Multiple small nucleic acid delivery system and multiple target vaccine

By loading multiple small nucleic acid molecules onto the hydrophobically modified peptide VQWRIRVAVIRK to form a multiple small nucleic acid delivery system, the problem of unsatisfactory effects of single targets in tumor treatment is solved, and the synergistic anti-tumor effect of multiple targets is achieved, enhancing the tumor immune response and therapeutic effect.

CN116999565BActive Publication Date: 2026-05-19SICHUAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310985298.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-07
Publication Date
2026-05-19
Estimated Expiration
2043-08-07

AI Technical Summary

Technical Problem

Current cancer treatments targeting single targets are not very effective. The complexity of the tumor microenvironment limits the effectiveness of immunotherapy, and the combined use of single targets is also not ideal.

Method used

The hydrophobically modified peptide VQWRIRVAVIRK is loaded with multiple small nucleic acid molecules, including siRNA and CpG oligonucleotides, to form a multiple small nucleic acid delivery system for the preparation of multiple target in situ vaccines, and can be used in combination with immune checkpoint inhibitors.

Benefits of technology

It improves the efficacy of tumor immunotherapy, can efficiently deliver a variety of small nucleic acids into cells, synergistically stimulates dendritic cell maturation, inhibits tumor cell proliferation and migration, relieves the inhibitory tumor microenvironment, enhances the immune response, and is a universal vaccine applicable to a variety of tumors. It is low in cost and has high safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116999565B_ABST
    Figure CN116999565B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biological medicine, and particularly relates to a multiple small nucleic acid delivery system and a multiple target vaccine. The present application aims to solve the problem that the treatment effect of single target in tumor biological treatment is not ideal. The technical solution for solving the problem is to provide a multiple small nucleic acid delivery system in which a hydrophobic modified polypeptide is loaded with multiple small nucleic acids. The sequence of the polypeptide is VQWRIRVAVIRK, and the hydrophobic modification is coupling of a hydrophobic fragment to the nitrogen terminal end of the polypeptide. Meanwhile, the present application provides a multiple small nucleic acid system containing siRNA molecules of STAT3, CCR2 and TGF-beta and CpG ODNs molecules. The polypeptide of the present application can quickly self-assemble into nanomicelles after being mixed with small nucleic acids to form a nanosystem loaded with multiple small nucleic acids; as an in situ vaccine carrier, the nanosystem can be used for treating different tumors by targeting different targets in the tumor microenvironment; and the nanosystem is low-toxic and safe, has a short preparation cycle, and has a good clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of vaccine preparation, specifically involving the preparation of multiple small nucleic acid delivery systems and multiple target vaccines. Background Technology

[0002] While significant progress has been made in tumor immunotherapy in recent years, several challenges remain in practical application. These include: 1) The overall response rate of immune checkpoint inhibitors is only 20-30%, and they do not specifically enhance the body's immunity, resulting in significant side effects and the risk of inducing autoimmune diseases; 2) Although breakthroughs have been achieved in hematological malignancies, CAR-T cell therapy has limited efficacy in solid tumors due to single-target therapy, poor penetration of solid tumors, and the inhibitory tumor microenvironment, limiting its application. Side effects include cytokine storms and neurotoxicity; 3) Personalized vaccines based on mutated neoantigens have long development cycles, complex preparation processes, and limited applicable populations, and the immune response induced by the body is insufficient to eliminate large tumors. Therefore, the key to improving the efficacy of tumor immunotherapy lies in finding (or releasing) specific and effective tumor antigen targets and relieving immunosuppression in the tumor microenvironment, thereby restoring and rebuilding the body's normal anti-tumor immune defense capabilities. In situ tumor vaccines can directly kill tumor cells in situ, release mutated neoantigens, induce an immune response, and kill distant tumors. Compared with personalized vaccines prepared based on genome sequencing, in situ vaccines do not require sequencing analysis and synthesis of peptides or mRNA, thus shortening treatment time and saving treatment costs. They can be used as a universal vaccine applicable to a variety of tumors for large-scale application.

[0003] The tumor microenvironment is a complex system composed of numerous immune cells, stromal cells, extracellular matrix, and active mediators, in addition to tumor cells. During malignant tumor growth, a suppressive tumor microenvironment gradually forms, including changes at various cellular levels: ① various immunosuppressive cells, including tumor-associated macrophages, myeloid-derived suppressor cells, and regulatory T cells; ② tumor-associated fibroblasts in the extracellular matrix; ③ microvascular disturbances within the tumor, lack of integrins in vascular endothelial cells, and changes at the molecular level; ④ immune checkpoint inhibitors such as PD-1 and CTLA4; ⑤ various soluble inhibitory factors secreted by suppressor cells, such as TGF-β, IL-10, and IL-6; ⑥ hypoxia, nutrient deficiency, decreased pH, and accumulation of metabolic toxic products within the tumor microenvironment. This suppressive immune microenvironment is a crucial basis for tumor cells to escape immune surveillance and for tumor development and progression, and is also one of the important reasons for poor efficacy of immunotherapy. Transforming the immunosuppressed "cold tumor" into an immunosuppressed "hot tumor" through different methods is currently a key research focus for improving the efficacy of tumor immunotherapy. However, due to the heterogeneity and complexity of tumors, the therapeutic effect of a single target is not ideal, and combining several different targets is one of the research hotspots in tumor immunotherapy.

[0004] While various immune adjuvants for activating tumor vaccines and drugs such as monoclonal antibodies, small molecule inhibitors, or siRNA targeting various targets to relieve the inhibition of the tumor microenvironment are currently in preclinical or clinical use, the tumor microenvironment is a complex network involving multiple cells and factors that interact with tumor cells. Treatment targeting a single link or single target within it is not ideal. In recent years, researchers have explored many combined immunotherapies, including the clinical use of immune checkpoint inhibitors in combination with conventional treatments (such as radiotherapy, chemotherapy, targeted drugs, and oncolytic virus therapy), the combination of multiple checkpoint inhibitors, and preclinical exploration of multi-target combinations (such as the combination of dual TLR agonists, and the combination of TGF-β small molecule inhibitors with IL-6 monoclonal antibodies and mRNA vaccines). However, how to combine these drugs to achieve a synergistic effect and overcome the inhibitory tumor microenvironment remains a crucial problem that urgently needs to be solved. Summary of the Invention

[0005] The technical problem that this invention aims to solve is that current cancer treatments targeting a single link or a single target do not yield ideal results.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is to provide a multiple small nucleic acid delivery system, which is prepared by loading two or more small nucleic acid molecules with a hydrophobically modified polypeptide; the sequence of the polypeptide is VQWRIRVAVIRK, and the hydrophobic modification is to couple a hydrophobic fragment to the nitrogen end of the polypeptide.

[0007] In the above-mentioned multiple small nucleic acid delivery system, the multiple small nucleic acids are two or more siRNAs.

