An electrochemical biosensor for detection of armillaria mellea

By using an electrochemical biosensor based on specific nucleic acid aptamer fragments and glucose oxidase, the problems of cumbersome operation and long detection time of existing detection methods have been solved, enabling rapid and sensitive detection of hyacinth yellow rot pathogen.

CN117191905BActive Publication Date: 2026-04-14INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311065694.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-23
Publication Date
2026-04-14
Estimated Expiration
2043-08-23

AI Technical Summary

Technical Problem

Existing methods for detecting hyacinth yellow rot fungus are cumbersome and time-consuming, making it difficult to achieve rapid and sensitive detection.

Method used

An electrochemical biosensor based on a specific nucleic acid aptamer fragment and glucose oxidase was designed. Electrochemical detection was performed using a biological probe and a screen-printed carbon electrode. The specific identification and detection of hyacinth yellow rot fungus were achieved by differential pulse voltammetry.

Benefits of technology

It enables rapid, sensitive, and simple detection of hyacinth yellow rot pathogens, exhibiting high selectivity and high sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117191905B_ABST
    Figure CN117191905B_ABST
Patent Text Reader

Abstract

The application discloses an electrochemical biosensor based on specific nucleic acid aptamer fragments and glucose oxidase. The specific recognition of the same target object by the double nucleic acid aptamer is utilized to combine the modified metal organic framework compound and the magnetic nanoparticles with the target object to form a self-assembly structure, and the magnetic nanoparticles are separated out by utilizing the magnetism of the magnetic nanoparticles. Meanwhile, the specific catalytic action of the glucose oxidase on glucose produces hydrogen peroxide to further oxidize 3,3'-diamino benzidine to generate an electrochemical signal, and the metal organic framework compound and the magnetic nanoparticles both have peroxidase-like activity, which can further synergistically catalyze the oxidation of 3,3'-diamino benzidine by hydrogen peroxide, and the sensitivity is improved. Thus, based on the linear relationship between different concentrations of pathogen solutions and corresponding electrochemical signal intensities, the electrochemical biosensor realizes high-sensitivity detection of the hyacinth yellow rot fungus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of electrochemical detection technology for pathogens, specifically to an electrochemical biosensor based on a specific nucleic acid aptamer fragment and glucose oxidase, which is applied to the detection of hyacinth yellow rot pathogen. Background Technology

[0002] Hyacinth yellow rot fungus (Xanthomonas hyacinthi) is one of the harmful organisms restricted from entry by various countries, and it is also one of the quarantine harmful bacteria for import into my country. This fungus is the most important disease affecting hyacinths, spreading rapidly in the field and causing severe economic losses to crops. The fungus mainly survives inside the bulb and can spread from the bulb to the leaves. It can also be spread to healthy plants through agricultural machinery blades, wind, and rain.

[0003] Hyacinth rot fungus can parasitize a variety of plants, mainly including those in the genus *Hyacinthus* (Liliaceae), *Scillasp.*, *Muscaribotryoides*, and *Puschkinis acilloides*, among others. Inoculated hosts include *S. hispanica* and *Muscariarmeniacun*. With the introduction and cultivation of numerous ornamental plants, the risk of this pathogen spreading to my country is increasing.

[0004] Traditional pretreatment methods can effectively reduce the spread of this pathogen, heat treatment can effectively kill the pathogen inside the bulb, and early spraying of pesticides is also effective in preventing bacterial occurrence. For the detection of this pathogen, the most mature method currently is polymerase chain reaction (PCR) fluorescence detection. Although this method has high accuracy, the detection time is long and the processing method is relatively cumbersome. Therefore, under the current circumstances, there is an urgent need to develop a simple, highly sensitive, and easy-to-operate detection method for hyacinth yellow rot pathogen. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, this invention provides an electrochemical biosensor based on a specific nucleic acid aptamer fragment and glucose oxidase GOx. This sensor is used for electrochemical detection by specifically recognizing the hyacinth yellow rot pathogen, and has the advantages of good selectivity, high sensitivity, simplicity, and speed.

[0006] To achieve the above objectives, the present invention relates to an electrochemical biosensor for detecting hyacinth yellow rot fungus, which has the following significant features:

[0007] This electrochemical biosensor is constructed based on a specific nucleic acid aptamer fragment and glucose oxidase GOx, and consists of three parts: a biological probe, a screen-printed carbon electrode, and a portable electrochemical workstation.

[0008] Biological probes mainly consist of metal-organic framework compound MIL-88-NH2 material, magnetic nanoparticles MNPs, and probe bodies respectively attached to the surface of MIL-88-NH2 or MNPs.

