Nucleic acid aptamer specifically recognizing placenta-specific protein 1 and use thereof

Abstract

This invention belongs to the field of biotechnology and discloses a nucleic acid aptamer that specifically recognizes placental-specific protein 1 and its uses. The nucleotide sequence of the nucleic acid aptamer includes any one of the sequences shown in SEQ ID No. 1-57. This invention employs X-aptamer screening technology, combined with high-throughput sequencing technology and bioinformatics analysis, to reduce the number of screening rounds and obtain candidate nucleic acid aptamers. Further analysis of their affinity and specificity yields a nucleic acid aptamer that specifically recognizes placental-specific protein 1. The nucleic acid aptamer of this invention has the characteristics of high affinity and specificity, good stability, convenient synthesis, and easy labeling of functional groups. It can be used for the detection or binding of placental-specific protein 1, the diagnosis of placental-specific protein 1-related diseases, and the preparation of products for prognosis.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to nucleic acid aptamers that specifically recognize placental-specific protein 1 and their uses. Background Technology

[0002] The gene for placenta-specific protein 1 (PLAC1) is located on chromosome Xq26.3, is approximately 92,641 bp in length, and contains three exons. Exon 3 is the coding region, encoding a 1.7 kb mRNA. PLACl protein contains a total of 212 amino acid residues, with amino acids 5-22 forming a transmembrane helical region and amino acids 23-212 forming an extracellular region. Current research shows that in normal female human tissues, PLAC1 is specifically expressed in the placenta and located on the trophoblast cell membrane. In addition, PLACl protein is also expressed in male prostate tissue and various human cancer cells (such as choriocarcinoma, breast cancer, lung cancer, liver cancer, colon cancer, gastric cancer, ovarian cancer, prostate cancer, pancreatic cancer, cervical cancer, etc.) (Nejadmoghaddam, Mohammad-Reza, Zarnani, Amir-Hassan, Ghahremanzadeh, Ramin, et al. Placenta-specific1 (PLAC1) is a potential target for antibody-drug conjugate-based prostate cancer immunotherapy[J]. Scientific Reports, 7(1):13373.).

[0003] Human PLAC1 and mouse Plac1 share approximately 75% and 60% sequence similarity at the gene base and protein amino acid levels, respectively.

[0004] Currently, only PLAC1 protein antibodies are known to have high affinity and high specificity for the PLAC1 protein. There are no research reports on nucleic acid aptamers targeting PLAC1 / Plac1 protein, either domestically or internationally. Summary of the Invention

[0005] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a nucleic acid aptamer that specifically recognizes placental-specific protein 1 and its uses, thereby solving the problems in the prior art.

[0006] A first aspect of the present invention protects a nucleic acid aptamer that specifically recognizes placenta-specific protein 1, said nucleic acid aptamer comprising at least one of 1)-5):

[0007] 1) Single-stranded DNA whose nucleotide sequence includes any one of the sequences shown in SEQ ID No. 1-57;

[0008] 2) The nucleotide sequence defined in 1) has more than 75% identity and specifically recognizes placental-specific protein 1 single-stranded DNA;

[0009] 3) Delete or add one or more nucleotides to the nucleotide sequence specified in 1), and use single-stranded DNA that specifically recognizes placental-specific protein 1.

[0010] 4) A single-stranded RNA transcribed from any of the nucleotides specified in 1) to 3) that specifically recognizes placental-specific protein 1;

[0011] 5) Hybridizes to the nucleotide sequence defined in 1) or 2) or 3) under strict conditions and specifically recognizes any single-stranded DNA or single-stranded RNA of placental-specific protein 1.

[0012] According to the technical solution of the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID No. 3 or SEQ ID No. 9.

[0013] According to the technical solution of the present invention, the nucleotide sequence in 2) specifically refers to a nucleotide sequence as shown in one of SEQ ID No. 1-57 obtained by substituting one or more (specifically, 1-10, 1-5, or 1-3) bases. The nucleotide sequence in 22) has 80%, 85%, 90%, 93%, 95%, 97%, or 99% or more homology with one of SEQ ID No. 1-57.

[0014] According to the technical solution of the present invention, the nucleotide sequence of the nucleic acid aptamer is modified, and the modified nucleic acid aptamer specifically recognizes placental specific protein 1. The modification is selected from at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization.

[0015] According to the technical solution of the present invention, the nucleotide sequence of the nucleic acid aptamer is linked to a signal molecule and / or an active molecule and / or a functional group, and the linked nucleic acid aptamer specifically recognizes placental-specific protein 1.

[0016] Preferably, the signaling molecule, active molecule, or functional group is selected from one or more of fluorescent or quenching groups, radioactive substances, therapeutic substances, proteins, antibodies, siRNA, luminescent nanomaterials, biotin, digoxin, and cholesterol.

[0017] More preferably, the fluorescent group is selected from one or more of fluorescein isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), Cy5, Cy3, Quasar 670, and Alexa Fluor488 / 647.

[0018] More preferably, the fluorescent group is selected from FAM.

[0019] According to the technical solution of the present invention, the placenta-specific protein 1 is derived from humans or mice.