[0008] In the above-mentioned multiplex small nucleic acid delivery system, the small nucleic acid is a nucleic acid molecule with a length of 18-35 bp.

[0009] In this system, the small nucleic acids are siRNAs targeting at least two of Stat3, Ccr2, and Tgfβ1.

[0010] Furthermore, the aforementioned multiplex small nucleic acid delivery system also includes CpG oligonucleotides. Preferably, the sequence of the CpG ODNs is: 5'-TCCATGACGTTCCTGACGTT-3'.

[0011] In this system, the peptide VQWRIRVAVIRK in the multiple small nucleic acid delivery system is modified by amidation of its carbon terminus to form VQWRIRVAVIRK-NH2.

[0012] In the above-mentioned multiple small nucleic acid delivery system, the hydrophobic fragment is a sterol compound, a saturated straight-chain fatty acid, or PEG or a PEG derivative; wherein the sterol compound is a cholesterol compound or a bile acid compound; or the saturated straight-chain fatty acid is at least one of C6-C20.

[0013] In the above-mentioned multiple small nucleic acid delivery system, the sterol compound is at least one of succinylated cholesterol, cholic acid or deoxycholic acid; or the PEG derivative is at least one of 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine-polyethylene glycol, distearylphosphatidylethanolamine-polyethylene glycol or dipalmitoylphosphatidylethanolamine-polyethylene glycol.

[0014] In the aforementioned multiplex small nucleic acid delivery system, the N-terminus of the hydrophobic peptide is coupled to the hydrophobic fragment via an amidation reaction between the -CO-OH group on the hydrophobic fragment and the -NH2 group on the peptide; preferably, the structure of the hydrophobically modified peptide is as follows:

[0015]

[0016] The R mentioned is a sterol compound, a saturated straight-chain fatty acid, or a PEG derivative.

[0017] In the above-mentioned multiplex small nucleic acid delivery system, the R in the polypeptide structure of the hydrophobic peptide is: , , , or At least one of them.

[0018] The aforementioned multiplex small nucleic acid delivery system is prepared from modified peptides and small nucleic acids at a mass ratio of 4 to 10:1. Preferably, the modified peptides and small nucleic acids are prepared at a mass ratio of 5:1.

[0019] In the aforementioned multiplex small nucleic acid delivery system, the proportions of the various small nucleic acids are based on approximately equal mass ratios. For example, if there are four types of small nucleic acids, they can be prepared in a mass ratio of 1:1:1:1.

[0020] The aforementioned multiple small nucleic acid delivery system was prepared by co-incubating hydrophobically modified peptides with small nucleic acids.

[0021] The aforementioned multiple small nucleic acid delivery system is obtained by co-incubating hydrophobically modified peptides and small nucleic acids in water or liquid culture medium for 5–15 min; furthermore, the liquid culture medium is at least one of RPMI 1640, DMEM dual-free medium, or Optim medium. The multiple small nucleic acids are uniformly distributed together in the water or liquid culture medium.

[0022] Furthermore, the aforementioned multiple small nucleic acid delivery system is prepared by co-incubating a hydrophobically modified polypeptide loaded with multiple small nucleic acids with a hydrophobically modified polypeptide small nucleic acid loaded with CpG ODNs.

[0023] This invention also provides the role of the above-mentioned multiplex small nucleic acid delivery system in the preparation of multiple target in situ vaccines.

[0024] Furthermore, the aforementioned tumors are selected from at least one of the following: melanoma, lung cancer, stomach cancer, esophageal cancer, liver cancer, pancreatic cancer, intestinal cancer, bladder cancer, prostate cancer, and breast cancer.

[0025] This invention also provides a multi-target vaccine made with the above-mentioned multiple small nucleic acid delivery system as the main active ingredient. Furthermore, the multi-target vaccine is a multi-target in situ vaccine.

[0026] Among them, the aforementioned multi-target vaccines also contain immune checkpoint inhibitors.

[0027] Among them, the aforementioned immune checkpoint inhibitors are PD-1 monoclonal antibodies, PD-L1 monoclonal antibodies, or CTLA-4 monoclonal antibodies.

[0028] Among them, the aforementioned immune checkpoint inhibitors are at least one of atezolizumab, pembrolizumab, tislelizumab, or camrelizumab.

[0029] Furthermore, the aforementioned vaccine is a tumor vaccine. Even further, the immune checkpoint inhibitors and multiplex small nucleic acid delivery systems in the aforementioned multi-target vaccine are packaged separately.

[0030] The aforementioned vaccines also contain pharmaceutically acceptable adjuvant components.

[0031] The beneficial effects of this invention are as follows: This invention creatively combines several small nucleic acids targeting different tumor-related pathways and loads them with a hydrophobically modified VQWRIRVAVIRK peptide. The resulting multiple small nucleic acid delivery system can efficiently deliver these multiple small nucleic acids into cells. The combination of several different small nucleic acids can efficiently and synergistically stimulate DC maturation, induce tumor cell apoptosis, inhibit tumor cell proliferation and migration, and relieve the inhibitory tumor microenvironment. Simultaneously, this invention's multiple small nucleic acid delivery system can be used in combination with PD-1 monoclonal antibodies to achieve a synergistic anti-tumor effect, improving therapeutic efficacy while ensuring safety, and overcoming the shortcomings of PD-1 monoclonal antibodies in tumors such as melanoma. In the embodiments of this invention, intratumoral immunization of mice with DP7-C peptide loaded with multiple siRNAs showed significantly enhanced anti-tumor effects and effector immune cell responses. This demonstrates that the technical solution of this invention can, to a certain extent, activate the function of immune cells in the tumor microenvironment by efficiently delivering small nucleic acids, promoting DC maturation, enhancing T cell infiltration in tumors, and comprehensively promoting the final in vivo effect of the in situ vaccine. Meanwhile, the technical solution of this invention is convenient to prepare, low in cost, low in toxicity and safe, and has a short preparation cycle. Compared with the cycle of personalized vaccines prepared based on genome sequencing, it is a universal vaccine applicable to a variety of tumors, which is easy to achieve large-scale application and has a good clinical application prospect. Attached Figure Description

[0032] Figure 1 Synthetic route of antimicrobial peptide DP7 coupled with cholesterol to form DP7-C.

[0033] Figure 2 Mass spectrum of DP7-C.

[0034] Figure 3 Preparation and characterization of DP7-C-loaded small nucleic acids. a. Particle size of DP7-C / multiplex siRNA / CpG ODNs. b. Transmission electron microscopy image of DP7-C / multiplex siRNA / CpG ODNs. c. Detection of the ratio of DP7-C / siRNA and DP7-C / CpG ODNs complexes by gel retardation electrophoresis. d. Stability test of DP7-C / siRNA complexes treated with RNase A.

[0035] Figure 4Efficiency assay of DP7-C / siRNA complex transfection in 293T cells. a. Fluorescence image of transfected 293T cells. b. Statistical analysis graph by flow cytometry. (*p<0.05, **p<0.01, ***p<0.001).

