Mutant of rice brittle culm control gene bc21, protein, expression vector and application thereof
By regulating the cellulose, hemicellulose, and lignin content of rice stems and leaves using the BC21 gene mutant, the problem of insufficient mechanical strength of rice stems was solved, brittleness was regulated, and the yield and quality of rice were improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- COLLEGE OF SCI & TECH NINGBO UNIV
- Filing Date
- 2022-04-24
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies are insufficient to effectively control the brittleness of rice, affecting the mechanical strength of its stems and its resistance to lodging, leading to a decline in yield and quality.
By regulating the content of cellulose, hemicellulose, and lignin in rice stems and leaves using the BC21 gene mutant, the cellulose content was reduced while the hemicellulose and lignin content were increased. The encoded protein made the rice stems and leaves brittle, and the plant architecture was optimized using the expression vector.
It significantly reduces the mechanical strength of rice stalks, increases their brittleness, makes them suitable for animal feed and easy to crush and return to the field, thereby improving the yield and quality of rice.
Smart Images

Figure CN116970618B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of rice breeding technology, and more specifically, to mutants, proteins, expression vectors, and applications of the rice fragility-regulating gene BC21. Background Technology
[0002] Rice is one of the world's most important food crops and my country's largest food crop, with its yield directly impacting national food security. The stem is a crucial component of the plant, and its mechanical strength is an important agronomic trait in rice breeding. Lodging resistance significantly affects rice yield; early lodging during rice growth leads to reduced yield, while late lodging not only decreases yield but also affects rice quality, and in severe cases, can cause plant death.
[0003] Fragile mutants are a class of mutants with significantly reduced mechanical strength, exhibiting alterations in the main components of their cell walls, such as cellulose, hemicellulose, and lignin. On the one hand, brittle mutants can reduce the cellulose content of rice stems while increasing the content of hemicellulose and lignin, altering the nutritional composition and making them more digestible and suitable for animal feed. On the other hand, the brittleness of the rice stems facilitates crushing and returning them to the field, reducing the phenomenon of farmers burning straw due to its difficulty in disposal, thus avoiding environmental pollution caused by straw burning. Furthermore, brittle mutants can regulate the stem diameter and cell wall thickness of rice. Since lodging in rice is mainly related to traits such as plant height, internode length, stem diameter, and cell wall thickness, differences in these traits alter the mechanical properties of the rice stem, such as its resistance to bending and mechanical strength, thus achieving brittleness without lodging. Therefore, developing brittle rice mutants into a dual-purpose rice and forage crop has great application potential in improving the utilization rate of straw resources and is of great significance for the development of green agriculture. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide the application of rice brittleness gene in regulating rice brittleness, so that the stems and leaves of rice mutants containing the gene exhibit brittleness.
[0005] To solve the above problems, the technical solution adopted by the present invention is as follows:
[0006] The application of gene BC21 in regulating rice fragility is to regulate rice fragility through gene BC21 mutation.
[0007] The gene BC21 is numbered Os06g0196600 in the Rice Genome Annotation Database and contains the nucleotide sequence shown in SEQ ID NO: 1.
[0008] Compared with existing technologies, this invention regulates the brittleness of rice by modulating the BC21 gene (Os06g0196600) in the Rice Genome Annotation Database to change the content of cellulose, hemicellulose and lignin in rice stems and leaves.
[0009] A mutant of the rice fragility-regulating gene BC21 is disclosed. The nucleotide sequence of BC21 is based on the sequence shown in SEQ ID NO: 1, but with a point mutation occurring 770 bp after the start codon ATG, replacing cytosine C with thymine T. Inducing this point mutation at 770 bp after the start codon ATG in the BC21 DNA sequence, replacing cytosine C with thymine T, significantly reduces the cellulose content and significantly increases the hemicellulose and lignin content in the rice stems of the BC21 mutant, and also significantly reduces the mechanical strength of the rice stems.