[0020] The second aspect of the present invention protects the use of a nucleic acid aptamer that specifically recognizes placental-specific protein 1 in at least one of the following B1)-B7):

[0021] B1) Use in the preparation of products for binding placenta-specific protein 1;

[0022] B2) Use in the preparation of products for the detection of placental-specific protein 1;

[0023] B3) Use in the purification of placental-specific protein 1;

[0024] B4) Use in the preparation of products targeting placental-specific protein 1;

[0025] B5) Use in the preparation of inhibitors of placental-specific protein 1;

[0026] B6) Use in the preparation of screening, diagnostic or auxiliary diagnostic tools for diseases related to placental-specific protein 1;

[0027] B7) Use in the preparation of medicines or products for the prevention, improvement or treatment of diseases related to placental-specific protein 1.

[0028] According to the technical solution of the present invention, the placenta-specific protein 1-related diseases are selected from one or more of choriocarcinoma, breast cancer, lung cancer, liver cancer, colon cancer, gastric cancer, ovarian cancer, prostate cancer, pancreatic cancer, and cervical cancer.

[0029] Preferably, the placenta-specific protein 1-related disease is choriocarcinoma.

[0030] A third aspect of the present invention protects a probe, said probe being a substance obtained by labeling the nucleic acid aptamer with a label.

[0031] According to the technical solution of the present invention, the marker is selected from signal molecules and / or functional groups.

[0032] Preferably, the signal molecule or functional group is selected from one or more of fluorescent or quenching groups, radioactive substances, nanoluminescent materials, biotin, digoxin, and cholesterol.

[0033] More preferably, the fluorescent group is selected from one or more of fluorescein isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), cy5, cy3, Quasar 670, and Alexa Fluor488 / 647.

[0034] More preferably, the fluorescent group is selected from FAM.

[0035] A fourth aspect of the present invention protects a product for binding to or detecting placental-specific protein 1, said product comprising the nucleic acid aptamer as described above.

[0036] According to the technical solution of the present invention, the product is selected from reagent kits, membrane strips, sensors, and chips.

[0037] A fifth aspect of the present invention protects a medicament for the prevention, improvement or treatment of placental-specific protein 1-related diseases, said medicament containing a nucleic acid aptamer as described above.

[0038] A sixth aspect of the present invention protects a drug delivery system that specifically targets placenta-specific protein 1, the drug delivery system comprising a nucleic acid aptamer as described above.

[0039] A seventh aspect of the present invention protects a method for detecting placental-specific protein 1, the method comprising labeling a reporter group onto a nucleic acid aptamer as described above, causing the nucleic acid aptamer labeled with the reporter group to interact with a sample to be tested, and detecting placental-specific protein 1 by detecting the signal of the reporter group.

[0040] The eighth aspect of this invention protects a method for preparing nucleic acid aptamers as described above, comprising the following:

[0041] 1) Negative selection: The initial ssDNA library microspheres were incubated with magnetic beads to obtain microspheres that do not adsorb magnetic beads;

[0042] 2) Positive screening: PLAC1 protein was mixed with magnetic beads to obtain magnetically labeled target proteins; the microspheres obtained in 1) that do not adsorb magnetic beads were incubated with the magnetically labeled target proteins to obtain microspheres that can bind to the target proteins.

[0043] 3) Dissociation: The microspheres bound to the target protein obtained in 2) are dissociated and then precipitated with PLAC1 protein to obtain the target ssDNA, which is the nucleic acid aptamer that specifically recognizes placental specific protein 1.

[0044] The present invention has the following beneficial effects:

[0045] 1) The nucleic acid aptamer of the present invention can specifically recognize placental specific protein 1. Its binding strength to the target molecule is comparable to that of the antibody that recognizes the same target. Moreover, the volume of the nucleic acid aptamer of the present invention is much smaller than that of the antibody, and its molecular weight is only about half that of the antibody. Compared with the antibody, the smaller volume makes the nucleic acid aptamer have better tissue uptake ability, tissue penetration ability and faster blood metabolism speed.

[0046] 2) The nucleic acid aptamers of the present invention have no immunogenicity or low immunogenicity when used in vivo, while the antibodies have high immunogenicity.

[0047] 3) The nucleic acid aptamers of the present invention can be synthesized by chemical methods and amplified in large quantities by PCR technology. Their production cost, efficiency and stability are significantly better than those of antibodies.

[0048] 4) Compared to antibodies, the nucleic acid aptamers of the present invention can be easily modified in various ways to obtain special properties or functions without affecting their binding ability. Attached Figure Description

[0049] Figure 1 The diagram shown illustrates the method for preparing nucleic acid aptamers in Example 1 of the present invention.

[0050] Figure 2 The image shown is an agarose gel electrophoresis result of the PCR amplification product in Example 1 of this invention. In the image, M represents the DNA Marker, 1 represents the initial solution control, 2 represents the target protein, and 3 represents the magnetic bead control.

[0051] Figure 3 The results of the nucleic acid aptamer library obtained in Example 1 of this invention are shown. The Start pool is the initial control group (OK indicates low copy number, HC indicates high copy number), T2 is the experimental group (0-10 is the standardized relative copy number; a higher value indicates potentially higher affinity), and MP control is the magnetic microparticle control group (CP indicates the presence of copies, NR indicates the absence of copies).