[0036] Figure 5 q-PCR was used to detect the silencing efficiency of DP7-C / multiplex siRNA at the cellular level.

[0037] Figure 6 DP7-C cytotoxicity assay.

[0038] Figure 7 DP7-C / multiplex siRNA synergistically induced dendritic cell (DC) maturation, tumor cell apoptosis, and inhibited tumor cell proliferation and migration in vitro. a. Detection of DP7-C / multiplex siRNA synergistic induction of DC maturation; b. DP7-C / multiplex siRNA synergistic induction of tumor cell apoptosis; c. DP7-C / multiplex siRNA synergistic inhibition of tumor cell proliferation; d. DP7-C / multiplex siRNA synergistic inhibition of tumor cell migration. (*p<0.05, **p<0.01, ***p<0.001).

[0039] Figure 8 Antitumor effect of DP7-C / multiplex siRNA complex in treating a CT26 subcutaneous tumor model. A. Tumor volume after 6 treatments; B. Tumor weight; C. Treg cells / CD4+ ratio in the tumor. + Cells / NK cells / CD8 + Cell percentage. (*p<0.05, **p<0.05, ***p<0.001).

[0040] Figure 9 Antitumor effect of DP7-C / multiplex siRNA complex in treating a B16 subcutaneous tumor model. A. Tumor volume after 6 treatments; B. Tumor weight; C. Treg cells / CD4+ ratio in the tumor. + Cells / NK cells / CD8 + Cell percentage. (*p<0.05, **p<0.05, ***p<0.001).

[0041] Figure 10Antitumor effects of DP7-C / multiplex siRNA complex combined with PD-1 monoclonal antibody in the treatment of CT26 and B16 subcutaneous tumor models. a. CT26 tumor growth curve (arrows indicate administration time points); b. CT26 tumor volume after combined PD-1 monoclonal antibody treatment; c. B16 tumor growth curve (arrows indicate administration time points); d. B16 tumor volume after combined PD-1 monoclonal antibody treatment. Detailed Implementation

[0042] DP7 (QWRIRVAVIRK, SEQ ID No. 8) is a reported positively charged hydrophilic antimicrobial peptide, commonly available in the form of an amidation-modified C-terminus. The DP7 used in this invention is QWRIRVAVIRK-NH2. Hydrophobic fragments (or hydrophobic compounds) such as cholesterol, bile acids, and long-chain fatty acids, coupled with hydrophilic peptides, may possess the ability to self-assemble into nanostructures. This study utilizes the hydrophobic fragment to couple the antimicrobial peptide DP7 to nanostructure the antimicrobial peptide, enabling in-situ intratumoral drug delivery.

[0043] Meanwhile, because DP7 carries a positive charge, the self-assembled hydrophobic DP7 micelles are positively charged in aqueous solution, demonstrating their potential as a non-viral gene delivery vector, particularly for siRNA. Based on previous research, this invention suggests that hydrophobically modified DP7, if it can combine with the silencing effect of siRNA targeting tumor sites, could potentially play an important role in siRNA-based tumor therapy research and applications.

[0044] This invention utilizes micelles formed by hydrophobically modified DP7, especially cholesterol-modified DP7-C conjugates, to successfully load various small nucleic acids and efficiently introduce them into tumor cells. This opens up possibilities for the establishment of multiple small nucleic acid delivery systems, particularly for the delivery of multi-target antisense nucleic acids (ASO), small interfering nucleic acids (siRNA), microRNAs (miRNA), aptamers, and transfer RNA (tRNA) fragments.

[0045] This invention demonstrates that the small nucleic acid delivery system of this invention can achieve efficient delivery of at least three siRNAs, allowing them to exert their individual biological effects effectively without significant interference. In particular, it can provide small nucleic acid drugs targeting multiple different sites to act synergistically against a single disease or tumor.

[0046] For example, in the embodiments of this invention, siRNA molecules targeting three different targets—Stat3, Ccr2, and Tgfβ1—were selected in advance and co-incubated with DP7-C to obtain DP7-C / Stat3 siRNA+Ccr2 siRNA+Tgfβ siRNA composite nanoparticles. These nanoparticles exhibited significantly enhanced anti-tumor effects and lymphocyte responses.

[0047] The selection of the three targets was based on extensive preliminary research. To investigate the differences between "cold" and "hot" tumors, we performed transcriptome sequencing on CT26 and B16F10 subcutaneous tumors to analyze the differentially expressed immune gene profiles of "cold" and "hot" tumors. Compared with mice inoculated with B16F10 "cold" tumors, mice inoculated with CT26 "hot" tumors had higher gene expression profiles related to effector T cells, co-stimulatory molecules, and inflammatory cytokines. Simultaneously, we analyzed the differentially expressed genes related to the tumor microenvironment between hot and cold tumors. Transforming immunosuppressive "cold" tumors into immunosuppressive "hot" tumors through different methods is currently a key research focus for improving the efficacy of tumor immunotherapy. The tumor microenvironment is highly complex, and there are many types of targets that can improve the efficacy of tumor immunotherapy by improving the tumor microenvironment, transforming "cold" tumors into "hot" tumors. Furthermore, due to the heterogeneity and complexity of tumors, the therapeutic effect of a single target is not ideal; therefore, combining several different targets is also a current research hotspot in clinical trials. Based on this, we screened differential immune gene profiles of "cold" and "hot" tumors and selected targets from different pathways for assembly. Among these genes, STAT3 induces tumor cell death, leading to the release of tumor-associated antigens, while CCR2 and TGFβ play important roles in cell proliferation, invasion, anti-apoptosis, and suppression of immune responses in many cancers.

[0048] To achieve better immune responses, the small nucleic acid delivery system of this invention can also incorporate CpG ODNs, which primarily function as immune adjuvants. Since CpG ODNs are themselves small nucleic acids, they can be formulated into nanoparticles with DP7-C alone, and then used in conjunction with the aforementioned composite nanoparticles made from small nucleic acid drugs and DP7-C; alternatively, CpG ODNs and small nucleic acid drugs can be co-incubated with DP7-C to form composite nanoparticles. The amount of CpG ODNs can be adjusted according to actual usage requirements. In one example of this invention, three siRNAs and CpG ODNs were used, with a mass ratio of 1:1:1:1, achieving good anti-tumor effects.