[0010] A protein encoded by a mutant of the rice fragility-regulating gene BC21, wherein the amino acid sequence of the protein, based on that shown in SEQ ID NO: 2, has an amino acid sequence in which the 257th amino acid is mutated from alanine to valine. The protein encoded by this mutant of the BC21 regulatory gene can impart fragility to the stems and leaves of rice containing this protein.
[0011] An expression vector containing the aforementioned gene BC21. The expression vector containing this rice fragility-regulating gene BC21 can enhance the fragility of the stems and leaves of rice plants containing this expression vector.
[0012] Application of the expression vector for the rice fragility-regulating gene BC21 in rice plant architecture improvement. Applying this expression vector to rice plant architecture improvement can optimize the plant architecture, making it more suitable for animal feed and easier to crush and return to the field.
[0013] Application of the mutant of the rice fragility-regulating gene BC21 in regulating the fragility of rice stems and leaves. Applying the mutant of the rice fragility-regulating gene BC21 to the regulation of rice stem and leaf fragility can significantly improve the fragility of rice stems and leaves.
[0014] Application of the mutant of the rice brittleness regulatory gene BC21 in rice improvement breeding or seed production. Applying the mutant of the rice brittleness regulatory gene BC21 to rice improvement breeding and seed production can provide rice seeds with brittle stems, facilitating the large-scale promotion and application of brittle rice.
[0015] Application of the mutant of the rice fragility regulatory gene BC21 in the preparation of transgenic rice. Applying the mutant of the rice fragility regulatory gene BC21 to the preparation of transgenic rice allows the transgenic rice to carry this fragility gene and facilitates the preservation of this fragility trait. Attached Figure Description
[0016] Figure 1 Phenotypic images of stem and leaf breaks in mature wild-type (WT) and bc21 mutants are shown. A shows the phenotypic image of stem breaks in mature wild-type (WT) and bc21 mutants, and B shows the phenotypic image of leaf breaks in mature wild-type (WT) and bc21 mutants.
[0017] Figure 2 Figures showing the flexural and tensile strength of stems in mature wild-type (WT) and bc21 mutants;
[0018] Figure 3 Figure 1 shows the cell wall component content analysis of the stems of the wild-type (WT) and bc21 mutant at maturity.
[0019] Figure 4 The image shows the map-based cloning and gene structure of the BC21 gene. A represents the fine mapping results of the BC21 gene, with RM6734 and RM253 being the SSR markers used for mapping, and STS1, STS2, and STS3 being newly developed polymorphic markers. B shows the structure and mutation sites of the BC21 gene, with untranslated regions and introns represented by white boxes and solid lines, respectively, and exons represented by black boxes. Arrows indicate mutation sites.
[0020] Figure 5 The images show the stem and leaf breakage phenotypes of wild-type (WT), bc21 mutant, and transgenic revertant (Comp) lines. A shows the stem breakage phenotype of mature wild-type (WT), bc21 mutant, and transgenic revertant (Comp) lines; B shows the leaf breakage phenotype of mature wild-type (WT), bc21 mutant, and transgenic revertant (Comp) lines.
[0021] Figure 6 This is a schematic diagram of the modified overexpression transformation vector pCAMBIA1300. Detailed Implementation
[0022] The present invention will be further illustrated below with reference to embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0023] Example 1
[0024] This embodiment provides the application of gene BC21 in regulating rice fragility, specifically by regulating rice fragility through gene BC21 mutation.
[0025] The gene BC21 is numbered Os06g0196600 in the Rice Genome Annotation Database and contains the nucleotide sequence shown in SEQ ID NO: 1.
[0026] Compared with existing technologies, this invention regulates the brittleness of rice by modulating the BC21 gene (Os06g0196600) in the Rice Genome Annotation Database to change the content of cellulose, hemicellulose and lignin in rice stems and leaves.
[0027] Example 2
[0028] This embodiment provides a mutant of the rice fragility regulatory gene BC21. The nucleotide sequence of the rice fragility regulatory gene BC21 is based on the one shown in SEQ ID NO: 1, with a point mutation at the base 770 bp after the start codon ATG in the DNA sequence, in which cytosine C is replaced by thymine T.