[0052] Figure 4 The graph shown is an amplification curve of affinity detection between the nucleic acid aptamer and placental specific protein 1 in Example 2 of the present invention.

[0053] Figure 5 The images shown are laser confocal microscope images of human lung tissue, human spleen tissue, human liver tissue, human myocardial tissue, human kidney tissue, and human stomach tissue stained with FAM-labeled nucleic acid aptamers and fluorescently labeled PLAC1 antibodies in Example 3 of the present invention.

[0054] Figure 6The images shown are laser confocal microscope images of human chorionic villus tissue, human chorionic carcinoma tissue, mouse chorionic villus tissue, human ovarian tissue, human testicular tissue, human colon tissue, and human brain tissue after staining with FAM-labeled nucleic acid aptamers and fluorescently labeled PLAC1 antibodies in this embodiment.

[0055] Figure 7 The images shown are laser confocal microscope images of FAM-labeled nucleic acid aptamers and fluorescently labeled PLAC1 antibodies cultured with human trophoblast cells, as shown in Example 4 of this invention. Detailed Implementation

[0056] To address the lack of specific nucleic acid aptamers for human PLACl protein (PLACl) and mouse Plac1 protein (Plac1) in existing technologies, and the problems of large size and immunogenicity of antibodies specifically recognizing PLACl / Plac1 proteins, this invention utilizes X-aptamer screening technology, high-throughput sequencing technology, and bioinformatics analysis to screen and obtain nucleic acid aptamers that specifically recognize PLACl / Plac1 proteins. The nucleic acid aptamers of this invention are characterized by high specificity, high stability, convenient synthesis, and easy labeling of functional groups. They can specifically recognize and bind to PLACl / Plac1 proteins and can be used for the detection of PLACl / Plac1 proteins and the preparation of products targeting PLACl proteins, such as biosensors, for screening, diagnosis, or auxiliary diagnosis of PLACl-related diseases. Furthermore, the nucleic acid aptamers of this invention are also potential drugs for PLACl / Plac1 protein-related diseases, and can be used to prepare reagents or drugs for clinical prevention, improvement, or treatment.

[0057] For the above objectives, a first aspect of the present invention protects a nucleic acid aptamer that specifically recognizes placental-specific protein 1, said nucleic acid aptamer comprising at least one of 1)-5):

[0058] 1) Single-stranded DNA whose nucleotide sequence includes any one of the sequences shown in SEQ ID No. 1-57;

[0059] 2) The nucleotide sequence defined in 1) has more than 75% identity and specifically recognizes placental-specific protein 1 single-stranded DNA;

[0060] 3) Delete or add one or more nucleotides to the nucleotide sequence specified in 1), and use single-stranded DNA that specifically recognizes placental-specific protein 1.

[0061] 4) A single-stranded RNA transcribed from any of the nucleotides specified in 1) to 3) that specifically recognizes placental-specific protein 1;

[0062] 5) Hybridizes to the nucleotide sequence defined in 1) or 2) or 3) under strict conditions and specifically recognizes any single-stranded DNA or single-stranded RNA of placental-specific protein 1.

[0063] As a preferred embodiment, the placenta-specific protein 1 is derived from human and is human PLACl.

[0064] As a preferred embodiment, the placenta-specific protein 1 is derived from mice and is mouse Plac1.

[0065] As a preferred embodiment, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID No. 3 or SEQ ID No. 9.

[0066] As a preferred embodiment, the bases in the nucleotide sequence can be natural bases, such as thymine T, cytosine C, adenine A, and guanine G; or they can be derivatives of natural bases. The derivatives of natural bases are compounds in the prior art, such as thymine T. The structure of its thymine derivatives can be found in reference 1 (Hongyu Wang., X-aptamers targeting Thy-1membrane glycoprotein in pancreatic ductaladenocarcinoma, Biochimie, 181)(2021):25-33, or CN100372863C.

[0067] As a preferred embodiment, the nucleotide sequence in 2) specifically refers to a nucleotide sequence as shown in one of SEQ ID No. 1-57 obtained by substituting one or more (specifically, 1-10, 1-5, or 1-3) bases. The nucleotide sequence in 22) may have 80%, 85%, 90%, 93%, 95%, 97%, or 99% or more homology with one of SEQ ID No. 1-57.

[0068] As a preferred embodiment, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer is specifically recognized, wherein the modification is selected from at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization.

[0069] In a preferred embodiment, the nucleotide sequence of the nucleic acid aptamer is linked to a signaling molecule and / or an active molecule and / or a functional group and / or a radionuclide, and the linked nucleic acid aptamer specifically recognizes placental-specific protein 1.

[0070] For the purposes described above, another aspect of the present invention protects a probe, said probe being a substance obtained by labeling the nucleic acid aptamer described above with a label.