[0049] Immune checkpoint inhibitors, such as PD-1, PD-L1, or CTLA-4 monoclonal antibodies, are widely used in current immunotherapy. However, due to the potential inhibitory effect of the tumor microenvironment, some tumors respond poorly to monoclonal antibody drugs. The multiplex small nucleic acid delivery system of this invention can be used in combination with immune checkpoint inhibitors such as PD-1 monoclonal antibodies to achieve a synergistic anti-tumor effect. This not only improves treatment efficacy while ensuring safety but also overcomes the shortcomings of PD-1 monoclonal antibodies and other immune checkpoint inhibitors in tumors such as melanoma, bladder cancer, and prostate cancer. Immune checkpoint inhibitors can be selected from atezolizumab, pembrolizumab, tislelizumab, or camrelizumab. The immune checkpoint inhibitor and the multiplex small nucleic acid delivery system of this invention can be packaged in the same container, but more often they are packaged separately. The DP7-C vaccine of this invention, after being loaded with multiple small nucleic acids, can function as an in situ vaccine. In this invention, an in situ vaccine refers to a vaccine administered via local intratumoral injection. In situ vaccines, administered via local intratumoral injection, can scientifically combine "active" and "passive" immunization. While directly inhibiting tumor cells, they can also deeply regulate and trigger the body's immune system, forming a recurring cycle of immune initiation, immune effect, tumor cell death, antigen release leading to immune re-initiation, and immune re-effect, thus maximizing the anti-tumor immune effect.

[0050] The present invention will be described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments are further illustrations of the technical solutions of the present invention and do not indicate that the present invention is limited to these embodiments.

[0051] The main experimental materials and equipment used in this embodiment are as follows:

[0052] 1. Experimental cell lines and experimental animals

[0053] 293T, B16, and CT26 cells were purchased from the American Type Culture Collection (ATCC). Cells were cultured in DMEM (Gibco) or 1640 (Gibco) medium containing 10% fetal bovine serum (FBS, Gibco). Six- to eight-week-old female Balb / c and C57BL / 6J mice were purchased from Beijing Vital River Laboratory Animal Co., Ltd. and housed in an SPF-grade environment.

[0054] 2. Main Reagents, Materials, and Kits

[0055] The cell culture media used in the experiment: RPMI-1640 medium, DMEM medium and fetal bovine serum (FBS) were all purchased from Gibco, USA.

[0056] Both siRNA and CpG ODNs were synthesized by Shanghai Jima Biotechnology. siRNA:

[0057] Stat3: Chain of Justice (SEQ ID No. 1) 5'-UUAGCCCAUGUGAUCUGACACCCUGAA-3'

[0058] Antisense strand (SEQ ID No. 2) 5'-CAGGGUGUCAGAUCACAUGGGCUAA-3';

[0059] Ccr2: Chain of Justice (SEQ ID No. 3) 5'-GCAACAUGUUGGUCAUUAUTT-3'

[0060] Antisense strand (SEQ ID No. 4) 5'-AUAAUGACCAACAUGUUGCTT-3';

[0061] Tgfβ1: Justice Chain (SEQ ID No. 5) 5'-CGGACUACUAUGCUAAAGATT-3'

[0062] Antisense strand (SEQ ID No. 6) 5'- UCUUUAGCAUAGUAGUCCGTT-3';

[0063] CpG ODNs (SEQ ID No. 7): 5'-TCCATGACGTTCCTGACGTT-3'.

[0064] Cytokines and agonists: rmGM-CSF (122-03) was purchased from Shanghai Puxin Biotechnology Co., Ltd. Flow cytometry antibodies: Fixed Viability Stain 700 (564997, BD), CD3e-APC-Cy™7 (557596, BD), CD8a-PerCP-Cy™5.5 (551162, BD), CD335-BV421 (562850, BD), CD11b-FITC (557396, BD), F4 / 80-PE (565410, BD), Foxp3-Alexa Fluor® 647 (560401, BD).

[0065] PEI25K reagent was purchased from Sigma-Aldrich; Lipofectamine 2000 transfection reagent was purchased from Invitrogen; PD-1 antibody was purchased from BioX Cell (catalog number BP0146).

[0066] 3. Main instruments and equipment

[0067] Rotary evaporator, RV 10 rotary evaporator, EKA, Germany; Small animal in vivo imaging system, Caliper LifeSciences, IVIS Spectrum; Malvern particle size analyzer: ZetaSizer Nano-ZS Zen 3600, Malvern; Transmission electron microscope: H-600 transmission electron microscope, Hitachi; Flow cytometer: FACSCalibur, BD; Microplate reader: Multiskan Mk3, Thermo Scientific; DNA concentration analyzer: Nanodrop 2000, Thermo Scientific; Laser confocal microscope: FV1000, Olympus; Incubator: MCO-18, Thermo Scientific.

[0068] Example 1 Synthesis of antimicrobial peptide DP7-cholesterol conjugate (DP7-C)

[0069] The conjugation of antimicrobial peptide DP7 with cholesterol fragments is... Figure 1 The synthesis was performed using the synthetic route shown.

[0070] 2-chlorotrityl chloride Resin, also known as 2-chlorotriphenylmethyl chloride resin; Fmoc-RinkAmide MBHA Resin, also known as 4-(2',4'-dimethoxyphenyl-fluorenylmethoxycarbonyl-aminomethyl)-phenoxyacetamido-methyldiphenylmethylamine resin; Fmoc: fluorenylmethoxycarbonyl; pbf, tbu, Otbu, Trt, and Boc are all protecting groups, named 2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl, tert-butyl, tert-butoxy, triphenylmethyl, and tert-butoxycarbonyl, respectively.

[0071] The specific synthesis method is as follows:

[0072] 1. Swelling, activation, and deprotection of resin:

[0073] Swelling: Weigh 1.0 g of Rink MBHA (4-(2′,4′-dimethoxyphenyl-fluorenylmethoxycarbonyl-aminomethyl)-phenoxyacetamido-methyldiphenylamine) resin (substitution value 0.36 mmol / g) and place it in the reaction flask of the peptide synthesizer. Use DCM / DMF (1:1) for swelling activation. Shake the reaction flask up and down to allow the resin to swell fully for about 20 min. Remove the solvent.

[0074] Deprotection: Remove the Fmoc protecting group from the resin with 15 mL of 20% Piperdine / DMF (N,N-dimethylformamide) solution and react for 15 min. Wash the resin three times alternately with DCM / DMF (dichloromethane / N,N-dimethylformamide). Take a small amount of resin and wash it sequentially with methanol / DCM / DMF, then add it to an EP tube containing 5% ninhydrin in anhydrous ethanol solution. Boil in a water bath for three minutes. If the resin turns blue, it is a positive reaction. Then wash twice and continue to the next step of the reaction. Otherwise, continue to repeat the deprotection process.

