein administration. iTx Whether iBax mRNA delivered to the liver can be effectively degraded by liver tissue. - / - Mice were injected with EVs via the tail vein Tx / EV iTx MF was applied near the aorta for 1 hour. Liver tissue was then isolated and Bax mRNA was detected by qPCR, and BAX protein was analyzed by Western blot ( Figure 10 Middle A).

[0131] qPCR results showed that Tx Compared with the +MF group, EV iTx The Bax mRNA level in the +MF group was significantly decreased and almost the same as that in PBS and EV. Ctrl The expression levels of the two groups were similar ( Figure 10Western blot analysis showed a similar trend ( Figure 10 Middle C).

[0132] TUNEL staining of the liver showed that only EV Tx The TUNEL-positive cells in the +MF group increased significantly. iTx The +MF group showed no obvious signs of apoptosis ( Figure 10 The above data show that, compared with EV Tx In comparison, EV iTx It can significantly reduce hepatocyte apoptosis caused by BAX overload.

[0133] Based on this promising result, we further investigate the iTx The biocompatibility of the drug was fully evaluated. To be consistent with the in vivo treatment experiments, we used the same mouse model and dosing regimen ( Figure 10 During the treatment period, the body weight of mice was continuously monitored. Tx The weight of mice in the +MF group increased slowly, with a total increase of about 3g in 8 weeks, while the EV iTx The weight gain trend of mice in the +MF group was similar to that of the control group, with an increase of about 7.6 g ( Figure 10 (F) Blood biochemistry was used to evaluate the liver and kidney function of each group of mice. The results showed that compared with the control group, EV Tx AST, ALT and ALP levels were significantly increased in the +MF group, while EV iTx There was no significant difference between the +MF group and the control group ( Figure 10 However, there were no statistically significant differences in liver function indices (GGT, TBIL, DBIL, ALB, TBA) and renal function indices (BUN and CREA) among the four groups ( Figure 11 ).

[0134] It is worth noting that even EV Tx There were no significant changes in the histology of the liver in the treated mice ( Figure 12 ), suggesting that liver function parameters in blood may be more sensitive and earlier markers than histology. In conclusion, these data suggest that EV iTx EV Tx Better biosafety.

[0135] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An engineered extracellular vesicle, characterized in that The invention comprises genetically engineered extracellular vesicles, wherein the surface of the genetically engineered extracellular vesicles is coupled with transferrin-modified superparamagnetic iron oxide nanoparticles and an agonist loaded with a pro-apoptotic protein BAX; The genetically engineered extracellular vesicle membrane expresses PTGFRN-Δ687-MCP fusion protein, and the MCP RNA binding protein is used to increase the extracellular vesicle's ability to recognize the MS2 sequence and miR-122 recognition site. Bax mRNA loading amount; The nucleotide sequence of the coding sequence of the PTGFRN-Δ687-MCP fusion protein is shown in SEQ ID NO: 4; Bax The DNA sequence of the MS2 sequence in the mRNA molecule is as shown in SEQ ID NO: 9; The i Bax mRNA molecules Bax The DNA sequence is shown in SEQ ID NO: 7; The i Bax The nucleotide sequence of the miR-122 recognition site in the mRNA molecule is as shown in SEQ ID NO: 8; TfR is overexpressed on the membrane of the genetically engineered extracellular vesicle; the agonist of the pro-apoptotic protein BAX is embedded in the phospholipid bilayer of the genetically engineered extracellular vesicle; and the BAX agonist is BTSA1.

2. The engineered extracellular vesicle according to claim 1, characterized in that The nucleotide sequence of PTGFRN-Δ687 in the PTGFRN-Δ687-MCP fusion protein is as shown in SEQ ID NO: 5; The nucleotide sequence of the MCP RNA binding protein is as shown in SEQ ID NO: 6; The nucleotide sequence of TfR is shown in SEQ ID NO:

10.

3. The engineered extracellular vesicle according to claim 1, characterized in that The genetically engineered extracellular vesicles are coupled to superparamagnetic iron oxide nanoparticles via TfR-Tf.

4. The engineered extracellular vesicle according to any one of claims 1 to 3, characterized in that The diameter of the superparamagnetic iron oxide nanoparticles is 5-15 nm.

5. A method for constructing the engineered extracellular vesicles according to any one of claims 1 to 4, characterized in that: The following steps are involved: Will Bax The CDS fragment, miR-122 recognition site, and MS2 sequence were cloned into the plasmid to form i Bax carrier; The TfR CDS fragment was cloned into the plasmid to form TfR carrier; The PTGFRN-Δ687 CDS fragment and the MCP CDS fragment were cloned into a plasmid to generate the PTGFRN-MCP vector; PTGFRN-MCP vector, i Bax carrier and TfR The vector was co-transfected into mammalian cells, and extracellular vesicles were isolated through cell culture to obtain i Bax @EV TfR ; will i Bax @EV TfR The first co-incubation with transferrin-modified superparamagnetic iron oxide nanoparticles was performed to obtain i Bax @EV SMN ; The i Bax @EV SMN A second co-incubation with an agonist of the pro-apoptotic protein BAX was performed to obtain engineered extracellular vesicles (EVs). iTx .

6. The construction method according to claim 5, characterized in that: in i Bax In the vector, the exogenous inserted fragment is Bax The fusion fragment formed by the CDS fragment, the miR-122 recognition site fragment and the MS2 sequence has a nucleotide sequence as shown in SEQ ID NO: 1; In the TfR In the vector, the exogenous insert is a TfR CDS fragment carrying an enzyme cleavage site, and the nucleotide sequence is shown in SEQ ID NO: 3; In the PTGFRN-MCP vector, the exogenous insertion fragment is a fusion fragment formed by the PTGFRN-Δ687 CDS fragment and the MCP CDS fragment, and the nucleotide sequence is shown in SEQ ID NO:

4.

7. The construction method according to claim 5, characterized in that: During the co-transfection, the PTGFRN-MCP vector, i Bax carrier and TfR The copy number of the vector is 1:1:

1.

8. The construction method according to any one of claims 5 to 7, characterized in that: The first co-incubation condition is 4°C, and the first co-incubation time is 4 hours; The second co-incubation condition is an ice bath, and the co-incubation time is 1 hour.

9. Use of the engineered extracellular vesicles according to any one of claims 1 to 4 or the engineered extracellular vesicles obtained by the construction method according to any one of claims 5 to 8 in the preparation of a drug for treating atherosclerosis.

Images