[0071] In a preferred embodiment, the marker is a signal molecule and / or a functional group. The marker refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect and can be linked to nucleic acids. The marker includes, but is not limited to, dyes; radioactive markers, such as… 32 P; conjugated coupling groups, such as biotin; haptens, such as digoxigenin (DIG); chemiluminescent, phosphorescent, or fluorescent portions; and fluorescent dyes alone or in combination with portions that can inhibit or shift the emission spectrum via fluorescence resonance energy transfer (FRET). Labels can provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric analysis, quantum dots, electrochemistry, X-ray diffraction or absorption, magnetism, enzyme-linked immunosorbent assays (ELISA), filter paper-based immunoassays, affinity precipitation, affinity chromatography, enzyme activity, projection microscopy or scanning imaging, super-resolution imaging, cell tracing, in vivo nanoparticle tracking imaging in animals or humans, nanoflow cytometry, tunable resistance pulse sensing, fluorescence-correlated spectroscopy, surface plasmon resonance, fluorescence polarization, surface-enhanced Raman spectroscopy, electrochemical sensing, microfluidics or microfluidics, microarray analysis, proteomics, genomics, metabolomics, microbiomics, RNA (mRNA, lnRNA, snRNA), miRNA, etc. Labels can be charged portions (positive or negative) or selected as needed, and can be charge-neutral. The label may include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without a label (e.g., direct sequence reading). The label may also be used for targeted drug delivery.

[0072] In some embodiments, the label is a fluorophore, colorimetric label, quantum dot, biotin, and other tag molecules that can be used for detection (such as alkyne groups for Raman diffraction imaging, cycloalkenes for click reactions, and initiating groups for polymer labeling). It can also be selected from peptide / protein molecules, LNA / PNA, non-natural amino acids and their analogs (such as peptides), non-natural nucleic acids and their analogs (nucleotides), and nanostructures (including inorganic nanoparticles, NV-centers, aggregation / assembly-induced luminescent molecules, rare earth ion ligand molecules, polyoxometalates, etc.).

[0073] In some embodiments, the fluorophore may be selected from fluorescein dyes, rhodamine dyes, and cyanine dyes.

[0074] Preferably, the fluorescein dyes include standard fluorescent groups and their derivatives, such as fluorescein isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), Cy5, Cy3, Quasar 670, Alexa Fluor 488 / 647, etc.

[0075] Preferably, the rhodamine dyes include R101, tetraethylrhodamine (RB200), and carboxytetramethylrhodamine (TAMRA), etc.

[0076] Preferably, the cyanine dyes are mainly selected from two categories: one is the thiazole orange (TO) and oxazole orange (YO) series and their dimer dyes, and the other is the polymethyl cyanine dye series.

[0077] In some embodiments, the fluorophore may also be selected from the following dyes: stilbene, naphthaleneimide, coumarin, acridine, pyrene, etc.

[0078] The fluorophore is usually labeled at the 5' end of the probe sequence, but it can also be placed at the 3' end by changing the modifying bond (e.g., -OH or -NH bond).

[0079] In one embodiment of the present invention, the 5' end of the single-stranded DNA (ssDNA) aptamer described in SEQ ID No. 1-57 is labeled with FAM. The probe is then injected into the blood or incubated in vitro with relevant tissues or cells. The cells expressing placental-specific protein 1 can then be identified and imaged using a fluorescence recognition instrument.

[0080] For the purposes described above, another aspect of the present invention protects a product for binding to or detecting placental-specific protein 1, said product comprising the nucleic acid aptamer as described above.

[0081] According to the technical solution of the present invention, the product is selected from reagent kits, membrane strips, sensors, and chips.

[0082] Preferably, the kit further includes Taq DNA polymerase, dNTPs, PCR buffer, and Mg2+ required for PCR amplification. 2+ One or more of them.

[0083] Preferably, the various reagent components of the kit may be present in separate containers, or may be pre-assembled into a reagent mixture, either wholly or partially.

[0084] For the purposes described above, another aspect of the present invention protects a medicament for the prevention, improvement or treatment of placental-specific protein 1-related diseases, said medicament containing the nucleic acid aptamer as described above.

[0085] As a preferred embodiment, the drug further comprises one or more pharmaceutically acceptable carriers.

[0086] Preferably, the pharmaceutically acceptable carrier may be a diluent, excipient, filler, binder, wetting agent, disintegrant, absorption promoter, adsorbent, surfactant, or lubricant.

[0087] To achieve the above objectives, another aspect of the present invention protects a drug delivery system specifically targeting placental-specific protein 1, the drug delivery system comprising the nucleic acid aptamers described above. By loading drugs (e.g., MTX) into drug-carrying microparticles (e.g., PLGA) using relevant technologies (e.g., emulsification diffusion technology), and linking the nucleic acid aptamers to the drug-carrying microparticles via electrostatic coupling or other methods, a drug delivery system capable of targeted drug delivery to cells expressing placental-specific protein 1 (e.g., trophoblastic cells, invasive hydatidiform mole cells, choriocarcinoma cells, breast cancer cells, lung cancer cells, liver cancer cells, colon cancer cells, gastric cancer cells, ovarian cancer cells, prostate cancer cells, pancreatic cancer cells, cervical cancer cells, etc.) can be constructed. This targeted drug delivery system can be used to treat various cancers, ectopic pregnancies, and other diseases requiring chemotherapy drugs with significant side effects, achieving low-toxicity and highly efficient targeted drug delivery.