[0075] 2. Coupling of the first amino acid (Lys)

[0076] Weigh out Fmoc-Lys(Boc)-OH (1.44 mmol, 0.93 g, 4 eq), dissolve it in DMF (approximately 5 mL), and add it to the reaction flask. Then add 5 mL of HBTu (benzotriazole-N,N,N',N'-tetramethylurea hexafluorophosphate) (1.44 mmol, 0.54 g, 4 eq) and 5 mL of DIEA (diisopropylethylamine) (2.88 mmol, 0.474 mL, 8 eq). Add 5 mL of DMF solution and then start the reaction. Shake the reaction flask up and down for 50 minutes. Then drain the reaction solution and take a small amount of resin. Wash the resin sequentially with CH3OH / DCM / DMF and add it to an EP tube containing 5% ninhydrin in anhydrous ethanol. Boil in a water bath for three minutes. If the resin turns yellow or light blue, it indicates a negative reaction, and the reaction is complete. Wash the resin in the reaction flask three times alternately with DCM / DMF, remove the solvent, and proceed with the subsequent reaction. If the resin turns dark blue or reddish-brown, the reaction is incomplete and needs to be repeated. This step is relatively easy to carry out, and the condensation is generally quite complete. The raw material used in this step is Fmoc-Rink Amide MBHA Resin, which is composed of MBHA Resin linked with Fmoc-protected and modified Rink Amide Linker. This invention uses a degree of substitution of 0.36 mmol / g, but other degrees of substitution can achieve the same or similar technical effects and are also within the scope of protection of this invention. The degree of substitution of 0.36 mmol / g used in this invention is the optimal value that balances factors such as the yield, purity, and resin utilization of the synthesized fragment.

[0077] 3. Elongation of amino acid chains

[0078] After removing Fmoc from Fmoc-Lys(Boc)-MBHA Resin obtained in step 2, N,N-dimethylformamide, Fmoc-Arg(pbf)-OH, 1-hydroxyphenyltriazole, benzotriazole-N,N,N',N'-tetramethylurea hexafluorophosphate, and N,N'-diisopropylethylamine were added, and the reaction was carried out under nitrogen protection to obtain Fmoc-Arg(pbf)-Lys(Boc)-MBHA Resin. Following this method, Fmoc-Ile-OH, Fmoc-Val-OH, Fmoc-Ala-OH, Fmoc-Val-OH, Fmoc-Arg(pbf)-OH, Fmoc-Ile-OH, Fmoc-Arg(pbf)-OH, Fmoc-Trp(Boc)-OH, Fmoc-Gln(Trt)-OH, and Fmoc-Val-OH were sequentially added.

[0079] The above synthesis yields a fully protected DP7 sequence peptide.

[0080] 4. Acetylation blocking

[0081] When the condensation reaction is not ideal, in order to avoid the influence of the missing peptide on subsequent reactions, the free amino group is generally acetylated and blocked. The prepared blocking solution (acetic anhydride:pyridine:DMF 3:3:4) is added to the reaction flask containing the resin, and the reaction flask is shaken up and down for about 20 minutes. The ninhydrin is detected. If the resin turns yellow, the reaction is complete and subsequent reactions can be carried out. If the blocking is not complete, the blocking time needs to be extended or the ratio of the blocking solution needs to be adjusted to make the reaction as complete as possible.

[0082] 5. Hydrophobic modification of DP7

[0083] 1) Hydrophobic modification of DP7 with succinylated cholesterol

[0084] Weigh 0.67 g (1.44 mmol, 4.0 eq) of succinylated cholesterol, dissolve it in DCM (approximately 10 mL), and add it to the reaction flask. Then add 5 mL each of HBTu (1.44 mmol, 0.54 g, 4 eq), DIEA (2.88 mmol, 0.474 mL, 8 eq), and DMF solution. Shake the reaction flask up and down for 50 min, then drain the reaction solution. Take a small amount of resin and wash it sequentially with CH3OH / DCM / DMF, then add it to an EP tube containing 5% ninhydrin in anhydrous ethanol solution. Boil in a water bath for three minutes. If the resin turns yellow or light blue, it indicates a negative reaction, and the reaction is complete. Wash the resin in the reaction flask three times alternately with DCM / DMF, then remove the solvent. The resin obtained above was added to a reaction flask containing lysis buffer. The flask was sealed and placed on a shaker for reaction. After approximately 2 hours, the resin was removed by filtration. The resin was washed several times with DCM, and the filtrate was collected. TFA and solvent were removed by rotary evaporation. Anhydrous diethyl ether at ice was added to the remaining liquid, resulting in a large amount of white flocculent precipitate. The white precipitate obtained by high-speed centrifugation (4000 r / min) was the crude product. Further purification of the crude product by preparative high-performance liquid chromatography yielded the target product, cholesterol-modified DP7 (DP7-C), whose mass spectrum is shown below. Figure 2 The determined molecular weight was consistent with expectations.

[0085] Since solid-phase peptide synthesis technology is relatively mature, the conjugate of antimicrobial peptide DP7 and cholesterol can also be synthesized by synthetic companies. For example, DP7-C (Chol-suc-VQWRIRVAVIRK-NH2) modified with succinylated cholesterol was synthesized by Shanghai Ketai Biotechnology Co., Ltd. using solid-phase synthesis. The synthesized DP7-C was purified by HPLC with a purity >95%, and the molecular weight of DP7-C was determined by MS. The synthesized peptide was stored at -20℃ and prepared as a 5 mg / ml stock solution with MillQ water before use. The DP7-C (Chol-suc-VQWRIRVAVIRK-NH2) synthesized by solid-phase synthesis is based on DP7, with the N-terminus coupled to hydrophobic cholesterol via an ester bond, and its C-terminus protected by a -NH2 molecule. The mass spectrum of DP7-C is shown below. Figure 2 The molecular weight is 1991.3408, and the main peak on the MS chromatogram is 996.1748, indicating that the correct DP7-C was synthesized.

[0086] Example 2: Preparation and characterization of DP7-C loaded with multiple siRNAs and CpG ODNs

[0087] 1. Methods and optimal ratios for combining DP7-C / siRNA and DP7-C / CpG ODNs

[0088] Dilute DP7-C in aqueous solution to the desired concentration. Add siRNA / CpG ODNs at a mass ratio of DP7-C:siRNA or CpG ODNs of 1:1 to 8:1, mix gently, and incubate at room temperature for 10 min to obtain DP7-C / siRNA and DP7-C / CpG ODNs nanoparticles. Gel retardation electrophoresis was used to detect the binding of DP7-C to siRNA / CpG ODNs at different mass ratios.

[0089] Experimental results showed that the particle size of DP7-C loaded with multiple siRNAs and CpG ODNs was 102.35 ± 0.62 nm. Figure 3 a) Transmission electron microscopy revealed that the particle size of the nanoparticle-small nucleic acid complex was approximately 100 nm. Figure 3 b). Gel retardation electrophoresis results showed that at a mass ratio of 5:1, there were no free siRNA / CpG ODNs bands; all siRNA / CpG ODNs bands were bound to DP7-C. This indicates that the optimal ratio of DP7-C modification to siRNA / CpG ODNs for incubation is 5:1. Figure 3 c). In subsequent experiments, a formulation of 15 μg siRNA (5 μg each of the three siRNAs), 5 μg CpG ODNs, and 100 μg DP7-C was used. The three siRNAs and CpG ODNs were co-incubated with DP7-C to prepare DP7-C / siRNA composite nanoparticles.