[0029] Phenotypic and genetic analysis of mutants
[0030] A mutant of the rice brittleness gene bc21 was screened from the Kasalath mutant library induced by ethyl methanesulfonate mutagenesis. Brittleness was confirmed by artificial breakage at maturity. Wild-type rice showed tough stems and leaves that were not easily broken, while the rice containing the bc21 gene exhibited brittleness; both its stems and leaves were easily broken, and the fracture surfaces were clearly defined. Figure 1 Using rice containing the bc21 gene mutant as the male parent, it was crossed with Nipponbare japonica rice. The F1 generation had a normal phenotype, indicating that the mutant was controlled by a recessive gene. The F2 generation was obtained by crossing the F1 generation. The F2 generation showed clear segregation, exhibiting traits from both parents. The segregation ratio of wild-type (non-brittle) plants to mutant (brittle) plants was 168 / 60 = 2.8, and the chi-square test result was 0.21 < χ². 2 0.05,1 =3.84, which is consistent with the 3:1 segregation ratio controlled by a pair of genes, indicating that the mutant is controlled by a recessive single gene.
[0031] Mechanical strength analysis of mutant stems
[0032] At maturity, stems of wild-type and bc21 mutant with the same internode were harvested from the field and placed on equally spaced supports. A digital tensile tester was used to apply downward pressure from the middle of the stem until it broke. This was repeated three times, and the peak value of the applied force was recorded as the stem's bending strength. Compared to the wild type, the mutant showed lower bending strength at the 1st, 2nd, and 3rd internodes, with a significant difference at the 1st and 3rd internodes. Ten stems each from the mature mutant and wild type were collected, and the tensile force at approximately 10 cm of the stem at the 2nd internode was measured using a universal tensile testing machine. The results showed that the mutant's strength at the 2nd internode was reduced by 81.44% compared to the wild type, reaching a highly significant level. Figure 2 Therefore, the brittleness of the mutant stem affects its mechanical strength.
[0033] Analysis of cell wall component content in mutant stems
[0034] Mature wild-type and brittle-stem mutant stems from field cultivation were collected. The stems and leaves were separated, cut into appropriate lengths, and placed in clean, sealed bags. This process was repeated three times. The samples were sent to Ningbo Hangjing Biotechnology Co., Ltd. for determination of cellulose, hemicellulose, and lignin content, and the results were analyzed. Compared with the wild type, mutant bc21 showed a 36.6% decrease in cellulose content, and increases of 23% and 26% in hemicellulose and lignin content, respectively. Figure 3 The cellulose content of mutant bc21 is significantly lower than that of wild type, and the decrease in cellulose content may be the main reason for the brittleness and reduced mechanical strength of bc21 plants.
[0035] Location of the BC21 gene
[0036] Thirty fragile mutant individuals were screened from the F2 generation of the cross between mutant bc21 and Nipponbare for gene mapping cloning. Initial mapping located the mutant gene on chromosome 6, with SSR markers between RM6734 and RM253. Subsequently, the sample size was expanded, and fragile mutants were screened. Three new polymorphic STS molecular marker pairs were further designed between the two markers, named STS1, STS2, and STS3, with the following sequences:
[0037] STS1U-5'ACCAGGCTGAATGTATAGAT 3'
[0038] STS1L-5'TTAGGCACATAAACCAAG 3'
[0039] STS2U-5'AAAATTGTAGGTGGGTTGGT 3'
[0040] STS2L-5'TACAGAGAAAAAGATTGAAGC 3'
[0041] STS3U-5'CAGTGATTCGTTTGAAAT 3'
[0042] STS3L-5'CCCTGTTGTTTGTATGAC 3'
[0043] Ultimately, the genes were located between STS markers STS2 and STS3 (specifically, their physical locations on chromosome 6 are 4873357 bp and 4926248 bp, respectively), with recombinants of 1 / 1476 and 3 / 1476, respectively, and a physical distance of 52.9 kb. Figure 4 ).