[0088] The nucleic acid aptamer of the present invention can specifically bind to human chorionic villus tissue, human chorionic carcinoma tissue and mouse chorionic villus tissue, while it does not specifically bind to other major human organs and tissues such as ovary, testis, colon, brain, lung, spleen, liver, myocardium, kidney and stomach. Therefore, it can be used as a drug delivery system to specifically and target human chorionic villus tissue, human chorionic carcinoma tissue and mouse chorionic villus tissue.

[0089] As a preferred embodiment, the drug delivery system may be a liposome drug delivery system, a polymer micelle drug delivery system, a polymer disk drug delivery system, or a nanoparticle drug delivery system.

[0090] As a preferred embodiment, the drug delivery system is used for targeted delivery and / or site-specific release of drugs.

[0091] For the above objectives, another aspect of the present invention protects the use of a nucleic acid aptamer that specifically recognizes placental-specific protein 1 in at least one of the following B1)-B7):

[0092] B1) Use in the preparation of products for binding placenta-specific protein 1;

[0093] B2) Use in the preparation of products for the detection of placental-specific protein 1;

[0094] B3) Use in the purification of placental-specific protein 1;

[0095] B4) Use in the preparation of products targeting placental-specific protein 1;

[0096] B5) Use in the preparation of inhibitors of placental-specific protein 1;

[0097] B6) Use in the preparation of screening, diagnostic or auxiliary diagnostic tools for diseases related to placental-specific protein 1;

[0098] B7) Use in the preparation of medicines or products for the prevention, improvement or treatment of diseases related to placental-specific protein 1.

[0099] According to the technical solution of the present invention, the placenta-specific protein 1-related diseases are colorectal cancer, gastric adenocarcinoma, or breast cancer.

[0100] According to the technical solution of the present invention, the placenta-specific protein 1-related disease is choriocarcinoma.

[0101] For the purposes described above, another aspect of the present invention protects a method for detecting placental-specific protein 1, the method comprising labeling a reporter group onto a nucleic acid aptamer as described above, causing the nucleic acid aptamer labeled with the reporter group to interact with a sample to be tested, and detecting placental-specific protein 1 by detecting the signal of the reporter group.

[0102] As a preferred embodiment, the reporter group may be biotin or a fluorescent group, and the fluorescent group is selected from, but not limited to, Rhodamine, FAM, FITC, BODIPY, Cy3, Cy5, VIC, HEX, TRT, ROX, JOE, and TAMRA.

[0103] In a more preferred embodiment, the reporting group is FAM.

[0104] As a preferred embodiment, the sample to be tested is selected from one or more of the following: chorionic villus tissue, choriocarcinoma tissue, ovarian tissue, testicular tissue, colon tissue, brain tissue, lung tissue, spleen tissue, liver tissue, myocardial tissue, kidney tissue, and stomach tissue.

[0105] For the above objectives, another aspect of the present invention protects a method for preparing a nucleic acid aptamer as described above, comprising the following:

[0106] 1) Negative selection: The initial ssDNA library microspheres were incubated with magnetic beads to obtain microspheres that do not adsorb magnetic beads;

[0107] 2) Positive screening: PLAC1 protein was mixed with magnetic beads to obtain magnetically labeled target proteins; the microspheres obtained in 1) that do not adsorb magnetic beads were incubated with the magnetically labeled target proteins to obtain microspheres that can bind to the target proteins.

[0108] 3) Dissociation: The microspheres bound to the target protein obtained in 2) are dissociated and then precipitated with PLAC1 protein to obtain the target ssDNA, which is the nucleic acid aptamer that specifically recognizes placental specific protein 1.

[0109] In this invention, the purpose of the above-described uses or methods may be for disease diagnosis, disease prognosis, and / or disease treatment, or their purpose may be non-disease diagnosis, non-disease prognosis, and non-disease treatment; their direct purpose may be to obtain information on intermediate results of disease diagnosis, disease prognosis, and / or disease treatment, or their direct purpose may be non-disease diagnosis, non-disease prognosis, and / or non-disease treatment.

[0110] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0111] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0112] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0113] Example 1: Screening and preparation of nucleic acid aptamers

[0114] In this embodiment, nucleic acid aptamers that specifically recognize placental-specific protein 1 were screened using X-aptamer screening and sequencing technologies. The preparation method of the nucleic acid aptamers is as follows: Figure 1 The diagram shown includes the following steps:

[0115] 1. Materials and Instruments

[0116] 1.1 The main materials and reagents are shown in Table 1.

[0117] Table 1

[0118]

[0119]

[0120] Preparation of buffer solution

[0121] Prepare two buffer solutions: one is a screening buffer containing bovine serum albumin (BSA) (buffer A), and the other is a protein-free buffer without bovine serum albumin (BSA) (buffer B).

[0122] Buffer B (PBS™): 1×PBS pH 7.4, 1mM MgCl2 and 0.05% Tween 20.

[0123] Buffer A (PBSTMB): 1×PBS pH 7.4, 1mM MgCl2, 0.05% (V / V) Tween 20 and 2mg / mL BSA.

[0124] Note: BSA inhibits nonspecific binding.