[0090] 2. DP7-C prevents siRNA degradation

[0091] After treating DP7-C / siRNA composite nanoparticles with RNase A for 0, 0.5, 1, 2, and 4 hours, the DP7-C / siRNA composite nanoparticle group did not show a decrease in siRNA release. Figure 3 d). As a control group, naked siRNA was completely degraded after 0.5 h of RNase A treatment under the same conditions. Figure 3 d). This indicates that DP7-C plays a good protective role for siRNA.

[0092] Example 3: Research on DP7-C as a siRNA delivery vector

[0093] 1. Efficiency of DP7-C transfection of siRNA into cells

[0094] In this part of the experiment, cy3-siRNA (si-Scramble) was targeted, and siRNA was transfected into 293T cells to investigate the DP7-C transfection efficiency of siRNA. Specifically, 2 μg of cy3-siRNA and 10 μg of liposomes were co-incubated in DMEM medium, and then added to cells coated with 2×10⁶ saturates. 5 In 293T cells, after 4 h, the DMEM medium was replaced with DMEM + 10% FBS + 1% PS medium, and transfection continued for 24 h. Red fluorescence expression was observed and photographed using a fluorescence microscope. Cells were digested with trypsin, centrifuged at 12000 rpm for 3 min, resuspended in 100 μl PBS, and the proportion of Cy3-positive cells was detected by flow cytometry to determine transfection efficiency.

[0095] Experimental results showed that DP7-C had an efficiency of 89.79 ± 2.08% in transfecting siRNA into 293T cells, while the efficiency of naked siRNA entering 293T cells was 21.87 ± 1.63%, indicating that DP7-C has a higher delivery efficiency for siRNA. Figure 4 (a-4b).

[0096] 2. Knockdown efficiency of DP7-C transfection target siRNA

[0097] In this part of the experiment, target siRNAs (including si-Stat3, si-Ccr2, and si-Tgfβ) were transfected into B16 cells to investigate the knockdown efficiency of DP7-C transfection of target siRNAs. Specifically, a mixture of 2 μg si-Stat3 (sense strand see SEQ ID No. 1, antisense strand see SEQ ID No. 2), si-Ccr2 (sense strand see SEQ ID No. 3, antisense strand see SEQ ID No. 4), and si-Tgfβ (sense strand see SEQ ID No. 5, antisense strand see SEQ ID No. 6) and 10 μg DP7-C was co-incubated in DMEM medium. This mixture was then added to cells coated with 2×10⁶ cells of DMEM medium. 5 In B16 cells, after 4 h, the DMEM medium was replaced with DMEM + 10% FBS + 1% PS medium, and transfection continued for 24 h. After 24 h, RNA was extracted from B16 cells, reverse transcribed into cDNA, and the mRNA expression levels of Stat3, Ccr2, and Tgfβ were detected by qPCR. The three individual siRNA groups were prepared by mixing 2 μg of siRNA with 10 μg of DP7-C for the respective experiments.

[0098] Experimental results showed that DP7-C / siRNAs significantly reduced target gene expression levels compared to the control group, the material group (DP7-C), and the nonsense small nucleic acid group (DP7-C / si-Scramble); however, there was no significant difference compared to the DP7-C / single siRNA group. Therefore, we confirmed an effective combination of siRNAs (DP7-C / Stat3 siRNA + Ccr2 siRNA + Tgf-β siRNA), demonstrating that DP7-C can serve as an effective delivery vector for complex small nucleic acids (*p<0.05, **p<0.05, ***p<0.001). Figure 5 ).

[0099] Example 4: Study on the cytotoxicity of DP7-C

[0100] 1. Cytotoxicity detection of DP7-C

[0101] Cells were treated with different concentrations of DP7-C, PEI25K, or Lipo2000 for 24 h to compare the cytotoxicity of different concentrations. Specifically, 293T cells were seeded into 96-well plates, with 1 × 10⁶ cells per well. 4 Cells were cultured for 24 h, and then treated with different concentrations of DP7-C, PEI25K or Lipo2000 for 24 h. Then, 10 μL of CCK8 reagent was added to each well, and the cells were cultured at 37 °C for 4 h. The culture medium was then aspirated, and the absorbance at 570 nm was read using a Spectramax M5 microplate spectrophotometer (Molecular Devices, Sunnyvale, CA, USA).

[0102] The results showed that cell viability decreased significantly with increasing PEI25K and Lipo2000 concentrations, and cell survival rate decreased with PEI25K treatment at 100 μg / ml, indicating that these two transfection reagents had high cytotoxicity. In contrast, DP7-C cell proliferation decreased slowly with increasing concentration, indicating that DP7-C had lower cytotoxicity than Lipo2000 and PEI25K. Furthermore, no significant change in cell viability was observed in the DP7-C group with increasing DP7-C concentration, indicating low cytotoxicity. Figure 6 ).

[0103] Example 5: In vitro functional study of DP7-C delivered complex siRNA on cells

[0104] 1. Validation of the stimulation of DC cells by DP7-C transfection with complex siRNAs

[0105] BMDCs cultured to day 8 were treated for 24 hours with PBS, DP7-C / si-Scramble, DP7-C / si-Stat3, DP7-C / si-Ccr2, DP7-C / si-Tgfβ, DP7-C / CpG ODNs (SEQ ID No. 7), and DP7-C / siRNAs / CpG ODNs, respectively. After 24 hours, cells were collected for CD11c, CD80, and CD86 staining to assess BMDC maturation.

[0106] Flow cytometry results showed that the proportion of mature DCs in the untreated group was 20.47% ± 1.23, while the proportion of mature DCs in the DP7-C / si-Scramble group was 30.92% ± 0.82. DP7-C transfection with compound siRNAs (51.71% ± 1.76) was significantly more effective than DP7-C transfection with siRNA alone in inducing DC maturation (*p<0.05, **p<0.05, ***p<0.001). Figure 7 a).

[0107] 2. DP7-C transfection with complex siRNAs induces apoptosis in tumor cells.

[0108] CT26 cells were treated with PBS, DP7-C / si-Scramble, DP7-C / si-Stat3, DP7-C / si-Ccr2, DP7-C / si-Tgfβ, DP7-C / CpG ODNs, and DP7-C / siRNAs / CpG ODNs for 48 h, respectively. After 48 h, cells were collected for PI and Annexin-V staining to detect tumor cell apoptosis.

[0109] Flow cytometry results showed that the proportion of apoptotic cells in the untreated group was 5.47% ± 0.27, while the proportion of apoptotic cells in the DP7-C / si-Scramble group was 6.06% ± 0.16. DP7-C transfection with composite siRNAs (28.93% ± 0.15) was significantly more effective than DP7-C transfection with individual siRNAs in inducing tumor cell apoptosis (*p<0.05, **p<0.05, ***p<0.001). Figure 7 b).

[0110] 3. DP7-C transfection with complex siRNAs inhibits tumor cell proliferation.