[0044] Gene prediction and sequence analysis
[0045] Gene prediction analysis within the located chromosomal region was performed using the websites TIGR and Rice Genome Annotation Database, revealing 5 predicted genes and 2 genes with unknown expression within that region. cDNA sequencing of the 7 candidate genes, followed by bioinformatics comparative analysis, identified the BC21 gene, designated Os06g0196600. This gene has a full-length DNA of 3387 bp and a full-length cDNA of 1398 bp, consisting of 7 exons and 6 introns. A point mutation occurs 770 bp after the start codon ATG, changing the base from C to T, resulting in a mutation of the 257th amino acid in its encoded protein from alanine to valine.
[0046] BC21 Functional Complementarity Experiment
[0047] Construction of the response vector: Using a modified binary plant vector pCAMBIA1300 (… Figure 6 A 1398bp BC21cDNA sequence was inserted into the DNA.
[0048] Primers were designed based on the full-length ORF sequence of BC21. The primer sequences are as follows (underlined areas are restriction enzyme sites):
[0049] OVER-R: 5'AAAGAGCTCATGCAGAGCCTCTCCTCCCCA 3'
[0050] OVER-F: 5'AAATCTAGAGTAACGTTGCCGGCTGTC 3'
[0051] Total RNA was extracted from rice kasalash leaves using a Shanghai Sangon RNA extraction kit (SK1321). First-strand cDNA was synthesized using Oligo(dt)-18 primers and the extracted total RNA as a template via reverse transcription. Using this cDNA as a template, the full-length ORF was amplified using PrimeSTAR HS DNA Polymerase. PCR conditions were: 98℃ pre-denaturation for 10 s, 30 cycles of 98℃ for 10 s; 58℃ for 10 s; 72℃ for 1 min; and a final extension for 10 min. The PCR product was recovered by agarose gel extraction, purified by A-tailing, and ligated into the pMD19-T vector. The ligation product was heat-shocked and transformed into E. coli DH5α competent cells. After culturing at 37°C for 16 h, positive single clones were selected and sequenced. After sequencing and confirmation that the sequence was correct, the pCAMBIA1300 vector was modified and digested overnight at 37°C with SacI and XbaI. The ligation product was then transformed into E. coli. Plasmids were extracted by shaking. After the plasmids were verified to be correct by double enzyme digestion, the strain was preserved.
[0052] Electroporation transformation of Agrobacterium: The constructed vector was used to transform mature embryonic callus of the mutant bc21 via Agrobacterium strain EHA105. After infection, co-culture, screening for hygromycin-resistant callus, differentiation, rooting, hardening, and transplanting, transgenic plants were obtained. At maturity, fragility was confirmed, and the stems and leaves of the revertant lines reverted to the wild type. Figure 5 This study confirmed that the brittle stem phenotype of the mutant was caused by a point mutation in the BC21 gene.
[0053] The mutant of the rice brittleness regulation gene BC21 provided in this embodiment can significantly improve the brittleness of rice stems and leaves when applied to the regulation of brittleness.
[0054] The mutant of the rice brittleness regulatory gene BC21 provided in this example can also be applied to rice improvement breeding or seed production. Applying this mutant of the rice brittleness regulatory gene BC21 to rice improvement breeding and seed production can provide rice seeds with brittle stems, facilitating the large-scale promotion and application of brittle rice.
[0055] The mutant of the rice fragility-regulating gene BC21 provided in this embodiment can also be used in the preparation of transgenic rice. Applying this mutant of the rice fragility-regulating gene BC21 to the preparation of transgenic rice allows the transgenic rice to carry this fragility gene and facilitates the preservation of this fragility trait.