[0125] Oligonucleotide library and upstream and downstream primers for PCR amplification

[0126] The microsphere library containing the initial oligonucleotide library sequence: 5'-CAGGGGACGCACCAAGG-(N)40-GCCAATCAGCACGCGGGTCATGG (each microsphere has multiple copies of a single sequence of oligonucleotides coupled to its surface) was synthesized by AM Biotech, USA. Synthesis method: 100 mg per microsphere library. Usage instructions are given in screening step 2.1.

[0127] The upstream primer for PCR amplification is 5'-CAGGGGACGCACCAAGG-3' (SEQ ID No. 58).

[0128] The downstream primer for PCR amplification is 5'-GCCAATCAGCACGCGGGTCATGG-3' (SEQ ID No. 59).

[0129] PLAC1 target protein

[0130] Purchased from Abcam, part number: ab127141.

[0131] 2. Screening Steps

[0132] 2.1 Preparation of Oligonucleotide Libraries

[0133] 100 mg of dry-packaged microspheres (i.e., the X-Aptamer kit manual in Table 1, which contains 10...) 9 Mix the initial oligonucleotides (100 microspheres) with 10 mL of buffer B in a 15 mL centrifuge tube and centrifuge at 3000 CFR for 10 min at room temperature. Discard the supernatant, leaving only about 100 μL of supernatant in the centrifuge tube (ensure all microspheres remain in the tube when discarding the supernatant). Then add 3 mL of buffer B and vortex again to mix.

[0134] After mixing, place in a 95℃ water bath for 5 minutes and allow to cool naturally to room temperature to allow the oligonucleotides to form a stable tertiary structure. Add 7 mL of buffer A and vortex to mix. Then, centrifuge at 3000 CFR for 10 minutes at room temperature, discard the supernatant, and retain 100 μL of supernatant in the centrifuge tube. Add buffer A to the total volume of 1.8 mL, and finally transfer to a 2 mL tube to obtain the oligonucleotide library.

[0135] 2.2 Negative screening: Removing microspheres that are not specifically bound to the oligonucleotide library.

[0136] Pipette 250 μL of M-280 streptavidin magnetic particles (abbreviated as magnetic particles) from Table 1 into a 1.5 mL test tube, place the test tube on a magnetic rack, let it stand for 1 min, and then discard the supernatant.

[0137] Next, add 500 μL of buffer A, rotate and wash the magnetic particles, discard the supernatant, and repeat the washing twice. Resuspend the washed magnetic particles in 50 μL of buffer A, and then add them all to the oligonucleotide library obtained in step 2.1. Incubate uniformly by rotation at room temperature for 1 hour. Remove the magnetic particles and all microspheres bound to oligonucleotides using a magnetic separator, and transfer the unbound oligonucleotide microspheres to a 15 mL centrifuge tube. Repeat the washing and transfer process until all unbound oligonucleotide microspheres have been transferred. Discard the magnetic particles and all adsorbed ligand microspheres to obtain unbound aptamer microspheres.

[0138] The obtained aptamer microspheres were washed three times with 10 mL of buffer A. Finally, the washed aptamer microspheres were resuspended in buffer A and transferred to a 2 mL tube, with a final volume of 1.8 mL, to obtain microsphere library A, which was used for subsequent screening of target proteins.

[0139] 2.3 Coupling of the target protein (PLAC1 protein) with magnetic particles

[0140] Pipette 50 μL (approximately 0.5 mg) of M-280 streptavidin magnetic particles (abbreviated as magnetic particles) with a concentration of 10 mg / mL as shown in Table 1 into a 1.5 mL tube, place it on a magnetic rack and let it stand for 1 min, then discard the supernatant. Add 250 μL of buffer B, rotate and wash the magnetic particles, discard the supernatant, and repeat the washing twice to obtain magnetic particles X.

[0141] At room temperature, mix 100 μL of buffer B with the magnetic particles X from step 2.3 of this embodiment, then add 10–15 μg of the target protein (purchased from Abcam, catalog number: ab127141) and incubate at room temperature for 30 min to perform coupling. After coupling, place on a magnetic rack, discard the buffer, and wash with 200 μL of buffer B, repeating the wash twice. Then add 100 μL of buffer A to obtain the T1 mixture.

[0142] 2.4 Positive screening (first specific screening)

[0143] The microsphere library A obtained in step 2.2 of this embodiment is mixed with the T1 mixture obtained in step 2.3 of this embodiment at room temperature. After rotating and incubating at room temperature for 90 min, a mixed library B is obtained, and the mixed library B is divided into equal volumes.

[0144] Pipette 1 / 2 volume into a 1.5 mL tube and use a magnetic rack to adsorb microspheres that are non-covalently coupled to the magnetic particles for 1–2 min. Discard the supernatant and unbound aptamer microspheres to obtain microspheres in which the target protein, magnetic particles, and aptamers are bound (non-covalently coupled), and label them as new microspheres Y. Using a magnetic rack, wash the new microspheres Y repeatedly with 0.5 mL–1.0 mL of buffer A, adsorbing the magnetic particles onto the magnetic rack, and discard the supernatant. Continue until the washing solution becomes clear and free of unbound aptamer microspheres.