[0111] CT26 cells were treated with PBS, DP7-C / si-Scramble, DP7-C / si-Stat3, DP7-C / si-Ccr2, DP7-C / si-Tgfβ, DP7-C / CpG ODNs, and DP7-C / siRNAs / CpG ODNs for 24 h, respectively. After 24 h, 10 μL of CCK8 was added to each well, and the cells were incubated at 37 °C for 4 h. The culture medium was then discarded, and the absorbance at 570 nm was read using a Spectramax M5 microplate spectrophotometer (molecular device, Sunnyvale, CA, USA).

[0112] The experimental results show that DP7-C transfection with compound siRNAs is more effective than DP7-C transfection with siRNA alone in inhibiting tumor cell proliferation (*p<0.05, **p<0.05, ***p<0.001). Figure 7 c, where the DP7-C / siRNAs group is DP7-C / siRNAs / CpG ODNs)

[0113] 4. DP7-C transfection with complex siRNAs inhibits tumor cell migration.

[0114] CT26 cells were treated for 24 h with PBS, DP7-C / si-Scramble, DP7-C / si-Stat3, DP7-C / si-Ccr2, DP7-C / si-Tgfβ, DP7-C / CpG ODNs, and DP7-C / siRNAs / CpG ODNs, respectively. After 24 h, the cells were starved for 12 h with serum-free medium. Cells were digested, centrifuged after digestion, and the culture medium was discarded. The cells were washed 1-2 times with PBS and resuspended in serum-free medium. 200 μL of the cell suspension was added to a Transwell chamber, and 600 μL of medium containing 15% FBS was added to the lower chamber. The cells were cultured for 24 h. The Transwell chambers were removed, the culture medium in the wells was discarded, and the cells were washed twice with calcium-free PBS. Unmigrated cells were gently wiped away with a cotton swab. The cells were fixed with formaldehyde for 30 min and then air-dried. The cells were stained with 0.1% crystal violet for 30-60 min and washed 3 times with PBS. Gently wipe away the moisture in the upper chamber with a cotton swab. Observe the cells in five random fields of view under a 40x microscope and count them.

[0115] The experimental results showed that the cell migration rate in the untreated group was 19.78% ± 1.86, while the cell migration rate in the DP7-C / si-Scramble group was 8.24% ± 1.55. Both DP7-C alone and DP7-C transfected with multiple siRNAs showed significant effects in inhibiting tumor cell migration. Furthermore, compared to DP7-C transfected with siRNA alone, DP7-C transfected with multiple siRNAs (3.49% ± 0.23%) showed greater advantages. Figure 7 d, where the DP7-C / siRNAs group is DP7-C / siRNAs / CpGODNs). (*p<0.05, **p<0.05, ***p<0.001)

[0116] Example 6: Validation of the anti-CT26 subcutaneous tumor efficacy of the DP7-C-loaded multiple siRNAs and CpG ODNs complex in situ vaccine.

[0117] 1. Antitumor effect of the present invention in the CT26 subcutaneous tumor model

[0118] 1×10 6 CT26 cells were resuspended in 100 μl of 1640 medium and injected subcutaneously into the right back of mice. On days 7, 10, 13, 16, 19, and 22, subcutaneous tumors were injected with PBS, DP7-C / si-Scramble, DP7-C / si-Stat3, DP7-C / si-Ccr2, DP7-C / si-Tgfβ, DP7-C / CpG ODNs, and DP7-C / siRNAs / CpG ODNs in situ vaccines (single dose: 15 μg siRNA, 5 μg CpG ODNs, and 100 μg DP7-C). Tumor volume changes were recorded every 2 days. Mice were sacrificed on day 16 post-inoculation.

[0119] Experimental results showed that, in terms of average tumor volume, DP7-C / siRNAs / CpG ODNs were the most effective at inhibiting tumor volume and reducing tumor weight compared to other treatment groups (*p<0.05, **p<0.05, ***p<0.001). Figure 8 AB).

[0120] 2. Flow cytometry detection of intratumoral immune cell activation in the CT26 model

[0121] To further elucidate the immunogenicity of the DP7-C-loaded siRNAs and CpG ODNs complex in situ vaccine, flow cytometry was used to detect the activation of intratumoral immune cells after treatment of CT26 subcutaneous tumors with the DP7-C-loaded siRNAs and CpG ODNs complex in situ vaccine.

[0122] Mice were sacrificed on day 22 post-inoculation, and tumor tissue was collected and isolated using collagenase. Cells were collected for flow cytometry staining for FVS, CD45, CD3, CD4, CD8, FOXP3, and CD335. The proportion of immune cells was determined by flow cytometry.

[0123] The results showed that DP7-C / siRNAs / CpG ODNs were more effective than other treatment groups in activating effector T cells and NK cells, and inhibiting Treg cells (*p<0.05, **p<0.05, ***p<0.001). Figure 8 C).

[0124] 3. Antitumor effect of the present invention in a B16 subcutaneous tumor model

[0125] 5×10 5 After resuspending B16 cells in 100 μL DMEM medium, they were injected subcutaneously into the right back of mice. On days 7, 10, 13, and 16, PBS, DP7-C / si-Scramble, DP7-C / si-Stat3, DP7-C / si-Ccr2, DP7-C / si-Tgfβ, DP7-C / CpG ODNs, DP7-C / si-Stat3+si-Ccr2, DP7-C / si-Stat3+si-CpG ODNs, DP7-C / si-Stat3+si-Tgfβ, DP7-C / si-Ccr2+si-CpG ODNs, DP7-C / si-Ccr2+si-Tgfβ, DP7-C / si-Tgfβ+si-CpG ODNs, and DP7-C / siRNAs / CpG ODNs in situ vaccines were injected into the subcutaneous tumors, respectively. (A single dose consisted of 15 μg of siRNA, 5 μg of CpG ODNs, and 100 μg of DP7-C.) Tumor volume changes in mice were recorded every two days. Mice were sacrificed on day 16 post-inoculation.

[0126] Experimental results showed that, in terms of average tumor volume, DP7-C / siRNAs / CpG ODNs were the most effective at inhibiting tumor volume and reducing tumor weight compared to other treatment groups (*p<0.05, **p<0.05, ***p<0.001). Figure 9 AB).

[0127] 4. Flow cytometry detection of activation of intratumoral immune cells in B16 tumors

[0128] To further elucidate the immunogenicity of the DP7-C-loaded siRNAs and CpG ODNs complex in situ vaccine, flow cytometry was used to detect the activation of intratumoral immune cells after treatment of B16 subcutaneous tumor mice with the DP7-C-loaded siRNAs and CpG ODNs complex in situ vaccine.

[0129] Mice were sacrificed on day 16 post-inoculation, and tumor tissue was collected and isolated using collagenase. Cells were collected for flow cytometry staining for FVS, CD45, CD3, CD4, CD8, FOXP3, and CD335. The proportion of immune cells was determined by flow cytometry.

