Application of OsCAX1a gene in the breeding of cold-adapted rice varieties

Abstract

This invention discloses the application of the OsCAX1a gene in the breeding of cold-adapted rice varieties, belonging to the field of plant genetic engineering. The amino acid sequences of the two different spliceosome translation proteins encoded by the OsCAX1a gene are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the CDS sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. This invention reveals that OsCAX1a is a negative regulator of rice cold stress adaptation. Knocking out the OsCAX1a gene inhibits rice growth and development in the early stages, but as the heading stage lengthens and the plant enters the low-temperature growth period, the mutant exhibits significantly better cold adaptation, ultimately manifested in an increased number of tillers and increased grain yield per plant. By selecting varieties with low expression levels of this gene or by mutating the gene through gene editing, superior cold-adapted rice varieties tolerant to low-temperature stress can be cultivated, showing promising application prospects.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically involving Cation / H + Application of the reverse transport protein gene OsCAX1a in the breeding of cold-adapted rice varieties. Background Technology

[0002] Ca 2+ The CaCA superfamily is an ancient and widespread family of ion-coupled cation transporters, present in almost all areas of life, and generates H+ via major transporters. + Or Na + Gradient transport Ca 2+ Ca2+ or other cations, and play an important role in cation transport and homeostasis (Shigaki T and Hirschi K D. Diverse functions and molecular properties emerging for CAX Cation / H+ exchangers in plants[J]. Plant Biology, 2006, 8(4): 419-429; Pittman JK and Hirschi KD, Phylogenetic analysis and protein structure modelling identifies distinct Ca2+ / Cation antiporters and conservation of gene family structure within Arabidopsis and rice species[J]. Rice, 2016, 9(1): 3).

[0003] Cation / H +The reverse transporter (CAX) family is one of the five families of the CaCA superfamily. In plants, CAXs are members of a multigene family and are mainly found in vacuoles. The plant CAX family is divided into two major categories, IA and IB, based on amino acid sequence. In Arabidopsis thaliana, CAX1, CAX3, and CAX4 are classified as type IA, while CAX2, CAX5, and CAX6 are classified as type IB. In the rice genome, five CAXs have been identified: OsCAX1a, OsCAX1b, OsCAX1c, OsCAX2, and OsCAX3 (Shigaki T and Hirschi K D. Diverse functions and molecular properties emerging for CAXCation / H+exchangers in plants[J]. Plant Biology, 2006, 8(4): 419-429; Yamada N, Theerawitaya C, Cha-um S, et al. Expression and functional analysis of putative vacuolar Ca2+-transporters (CAXs and ACAs) in roots of salt tolerant and sensitive rice cultivars[J]. Protoplasma, 2014, 251(5): 1067-1075).

[0004] CAXs play an important role in cellular and physiological functions. In plants, CAXs utilize H+ + -ATPase and H + -H formed by pyrophosphatase + Gradient, mediating Ca 2+Metal ions are transferred from the cytoplasm to the vacuoles; during salt stress, CAXs can regulate pH levels, therefore CAXs are often found in halophytes to exert their salt tolerance characteristics (Pittman JK and Hirschi KD. CAX-ing a wide net: Cation / H+ transporters in metal remediation and abiotic stress signalling[J]. Plant Biology, 2016, 18(5):741-749; Kamiya T and Maeshima M. Residues in internal repeats of the rice Cation / H+ exchanger are involved in the transport and selection of cations[J]. The Journal of Biological Chemistry, 2004, 279(1):812-819). For example: AtCAX5 and HvCAX2 in high Mn 2+ Ca 2+ and Na + Under stress, gene expression levels are significantly increased (Edmond C, Shigaki T, Ewert S, et al. Comparative analysis of CAX2-like cation transporters indicates functional and regulatory diversity[J]. Biochemical Journal, 2009, 418(1): 145-154). Summary of the Invention

[0005] The purpose of this invention is to provide a Cation / H + Application of the reverse transport protein gene OsCAX1a in the breeding of cold-adapted rice varieties.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] This invention uses the Cation / H of rice +Using the OsCAX1a gene, a member of the CAX antitransporter family, as the target gene, we constructed two overexpression modes (OE1 and OE2) and knockout (CRISPR / Cas9) transformation vectors for OsCAX1a using genetic engineering. The overexpression and knockout vectors were introduced into the normal japonica rice variety Zhonghua 11 using Agrobacterium EHA105-mediated genetic transformation, resulting in T0 generation overexpressing plants and T0 generation knockout plants of the OsCAX1a gene. The transgenic materials were cultured to the T2 generation to obtain stable genetic material (identification results are shown in [link to documentation]). Figure 1 Under normal nutrient solution (Hoagland's standard hydroponic nutrient solution), the root length, root number, and plant height of the knockout plants were significantly lower than those of the control wild-type Zhonghua 11. Figure 2 Meanwhile, under normal nutrient solution culture, the root length, root number, and plant height of the overexpression families with two different splicing methods were slightly weaker than those of the control wild-type Zhonghua 11. Figure 2 This indicates that the mutation of this gene significantly affects the growth and development of rice, and the two splicing forms that overexpress this gene also affect the growth and development of rice to varying degrees.