[0009] The probe consists of two specific nucleic acid aptamer fragments, Xh-Apt-14 and Xh-Apt-1, which have specific recognition functions for the target analyte. The Xh-Apt-1 sequence is 5'-CAC GCA TAA CAC CAC GCAACA GGG CTCTCATCTGTGACA CAA CGA CGGAGTTATGCG TG-3'; while the Xh-Apt-14 sequence is 5'-CAC ACG CATAACTCTAGT CAC AGG AAG ACA AAC CGG GGG GCC CAC GCTGAG TTA TGC GTG-3'. Both Xh-Apt-14 and Xh-Apt-1 nucleic acid aptamer fragments are 5'-terminal amino-treated, and their sequences are self-selected, exhibiting high affinity and enabling specific recognition of the target analyte, Hyacinth Yellow Rot Fungi.

[0010] The biological probes include probe A and probe B; Xh-Apt-14 together with MIL-88-NH2 and glucose oxidase GOx constitutes probe A, while Xh-Apt-1 together with MNPs constitutes probe B.

[0011] The main preparation steps of probe A are as follows: First, MIL-88-NH2 is mixed with glutaraldehyde and reacted, then vacuum dried to obtain aldehyde-modified MIL-88-CHO. Then, MIL-88-CHO is mixed with nucleic acid aptamer fragments Xh-Apt-14 and GOx and reacted. The reaction product is centrifuged and washed with phosphate-buffered saline to obtain the MIL-88 / GOx / Xh-Apt-14 composite material. The reaction conditions for MIL-88-NH2 and glutaraldehyde are 1–3 hours at room temperature; the reaction conditions for Xh-Apt-14 and GOx are 6–18 hours at 30–45°C. The reaction product is centrifuged at 7000–11000 rpm for 7–13 minutes, and the centrifugation operation is repeated 2–5 times.

[0012] The main preparation steps of probe B are as follows: MNPs are mixed with coupling agents 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide and reacted to obtain carboxyl-activated MNPs. The magnetically washed MNPs are then mixed with the nucleic acid aptamer fragment Xh-Apt-1 and reacted to prepare the MNPs / Xh-Apt-1 composite material. The reaction conditions of MNPs and coupling agents are 30-45℃ for 6-18 hours and 2-5 magnetic washes.

[0013] Probe A and probe B are mixed with the target analyte and reacted at 30–45°C for 2–4 hours. The resulting product is then subjected to magnetic separation to obtain a self-assembled structure product. This self-assembled structure product has the following characteristics: after the biological probe comes into contact with the target analyte, due to specific recognition and the different recognition sites of different nucleic acid aptamer fragments, a self-assembled structure product is formed with the target analyte in the middle and probes A and B on both sides. The self-assembled structure product is separated by magnetic separation. This self-assembled structure product is then mixed evenly with glucose and 3,3'-diaminobenzidine to obtain the corresponding self-assembled structure product mixture system.

[0014] The supernatant of a mixture containing a certain amount of the target analyte, *Hyacinthia spp.*, was drop-coated onto the surface of a screen-printed carbon electrode. Then, differential pulse voltammetry (DPV) was used for detection. Based on a standard curve that linearly fits the DPV peak current intensity to the logarithm of the target analyte concentration, a highly sensitive electrochemical biosensor for the detection of *Hyacinthia spp.* was developed. Attached Figure Description

[0015] Figure 1 A schematic diagram illustrating the fabrication of an electrochemical biosensor based on a specific nucleic acid aptamer fragment and glucose oxidase, and its application in the detection of hyacinth yellow rot pathogen.

[0016] Figure 2 Affinity curves of Xh-Apt-1 and Xh-Apt-14 to the hyacinth yellow rot pathogen.

[0017] Figure 3 (a) Bioprobe A, (b) Bioprobe B, (c) Hyacinth yellow rot fungus and (d) its self-assembled structure (scanning electron microscope images). Detailed Implementation

[0018] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0019] The instruments and reagents used in the experiment were as follows: the instrument was a CS100E portable electrochemical analyzer (Wuhan Kosite Instrument Co., Ltd.); the reagent was hyacinth yellow rot fungus aptamer (Shanghai Sangon Biotech Co., Ltd.); all other reagents were of analytical grade; and the experimental water was double-distilled water.