[0130] The results showed that DP7-C / siRNAs / CpG ODNs were more effective than other treatment groups in activating effector T cells and NK cells, and inhibiting Treg cells (*p<0.05, **p<0.05, ***p<0.001). Figure 9 C).

[0131] Example 7: Validation of the antitumor effect of the in situ vaccine containing DP7-C-loaded siRNAs and CpG ODNs complex combined with PD-1 monoclonal antibody.

[0132] PD-1 monoclonal antibodies are widely used immune checkpoint inhibitors in current immunotherapy, but due to the potential inhibitory nature of the tumor microenvironment, some tumors respond poorly to PD-1 monoclonal antibodies. The previous results demonstrated that the composite in situ vaccine of this invention can relieve the inhibitory tumor microenvironment; therefore, we considered whether combining the in situ vaccine of this invention with PD-1 monoclonal antibodies could enhance the tumor's response to PD-1 monoclonal antibodies.

[0133] Subcutaneous injection 1×10 6 One CT26 (colon cancer) or 5×10 5 One B16 melanoma cell, when the tumor volume reaches approximately 100 mm. 3 At that time, participants were randomly assigned to groups. They were injected with PBS, isotype antibody IgG2a, αPD-1, DP7-C / siRNAs / CpG ODNs, DP7-C / siRNAs / CpG ODNs + isotype antibody IgG2a, or DP7-C / siRNAs / CpG ODNs + αPD-1, respectively. DP7-C / siRNAs / CpG ODNs were injected intratumorally, and αPD-1 or isotype antibody IgG2a was injected intraperitoneally. The intratumoral injection of the orthotopic vaccine consisted of 15 μg siRNA, 5 μg CpG ODNs, and 100 μg DP7-C, administered every three days for a total of five doses. Intraperitoneal injection of isotype antibody or αPD-1 consisted of 200 μg, administered twice a week for a total of four doses.

[0134] Experimental results showed that in the CT26 tumor model (Figure 10a-b), compared with the PBS and IgG2a control groups, αPD-1, DP7-C / siRNAs / CpG ODNs (Nanovaccine), and DP7-C / siRNAs / CpG ODNs+αPD-1 all inhibited tumor growth and reduced tumor weight; in the B16 tumor model ( Figure 10 Compared with the PBS and IgG2a control groups, αPD-1 treatment showed weak antitumor activity, but there was no significant difference between the two groups. DP7-C / siRNAs / CpG ODNs and DP7-C / siRNAs / CpG ODNs+αPD-1 could inhibit tumor growth and reduce tumor weight (*p<0.05, **p<0.05, ***p<0.001).

[0135] The above experiments demonstrate that the DP7-C-loaded siRNAs targeting Stat3, Ccr2, and Tgfβ, as described in this invention, achieve good anti-tumor effects, which is related to the roles of these three targets in tumor development and progression. Those skilled in the art will recognize that, in addition to the three specific siRNAs used in the embodiments of this invention, other siRNAs that can knock down Stat3, Ccr2, and Tgfβ expression can also achieve similar or comparable synergistic effects when used in combination. Furthermore, when used with ODNs, ODNs can act as immune adjuvants, enhancing the immune response. Moreover, when used in combination with immune checkpoint inhibitors such as PD-1 antibodies, it can improve the tumor microenvironment, thereby reducing the adverse effects of the tumor microenvironment on immune checkpoint inhibitors and achieving a synergistic anti-tumor effect. This approach not only improves therapeutic efficacy while ensuring safety but also overcomes the shortcomings of PD-1 monoclonal antibodies and other immune checkpoint inhibitors in some tumors.

Claims

1. A multiple small nucleic acid delivery system is prepared by loading a hydrophobically modified polypeptide with multiple small nucleic acid molecules; the multiple small nucleic acids are siRNAs targeting Stat3, Ccr2 and Tgf β1 respectively; the multiple small nucleic acid delivery system also contains CpG oligonucleotides with the sequence: TCCATGACGTTCCTGACGTT; The structure of the hydrophobically modified polypeptide is as follows: , The R mentioned is; ; The siRNA sequence targeting Stat3 is as follows: Chain of Justice: 5'-TTAGCCCATGTGATCTGACACCCTGAA-3' Antonym: 5'-CAGGGTGTCAGATCACATGGGCTAA-3'; The sequence of the siRNA targeting Ccr2 is as follows: Chain of Justice: 5'- GCAACATGTTGGTCATTATTT-3' Antonym chain: 5'-ATAATGACCAACATGTTGCTT-3'; The sequence of the siRNA targeting Tgfβ1 is as follows: Chain of Justice: 5'- CGGACTACTATGCTAAAGATT-3' Antisense chain: 5'- TCTTTAGCATAGTAGTCCGTT-3'.

2. The multiplex small nucleic acid delivery system according to claim 1, characterized in that... Hydrophobically modified peptides and small nucleic acids were prepared using a mass ratio of 4 to 10:1 as raw materials.

3. The multiplex small nucleic acid delivery system according to claim 2, characterized in that... The mass ratio of the hydrophobically modified peptide to the small nucleic acid is 5:

1.

4. The multiplex small nucleic acid delivery system according to claim 2, characterized in that... The proportions of the various small nucleic acids are prepared in equal quantities.

5. The multiplex small nucleic acid delivery system according to any one of claims 1 to 4, characterized in that: It is prepared by mixing the contained CpG oligonucleotides and siRNA, and then incubating them together with hydrophobically modified peptides.

6. The multiplex small nucleic acid delivery system according to claim 5, characterized in that: The incubation is carried out in water or liquid culture medium for 5 to 15 minutes.

7. The multiplex small nucleic acid delivery system according to claim 6, characterized in that: The liquid culture medium is at least one of RPMI 1640, DMEM dual-free culture medium.

8. The use of the multiplex small nucleic acid delivery system according to any one of claims 1 to 7 in the preparation of multiple target vaccines.

9. The application according to claim 8, characterized in that... The vaccine is a tumor vaccine; the tumor is at least one of melanoma or colon cancer.

10. The application according to claim 9, characterized in that... The vaccine in question is an in situ tumor vaccine.

11. A multitarget vaccine made with the multi-small nucleic acid delivery system as the main active ingredient according to any one of claims 1 to 7.

12. The multi-target vaccine according to claim 11, characterized in that: It also contains immune checkpoint inhibitors.

13. The multi-target vaccine according to claim 12, characterized in that: The immune checkpoint inhibitors mentioned are PD-1 monoclonal antibodies, PD-L1 monoclonal antibodies, or CTLA-4 monoclonal antibodies.

14. The multi-target vaccine according to claim 12, characterized in that: The immune checkpoint inhibitor is at least one of atezolizumab, pembrolizumab, tislelizumab, or camrelizumab.

15. The multitarget vaccine according to any one of claims 11 to 14, characterized in that: It also contains pharmaceutically acceptable auxiliary ingredients.