[0056] While the disclosure is as stated above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of this disclosure, and all such changes and modifications will fall within the protection scope of this invention. sequence list <110> Ningbo University of Science and Technology <120> mutants, proteins, expression vectors, and applications of the rice fragility regulatory gene BC21 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 3387 <212> DNA <213> Artificial sequences <400> 1 cgagcccaga cctccaccat cgccaccacc tccgcctcgt ttccatcgcc accacctcct 60 cccgccgccg ccgccgccac cgccgcgatg cagagcctcc tcctccccac cttcgccgcg 120 gcctccgccg cccccccgcg gagggggcgc gtgcctcccg ccggtcgcgc ctcggtctcc 180 gtgcgcgcgt ccgcgtccgc ggcggcggtg gcgccgagga gggagacgga tccgaggaag 240 agggtggtga tcacggggat ggggctggtg tccgtgttcg ggaacgacgt cgacgcctac 300 tacgaccgcc tcctcgccgg ggagagcggg attggcccca tcgaccgctt cgacgcctcc 360 aacttcccca cccgcttcgc cggccagatc cggggcttct cctccgaggg ctacatcgac 420 ggcaagaacg accgccgcct cgacgactgc ctccgctact gcatcgtcag cggcaagaag 480 gccctcgagt ccgccggcct cgccctcggc tccaaatcca tggacaaggt atttttcaaa 540 tgcactagta tcttttgctt cctcatgttc tcacatcctg ttaaaagttc ttagctagtg 600 gaggtacgag attccgattc gtagaaagtg tctcctgtgg tttagcactt ttgatagatc 660 agatcagcag ctgattcttt tatgaaatgg tggtgggatt tttttcccca tttctgtgat 720 agtatctgag tgagttagt agagagtcct agtatcgact cgacaagtgg agtaggcatt 780 attgcaatcc tggtgtgtgt atatttctat ttaattatca taaagaaggt tgttgagggt 840 ccatgtattt ctgttggcca tggaaggtta tagggggcgt atctgtttta aattgctgtc 900 aagtatcaat gcaatgcaga tggattcatt tcaagtttaa aaagattagt tcaacactat 960 agaggttttg tctggagcaa aacgaaaaaa aaaactgttt ttgcatttta ccatttattg 1020 atgtagaaat attttcaaat cacacccttt tgggcccatg tttcgttggt ttatatagt 1080 tggcgatagc ttcatcagtt cactctgcta tcaatttttc attgcttgta ctatgggtga 1140 aggatacct ggtgctaatt agtaaatgtt acatcgttgc agattgaaaa gactcgggct 1200 ggtgtacttg tgggcaccgg tatgggtggt cttacagtgt tctctgatgg tgttcagaat 1260 cttattgaga aggggcacag aaagataact ccattcttca ttccgtatgc cataacaaac 1320 atgggatctg cccttcttgg aatggacatt ggtttcatgg gtccaaacta ctccatctca 1380 actgcatgtg ctacctcgaa ctactgtttc tatgctgcag caaaccatat tcgcagaggc 1440 gaagccgatg tgatgattgc tggtggcact gaagccgcaa ttattccgat tggtgtcggt 1500 gggttgtcg cgtgtagagc actttcacag aggaacgatg accccaaaac agcatcaaga 1560 ccttgggacc aagaccgtga tggttttgtc atgggtgaag gagctggagt actggtatgt 1620 ttagtgaaca tattcaagtt tcaggttttc actctgttaa acatcttcta atcatttagc 1680 tctgccaaat taaaaaagg tcatggagag cttagaacat gcaatgaagc gtgacgcacc 1740 aataattgcg gagtatttag gaggtgccgt gaactgtgat gcttaccata tgactgaccc 1800 gagatctgat ggccttggtg ttcgtcttg cattaagcaa agctttgcag atgctggcgt 1860 tgcaccggag gaggtaatcc aaatattaca actttaaaga gcactcttat gtgttagttc 1920 tgtcatctgt aaaattgtat acctttttga tctggcagct gatacataag ctatgattta 1980 taatctgtcc tttggtttt tgtggggtgt taggattctt gtgtttgtta tgccagctat 2040 ttttaacacc aattccagcg atattgccc