[0145] The remaining half volume of the mixed library B was washed using the same method. The two washes of the newly obtained microspheres Y were then combined and washed twice with 500 μL of buffer B each time. Typically, the total volume of the washing buffer is approximately 10 mL. The final microspheres Y were resuspended in 50 μL of buffer B.

[0146] Note: Measure the final suspension volume. If the final volume exceeds 50 μL, the dissociation fluid volume used for aptamer dissociation should be adjusted accordingly.

[0147] 2.5 Aptamer dissociation

[0148] Add 50 μL of 1N NaOH to 50 μL of the new microspheres Y obtained in step 2.4. Incubate at 65 °C for 30 min. Then add 40 μL of 2M Tris-Cl to neutralize the NaOH. Use a magnetic rack to adsorb magnetic particles, and transfer the supernatant to a 1.5 mL tube to obtain mixture U. (Mixture U contains the oligonucleotide aptamers screened in step 1)

[0149] Note: A: The 2M Tris-Cl here is not a buffer solution. Its pH value should be between 5.0 and 5.5. When added to the tube above, the pH value should be between 7 and 8.

[0150] B: Example of aptamer dissociation: If the volume of the magnetic particle suspension is 64 μL, then the volume of 1N NaOH added should be 64 μL, while the volume of 2M Tris-Cl added should be 52 μL.

[0151] 2.6 Elution of coarse aptamer samples (equilibration filter column)

[0152] Prepare two filter columns, unscrew the bottom assembly, and open the cap. Place the filter column into a 1.5 mL collection tube, centrifuge at 1500g for 1 min, and discard the stock solution. Add 300 μL of buffer B to the top of the resin layer, centrifuge at 1500g for 1 min, and discard the rinsing solution. Repeat 2–3 times, discarding the rinsing solution in the collection tube each time.

[0153] Connect the filter column to a new 1.5 mL collection tube. (Each column can process 30 μL to 130 μL of sample. Divide the mixture U into two portions, using one column for each portion). Add the mixture U to the top of the filter column, centrifuge at 1500 g for 2 min, and collect the filtrate sample. Discard the used filter column. Combine the filtrates from the two collection tubes. Name this solution Mixture F. The volume of Mixture F is 140–180 μL.

[0154] 2.7 Specific screening

[0155] Divide the mixture F obtained in step 2.6 into three tubes (labeled 1-3 sequentially) (see Table 2), each containing 45 μL. Tube 1 is the initial solution control group, and tube 3 is the negative control group (containing magnetic particles). Add 105 μL of buffer A to each of tubes 1 and 3, bringing the total volume to 150 μL. Add the labeled target protein to tube 2, bringing the final reaction volume to 150 μL and the protein concentration to 100 nM (see Table 2 below for details). Vortex the mixture F and the target protein at room temperature for 1 hour.

[0156] Table 2

[0157]

[0158] Take 60 μL of M-280 streptavidin magnetic particles, wash with 500 μL of buffer B, repeat the washing twice, and finally resuspend the magnetic particles with 30 μL of buffer B to obtain resuspended particles C.

[0159] Add 10 μL of resuspended particle C to tubes 2 and 3 respectively.

[0160] Tube #1, without adding resuspended particles C, serves as the starting solution control, 150 μL. Tube #1 is named the starting solution tube.

[0161] Tubes #2 and #3 were vortexed at room temperature for 30 min each. Using a magnetic rack, particles were magnetically separated from tubes #2 and #3, and each tube was washed three times with 150 μL of buffer B. Finally, 100 μL of buffer B was added to both tubes #2 and #3 to obtain mixed solution E. The volume of mixed solution E in tubes #2 and #3 was 100 μL.

[0162] 2.8 PCR and gel electrophoresis analysis

[0163] Take 10 μL of the solution from tubes 1, 2, and 3 in step 2.8 and perform PCR amplification. Use primer 01 for tube 1, primer 02 for tube 2, and primer 07 for tube 3.

[0164] The PCR reaction solution includes: 100 μL of 1×PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 0.4 μM forward primer, 0.4 μM reverse primer and 1 U Taq Polymerase.

[0165] The amplification conditions were: pre-denaturation at 94℃ for 1 min, followed by cycling at 94℃ for 30 s, 58℃ for 30 s, and 72℃ for 1 min, with a final extension at 72℃ for 3 min. 25 cycles were performed.

[0166] The obtained PCR amplification products were analyzed using 4.5% agarose gel electrophoresis. Results are shown below. Figure 2 .

[0167] Note: Primers need to be diluted to the working solution concentration, with a final concentration of 40 nM. The expected PCR band size is 75 bp.

[0168] 2.9 Next-generation sequencing

[0169] 80 μL of each PCR product obtained in step 2.8 of this embodiment was sent to the High-Throughput Department of Sangon Biotech (Shanghai) Co., Ltd. for next-generation sequencing. The sequencing results were sent to AM Biotech (USA) for data analysis to obtain the target protein aptamer library screening results. The results of the obtained nucleic acid aptamer library (with artificial bases removed) are shown in [the image / document / reference]. Figure 3The nucleotide sequences of the aptamers are shown in Table 1.