[0008] Field cultivation trials revealed that the OsCAX1a mutant exhibited delayed growth and development, and a prolonged heading period (during the entire vegetative growth period, daytime temperatures ranged from 26-38°C, and nighttime temperatures from 20-30°C). After reaching full heading, it underwent low-temperature stress (during the reproductive growth period, daytime temperatures ranged from 26-28°C, and nighttime temperatures from 16-20°C) and showed superior growth compared to the wild-type and overexpression families. Furthermore, it demonstrated higher tiller numbers and higher final grain yield per plant compared to the wild-type and overexpression families. Figure 3 ).

[0009] These results indicate that both mutation and overexpression of the OsCAX1a gene significantly inhibited rice growth and development. Mutations in this gene resulted in higher tiller numbers and higher grain yield per plant under low-temperature stress compared to wild-type and overexpression families. Based on this, the present invention provides the application of the OsCAX1a gene in the breeding of cold-adapted rice varieties. This application is achieved by reducing the expression of the rice OsCAX1a gene or by causing the rice OsCAX1a gene to lose its function. Loss of function of the rice OsCAX1a gene can be achieved by mutation or deletion of the OsCAX1a gene. Specifically, the loss of function of the rice OsCAX1a gene may include the following steps: constructing an OsCAX1a gene knockout vector, introducing the vector into rice to obtain transgenic rice, obtaining an OsCAX1a gene knockout T0 generation family, and obtaining genetically stable OsCAX1a gene knockout plants through breeding.

[0010] The different spliceosome translation proteins OsCAX1a-1 and OsCAX1a-2 encoded by the OsCAX1a gene have amino acid sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and their corresponding CDS sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0011] This invention reveals that OsCAX1a is a negative regulator of rice's cold stress adaptation. While knocking out the OsCAX1a gene suppresses growth in the early stages of rice development, as the heading stage elongates and the plant enters the low-temperature growth period, the mutant exhibits significantly better cold adaptation, ultimately manifested in an increased number of tillers and higher grain yield per plant. Applying this gene to transgenic varieties, by selecting for varieties with low gene expression or by mutating the gene through gene editing, can cultivate superior cold-adapted rice varieties tolerant to low-temperature stress, showing promising application prospects. Attached Figure Description

[0012] Figure 1 These are the positive identification results for OsCAX1a gene-edited mutants and transgenic families overexpressing two splicing forms. A: Sequencing results of the mutant editing site; C1, C2, C3, and C4 are sequencing results of the mutant knockout site; B and C: Identification results of expression levels in overexpression families; ZH11: wild type; OE1-1, OE1-2, and OE1-3 are families overexpressing OsCAX1a with the first splicing form; OE2-1, OE2-2, and OE2-3 are families overexpressing OsCAX1a with the second splicing form.

[0013] Figure 2 These are growth phenotypic data for wild-type, mutant, and overexpression transgenic families under normal hydroponic conditions. A: Phenotype after 14 days of hydroponics; B: Plant height; C: Root length; D: Fresh weight; E: Number of roots.

[0014] Figure 3 The field growth phenotypes (bar value 15cm) of wild-type, mutant, and overexpression transgenic families are shown. Detailed Implementation

[0015] The present invention will be further described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

[0016] Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods and can be performed according to the described resetting techniques (see Molecular Cloning, Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used are all commercially available.

[0017] Example 1: Construction of transgenic plants overexpressing the OsCAX1a gene

[0018] Total RNA was extracted from rice Zhonghua 11, and cDNA was obtained by reverse transcription. Two coding sequences of the OsCAX1a gene were amplified by PCR using primers CAX1a-OE1S and CAX1a-OE1A, and CAX1a-OE2S and CAX1a-OE2A. The sequences were then ligated into the pU1301 vector (modified from Cambia's Pcambia-1301, with the 35S promoter replaced by the maize ubiquitin promoter) using homologous recombination. Expression vectors pUbiquitin-OsCAX1a-OE1-1301 and pUbiquitin-OsCAX1a-OE2-1301 were constructed and introduced into the normal rice variety Zhonghua 11. OsCAX1a gene overexpression families were identified at generation T0 by qRT-PCR. The qRT-PCR primers were LK1-OE1-qRTF and LK1-OE1-qRTR, and LK1-OE2-qRTF and LK1-OE2-qRTR. The results are shown in […]. Figure 1 B and Figure 1 C. After T0 and T1 generation selection, a stable T2 family with OsCAX1a gene overexpression was obtained.