tgttggaaaa agaaggtttt ccgtttgatg 2100 ttctagaatt gatgttttca ccatgagctc tggttgctat tctgtatttt gttacaatt 2160 aatcaattgt tgtgtgtatt tattgcaaat tgtatggttt tgtttgggca aataatttga 2220 tgaaatttca tgtgtattta aatcacaaac gttttttttg caggtcaact acataaatgc 2280 tcatgcaacg tccaccctag ctggtgatct ggcagaggtg aacgccatta ggcaagtctt 2340 caaggatcca tcagagatta aaataaatgc aaccaaggtg cttttatgtt ccttatgtgt 2400 tttacctcca aattcaagga gactatacat tgccttccta atacaatctt ctgtttgcag 2460 tccatgattg gacattgcct tggtgcggct ggtggcttgg aagccattgc aactgttaaa 2520 gctataacca ctggatgggt ccatccaagc ataaaccagt ttgtaagtac cattttaaaa 2580 catcacttgc taatttacct agcctgccag tgggaacctg aggcacatta tggctagaaa 2640 aactaagggc tacattctta ttaatcacag aacccggagc cagctgttga atttgacacg 2700 gtacctaatg taaaaaagca acatgaagtg aatgttggtg agtaacaatg catgtggttt 2760 actgtattac tccgccatca atttcctctt cctdatatt gttttgtgtt gctatacagg 2820 tatctcgaat tcctttggat ttggtggaca caattcagtt gtagtatttg caccatttaa 2880 gccttaactt gctgcatgtt acacaaatct tggccagaat agtaaatgtc ttttcaggaa 2940 gttctgagtt attctgcatg tcttttcttt gggtgaagca actgttgatt tgacagccgg 3000 caacgttaca atgaactgga tctgagatta attccatttt aggcactccc atcttccatt 3060 gaaattgaga gctctgtata acgttgtttt gcataatttg caattgattc tacctacttc 3120 tgtataatgg aaaatgtggg aatttctaga attgtcatgt agaagcaaaa gttagatctc 3180 ctgttccata gaaatgcttg agccaaggaa ttgcttgtct gtaatttgta tctggtctag 3240 aaaaatgttc tcttcatttt tttttcttgt ccagtatgcc aatgtccgtc tagtggaata 3300 aaatgtattc agttttgctt aacttgctcg gctaatagct tggttcgatg agatgaaata 3360 ttctagattt cgccctgaat gtgtaca 3387 <210> 2 <211> 465 <212> PRT <213> Artificial sequences <400> 2 Met Gly Ser Leu Leu Leu Pro Thr Pro Ala Ala Ala Ser Ala Ala Pro 1 5 10 15 Pro Ala Ala Gly Ala Val Pro Pro Ala Gly Ala Ala Ser Val Ser Val 20 25 30 Path Path Ser Path Ser Path Path Path Val Path Pro Path Path Gly Thr Path 35 40 45 Pro Ala Leu Ala Val Val Ile Thr Gly Met Gly Leu Val Ser Val Pro 50 55 60 Gly Ala Ala Val Ala Ala Thr Thr Ala Ala Leu Leu Ala Gly Gly Ser 65 70 75 80 Gly Ile Gly Pro Ile Ala Ala Pro Ala Ala Ser Ala Pro Pro Thr Ala 85 90 95 Pro Ala Gly Gly Ile Ala Gly Pro Ser Ser Gly Gly Thr Ile Ala Gly 100 105 110 Leu Ala Ala Ala Leu Ala Ala Cys Leu Ala Thr Cys Ile Val Ser 115 120 125 Gly Leu Leu Path Leu Gly Ser Path Gly Leu Path Leu Gly Ser Leu Ser 130 135 140 Met Ala Leu Ile Gly Leu Thr Ala Ala Gly Val Leu Val Gly Thr Gly 145 150 155 160 Met Gly Gly Leu Thr Val Pro Ser Ala Gly Val Gly Ala Leu Ile Gly 165 170 175 Leu Gly His Path Leu Ile Thr Pro Pro Pro Ile Pro Thr Path Ile Thr 180 185 190 Ala Met Gly Ser Ala Leu Leu Gly Met Ala Ile Gly Pro Met Gly Pro 195 200 205 Path Thr Ser Ile Ser Thr Path Cys Path Thr Ser Path Thr Cys Pro Thr 210 215 220 Ala Ala Ala Ala His Ile Ala Ala Gly Gly Ala Ala Val Met Ile Ala 225 230 235 240 Gly Gly Thr Gly Pathway Ile Ile Pro Ile Gly Val Gly Gly Pro Val 245 250 255 Path Cys Path Path Leu Ser Gly Path Path Path Pro Leu Thr Path Ser 260 