[0020] Example 1

[0021] The schematic diagram of the preparation of the electrochemical biosensor based on a specific nucleic acid aptamer fragment and GOx, and its application in the detection of hyacinth yellow rot fungus, is shown in the figure below. Figure 1 As shown, the specific steps are as follows:

[0022] (1) Preparation of MIL-88-NH2. In a round-bottom flask, 0.81 g of FeCl3·6H2O and 0.55 g of 2-aminoterephthalic acid (2-NH2BDC) were dissolved by sonication in 15 mL of N,N-dimethylformamide (DMF). The solution was then magnetically stirred for 3 h in an oil bath at 120 °C, and the product solution gradually changed from yellow to dark brown. After the product solution cooled to room temperature, it was centrifuged and washed multiple times with DMF and ultrapure water (8000 rpm, 15 min, 4 °C), and then vacuum dried overnight at 60 °C to obtain MIL-88-NH2.

[0023] (2) Preparation of MIL-88 / GOx / Xh-Apt-14 composite material. 20 mg of MIL-88-NH2 was mixed with 50 mL of 2.5 wt% glutaraldehyde solution in a beaker and stirred for 2 h; then it was washed three times by centrifugation with phosphate-buffered saline (PBS) buffer solution (pH 7.4, 10 mM), and then vacuum dried at 60 °C for 12 h to obtain MIL-88-CHO; 2 mg of MIL-88-CHO was mixed with 1 nmol Apt-14 and 1 mL of 5 U / mL GOx, and reacted with stirring for 12 h; then it was washed by centrifugation with 1 mL of PBS, and then dispersed in 1 mL of PBS and stored at 4 °C.

[0024] (3) Preparation of MNPs / Xh-Apt-1. After magnetically washing 240 μL of 0.5 wt% MNPs solution three times with 480 μL PBS buffer, it was redispersed in 480 μL PBS buffer. Then, 500 μL of a mixed solution containing 0.1 M 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 0.01 MN-hydroxysuccinimide (NHS) was added, and the mixture was incubated at 37 °C for 50 min. After magnetically washing three times, it was dispersed in 480 μL PBS buffer, and 1 nmol Apt-1 was added. The mixture was incubated at 37 °C overnight. The resulting MNPs / Apt-1 conjugate was magnetically washed three times, redispersed in 480 μL PBS buffer, and stored at 4 °C.

[0025] (4) Preparation of standard concentration hyacinth yellow rot fungus solution. Mix 10 8 The stock solution of CFU / mL was serially diluted with 10mM PBS buffer to prepare 10... 7 CFU / mL, 10 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL and 10 1 Standard solutions of hyacinth yellow rot pathogens at different concentration gradients of CFU / mL.

[0026] (5) Preparation of self-assembled structural products. Take 20 μL of the MIL-88 / GOx / Xh-Apt-14 composite material dispersion from step (2), mix it with 30 μL of the MNPs / Xh-Apt-1 dispersion from step (3), and 50 μL of the hyacinth yellow rot fungus solution at various concentrations from step (4), and incubate for 3 h. After magnetic separation, mix the self-assembled structural products formed with glucose and 3,3'-diaminobenzidine until homogeneous to obtain the self-assembled structural product mixed system solution at various concentration gradients.

[0027] (6) Electrochemical detection of hyacinth yellow rot fungus: DPV detection was performed on the self-assembled mixed system solutions containing standard concentrations of hyacinth yellow rot fungus to obtain the DPV peak current corresponding to different standard concentrations of the target analyte by differential pulse voltammetry; a linear regression equation was performed between the DPV peak current and the logarithm of the target analyte concentration to obtain the standard curve.

[0028] (7) Detection of actual samples: A solution of hyacinth yellow rot fungus with a certain concentration was spiked and counted on a plate; at the same time, the concentration of the fungal solution was detected by DPV using the prepared electrochemical biosensor. The obtained peak current was substituted into the standard curve to calculate the concentration of the fungal solution and compared with the plate counting method.

[0029] Example 2

[0030] The schematic diagram of the preparation of the electrochemical biosensor based on a specific nucleic acid aptamer fragment and GOx, and its application in the detection of hyacinth yellow rot fungus, is shown in the figure below. Figure 1As shown. Steps (1-6) of Example 2 are the same as those of Example 1. Step (7) is as follows: Detection of actual samples: Hyacinth yellow rot fungus is artificially inoculated on hyacinth bulbs. A bulb sample solution containing a certain concentration of the fungus is taken for spot counting. At the same time, the concentration of the fungal solution is detected by DPV using the prepared electrochemical biosensor. The obtained peak current is substituted into the standard curve to calculate the concentration of the fungal solution and compared with the spot counting method.