[0019] Phenotypic comparison of stable families with OsCAX1a gene overexpression transgenic T2 generation in normal hydroponic nutrient solution is shown in [link to relevant documentation]. Figure 2 Its growth is slightly weaker than that of the wild-type Zhonghua 11.

[0020] The primer sequences mentioned above are as follows:

[0021] CAX1a-OE1S:ATCCATCTGCCTATCTATCTCT,

[0022] CAX1a-OE1A: TGTTAGGACTTAGGAGAGCATA;

[0023] CAX1a-OE2S: ATGATGGTGTATGCATGGG,

[0024] CAX1a-OE2A: AGCATTCCAAGAGTCCGA;

[0025] LK1-OE1-qRTF:GGTGTGGGTGTTCGCTCTTA,

[0026] LK1-OE1-qRTR:CCTCGATCTCTCCCTTGAGC;

[0027] LK1-OE2-qRTF:AAGATCGAGGTGGTCAAGTGC,

[0028] LK1-OE2-qRTR:ACTGGTTGCGGTCGTAGGG.

[0029] Example 2: Construction of OsCAX1a gene knockout transgenic plants

[0030] An OsCAX1a gene knockout vector was constructed using CRISPR / Cas9 technology. The OsCAX1a gene knockout target is [see details]. Figure 1 A, where the sequences of target site 1 (Target1) and target site 2 (Target2) are as follows:

[0031] Target1:CGAGCCCACCTCGCAGTCATGGG,

[0032] Target2: TCGGACTGGTTGCGGTCGTAGGG.

[0033] Using the two target sequences mentioned above, the gene knockout vector OsCAX1a-C was constructed (method referenced from Ma XA Robust CRISPR / Cas9 System for Convenient, High-Efficiency MultiplexGenome Editing in Monocot and Dicot Plants[J].Molecular Plant,2015,8(8):1274-1284). The gene knockout expression vector was introduced into the normal japonica rice variety Zhonghua 11 using Agrobacterium EHA105-mediated genetic transformation to construct an OsCAX1a gene knockout family. The OsCAX1a gene knockout family mutant plants were sequenced at generation T0 to determine if the gene had been knocked out. The detection primer pairs were: LK1FS: AGGTGGTCAAGTGCTCCC, LK1FA: TGATTTGGCAATCCGTTC. Sequencing of the amplified products revealed that C2 was a single-base insertion frameshift mutant. The results are shown in […]. Figure 1 A.

[0034] Positive plants were individually harvested and planted, and propagated to the T2 generation to obtain mutant plants of the OsCAX1a gene. Under normal hydroponic treatment, the growth and development of the OsCAX1a gene mutant plants were significantly weaker than that of the control plant, Zhonghua 11. Figure 2 (AD). Under normal field planting conditions, with daytime temperatures of 26-38°C and nighttime temperatures of 20-30°C, the OsCAX1a mutant exhibited delayed growth and a prolonged heading period. When wild-type, mutant, and overexpression materials all reached the heading stage, low-temperature stress (26-28°C during the reproductive growth period and 16-20°C at night) was introduced. The mutant showed significantly superior growth compared to the wild-type and overexpression families, exhibiting higher tiller numbers and higher final grain yield per plant. Figure 3 ).

[0035] The above results indicate that OsCAX1a is a negative regulator of cold stress adaptation in rice. Normal or overexpressed OsCAX1a gene expression leads to sensitivity to low-temperature stress. While knockout of OsCAX1a gene is suppressed in the early stages of rice growth and development, as the heading stage progresses and the plant enters the low-temperature growth period, the mutant exhibits significantly better cold adaptation, ultimately manifested in increased tiller number and increased grain yield per plant. Applying this gene to transgenic varieties, through selecting for low expression levels or by gene editing to mutate the gene, can cultivate superior cold-adapted rice varieties tolerant to low-temperature stress, showing promising application prospects.

Claims

1. The application of the OsCAX1a gene in the breeding of cold-adapted rice varieties, characterized by: The application is achieved by reducing the expression of the rice OsCAX1a gene or causing the rice OsCAX1a gene to lose its function; the cold-adapted rice varieties exhibit high tiller number and / or high grain yield per plant under low temperature stress; the amino acid sequences of the two different spliceosome translation proteins encoded by the OsCAX1a gene are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

2. The application according to claim 1, characterized in that: Loss of function of the rice OsCAX1a gene is achieved by mutating or deleting the OsCAX1a gene.

3. The application according to claim 2, characterized in that: The steps to induce loss of function of the rice OsCAX1a gene include: constructing a knockout vector for the OsCAX1a gene, introducing the vector into rice to obtain the OsCAX1a gene knockout T0 generation family, and obtaining genetically stable OsCAX1a gene knockout plants through breeding.

4. The application according to claim 1, characterized in that: The CDS sequences encoding two different spliceosome translation proteins are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

Images