265 270 Path Pro Thr Path Gly Path Path Path Gly Pro Val Met Gly Gly Gly Path 275 280 285 Gly Val Leu Val Met Gly Ser Leu Gly His Ala Met Leu Ala Ala Ala 290 295 300 Pro Ile Ile Ala Gly Thr Leu Gly Gly Ala Val Ala Cys Ala Ala Thr 305 310 315 320 His Met Thr Ala Pro Ala Ser Ala Gly Leu Gly Val Ser Ser Cys Ile 325 330 335 Leu Gly Ser Leu Ala Ala Ala Gly Val Ala Pro Gly Gly Val Ala Thr 340 345 350 Ile Ala Ala His Ala Thr Ser Thr Leu Ala Gly Ala Leu Ala Gly Val 355 360 365 Ala Ala Ile Ala Gly Val Pro Leu Ala Pro Ser Gly Ile Leu Ile Ala 370 375 380 Ala Thr Leu Ser Met Ile Gly His Cys Leu Gly Ala Ala Gly Gly Leu 385 390 395 400 Gly Ala Ile Ala Thr Val Leu Ala Ile Thr Thr Gly Thr Val His Pro 405 410 415 Ser Ile Ala Gly Pro Ala Pro Gly Pro Ala Val Gly Pro Ala Thr Val 420 425 430 Pro Ala Val Leu Leu Gly His Gly Val Ala Val Gly Ile Ser Ala Ser 435 440 445 Pro Gly Pro Gly Gly His Ala Ser Val Val Val Pro Ala Pro Pro Leu 450 455 460 For 465
Claims
1. The application of gene BC21 in regulating rice brittleness, characterized in that, The application involves regulating the fragility of rice through mutation of the BC21 gene. The BC21 gene is numbered Os06g0196600 in the Rice Genome Annotation Database and contains the nucleotide sequence shown in SEQ ID NO:
1. The mutation refers to a point mutation in which cytosine C is replaced by thymine T at a position 770 bp after the start codon ATG in the nucleotide sequence shown in SEQ ID NO:
1. The regulation is to increase the fragility of rice stems and leaves.
2. A mutant of the rice fragility-regulating gene BC21, characterized in that, The nucleotide sequence of the mutant of the rice fragility regulatory gene BC21 is based on the sequence shown in SEQ ID NO: 1, with a point mutation at 770 bp after the start codon ATG, in which cytosine C is replaced by thymine T.
3. A protein encoded by a mutant of the rice fragility-regulating gene BC21 as described in claim 2, characterized in that, The amino acid sequence of the protein is based on that shown in SEQ ID NO: 2, with the 257th amino acid in the sequence mutated from alanine to valine.
4. The application of the mutant of the rice fragility regulating gene BC21 as described in claim 2 in regulating the fragility of rice stems and leaves, wherein the application refers to improving the fragility of rice stems and leaves.
5. The application of the mutant of the rice fragility regulating gene BC21 as described in claim 2 in rice improvement breeding or seed production, wherein the application refers to improving the fragility of rice stems and leaves.
6. The application of the mutant of the rice fragility regulating gene BC21 as described in claim 2 in the preparation of transgenic rice, wherein the application refers to improving the fragility of rice stems and leaves.
Citation Information
Patent Citations
Rice root elongation control gene OsKASI and encoded protein
CN104031928A