[0031] Example 3

[0032] The schematic diagram of the preparation of the electrochemical biosensor based on a specific nucleic acid aptamer fragment and GOx, and its application in the detection of hyacinth yellow rot fungus, is shown in the figure below. Figure 1 As shown. Steps (1-6) of Example 3 are the same as those of Example 1. Step (7) is as follows: Detection of actual samples: Take diseased hyacinth bulbs from nature and perform TLC on a sample solution containing a certain concentration of hyacinth yellow rot fungus; at the same time, use the prepared electrochemical biosensor to perform DPV detection on the bacterial solution of this concentration, substitute the obtained peak current into the standard curve, calculate the concentration of the bacterial solution, and compare it with the TLC method.

[0033] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An electrochemical biosensor for detecting hyacinth yellow rot fungus, characterized in that, This electrochemical biosensor is constructed based on a specific nucleic acid aptamer fragment and glucose oxidase GOx, and consists of three parts: a biological probe, a screen-printed carbon electrode, and a portable electrochemical workstation. Biological probes mainly consist of metal-organic framework compound MIL-88-NH2 material, magnetic nanoparticles MNPs, and probe bodies respectively attached to the surface of MIL-88-NH2 or MNPs. The probe consists of two specific nucleic acid aptamer fragments, Xh-Apt-14 and Xh-Apt-1, which have specific recognition functions for the target analyte. The Xh-Apt-1 sequence is 5'-CAC GCA TAA CAC CAC GCA ACA GGG CTC TCATCTGTGACA CAA CGA CGGAGTTATGCG TG-3'; while the Xh-Apt-14 sequence is 5'-CACACG CATAACTCTAGTCACAGGAAGACA AAC CGG GGG GCC CAC GCTGAG TTA TGC GTG-3'. Both Xh-Apt-1 and Xh-Apt-14 nucleic acid aptamer fragments are 5'-terminally amino-treated, and their sequences are self-selected, exhibiting high affinity and enabling specific recognition of the target analyte, Hyacinth Yellow Rot Fungi. The biological probes include probe A and probe B; Xh-Apt-14 together with MIL-88-NH2 and glucose oxidase GOx constitutes probe A, while Xh-Apt-1 together with MNPs constitutes probe B. The main preparation steps of probe A are as follows: First, MIL-88-NH2 is mixed with glutaraldehyde and reacted, then vacuum dried to obtain aldehyde-modified MIL-88-CHO. Then, MIL-88-CHO is mixed with nucleic acid aptamer fragments Xh-Apt-14 and GOx and reacted. The reaction product is centrifuged and washed with phosphate-buffered saline to obtain the MIL-88 / GOx / Xh-Apt-14 composite material. The reaction conditions for MIL-88-NH2 and glutaraldehyde are 1–3 hours at room temperature; the reaction conditions for Xh-Apt-14 and GOx are 6–18 hours at 30–45°C. The reaction product is centrifuged at 7000–11000 rpm for 7–13 minutes, and the centrifugation operation is repeated 2–5 times. The main preparation steps of probe B are as follows: MNPs are mixed with coupling agents 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide and reacted to obtain carboxyl-activated MNPs. The magnetically washed MNPs are then mixed with the nucleic acid aptamer fragment Xh-Apt-1 and reacted to prepare the MNPs / Xh-Apt-1 composite material. The reaction conditions of MNPs and coupling agents are 30-45℃ for 6-18 hours and 2-5 magnetic washes. Probe A and probe B are mixed with the target analyte and reacted at 30–45°C for 2–4 hours. The resulting product is then subjected to magnetic separation to obtain a self-assembled structure product. This self-assembled structure product has the following characteristics: after the biological probe comes into contact with the target analyte, due to specific recognition and the different recognition sites of different nucleic acid aptamer fragments, a self-assembled structure product is formed with the target analyte in the middle and probes A and B on both sides. The self-assembled structure product is separated by magnetic separation. This self-assembled structure product is then mixed evenly with glucose and 3,3'-diaminobenzidine to obtain the corresponding self-assembled structure product mixture system. The supernatant of a mixture containing a certain amount of the target analyte, *Hyacinthia spp.*, was drop-coated onto the surface of a screen-printed carbon electrode. Then, differential pulse voltammetry (DPV) was used for detection. Based on a standard curve that linearly fits the DPV peak current intensity to the logarithm of the target analyte concentration, a highly sensitive electrochemical biosensor for the detection of *Hyacinthia spp.* was developed.