[0170] 3. Experimental Results

[0171] 3.1 PCR detection results of X-Aptamer screening

[0172] The PCR products obtained in step 2.9 were analyzed by agarose gel electrophoresis: 4.5% agarose gel electrophoresis. The resulting PCR band was 75 bp in size.

[0173] Figure 1 This is a schematic diagram of the nucleic acid aptamer screening method in this embodiment.

[0174] Figure 2 This is an agarose gel electrophoresis result of the PCR amplification products in this embodiment. In the figure, M represents the DNA Marker, 1 represents the initial solution control, 2 represents the target protein (PLAC1 protein), and 3 represents the magnetic bead control.

[0175] Figure 3 The table shows the results of the nucleic acid aptamer library obtained in this embodiment. The sequences displayed are conserved sequences of the complete aptamers after removing the upstream primer sequence "TTTTTAA" and the downstream primer sequence "CCATG". Startpool is the initial control group (OK indicates low copy number, HC indicates high copy number), T2 is the experimental group (0-10 is the normalized relative copy number; a higher value indicates potentially higher affinity), and MP control is the magnetic particle negative control group (CP indicates the presence of copies, NR indicates the absence of copies).

[0176] Table 3

[0177]

[0178]

[0179]

[0180] Example 2: Affinity study between nucleic acid aptamers and PLAC1 protein

[0181] In this embodiment, the nucleic acid aptamers DT-8 and DT-25 obtained in Example 1 were used as representatives to study their affinity for PLAC1 protein. The affinity between the nucleic acid aptamers and PLAC1 protein was detected using qPCR, commissioned to Shanghai Bioengineering Co., Ltd., and the specific steps are as follows:

[0182] 2.1 Protein Biotin Labeling

[0183] 1) Add 170 μL of ultrapure water to 2 mg NHS-PEG4-Biotin to prepare a 20 mM NHS-PEG4-Biotin stock solution;

[0184] 2) Dissolve protein PBP2a in phosphate buffer to obtain a protein PBP2a solution with a final concentration of 1-5 mg / mL; wherein the phosphate buffer consists of 0.1 M sodium phosphate and 0.15 M sodium chloride at a final concentration, pH 7.2.

[0185] 3) Mix the protein PBP2a solution obtained in step 2) with the NHS-PEG4-Biotin stock solution obtained in step 1) and incubate on ice for 2 hours or at room temperature for 30 minutes.

[0186] 4) Remove excess NHS-PEG4-Biotin by dialysis or gel filtration to obtain dialysate or filtrate, and store for later use.

[0187] 2.2 Quantitative detection of biotin (cubing dish method)

[0188] 1) Equilibrate the HABA / Avidin mixture to room temperature;

[0189] 2) Add 100 μL of ultrapure water to a microtube containing the HABA / Avidin mixture and dissolve by pipetting;

[0190] 3) Take 800 μL of PBS into a 1 mL colorimetric tube and use this tube for zeroing;

[0191] 4) Add 100 μL of the HABA / Avidin mixture from step 2) in section 2.2 to a cuvette, invert and mix thoroughly to obtain a HABA / Avidin mixed solution, and measure its A content. 500 Value (A) 500 H\A);

[0192] 5) Add 100 μL of biotinylated protein or HRP enzyme (positive control) to the HABA / Avidin mixed solution obtained in step 4), mix well; then measure the A at this point. 500 Value (A) 500 H\A\B).

[0193] Calculate the number of moles of biotin labeled per mole of protein and the number of biotin molecules labeled per mole of protein.

[0194] Calculate the Biotin / Protein molar ratio

[0195] A = Biotinylated protein millimolecular concentration = Protein concentration (mg / ml) / Protein molecular weight

[0196] Absorbance change at B = 500 nm

[0197] △A 500 = (0.9×A) 500 HABA / Avidin)-A 500 HABA / Avidin / Biotin

[0198] C = millimolecular concentration of biotin = mmol Biotin / ml reaction solution = ΔA 500 / (34,000M -1 cm -1 (Optical path)

[0199] Biotin / Protein molar ratio = C·10 (dilution factor) / A

[0200] 2.3 The value required to calculate the number of moles of biotin per mole of protein or sample is shown below:

[0201] 1) The concentration of the protein or sample used is expressed in mg / mL.

[0202] 2) The molecular weight of a protein is expressed in grams per mole (e.g., horseradish peroxidase = 40,000 g / mol; protein A = 150,000 g / mol).

[0203] 3) Detect the absorbance of the HABA / avidin reaction mixture at a wavelength of 500 nm (A). 500 H\A)

[0204] 4) Detect the absorbance of the HABA / avidin / biotin reaction mixture at a wavelength of 500 nm (A). 500 H\A\B)

[0205] 5) Dilution factor: The factor by which the sample has been diluted before being added to the reaction solution.

[0206] 2.4 Coupling of proteins with magnetic particles

[0207] 1) Mix the magnetic particles (10 mg / mL) thoroughly. Using a 100 μL pipette, pipette 50 μL (0.5 mg) into a 1.5 mL tube. Place the 1.5 mL tube containing 50 μL on a magnetic rack and let it stand for 1 min, allowing the magnetic particles to bounce slightly at the bottom edge of the tube. Discard the supernatant using a precision pipette. Add 250 μL of buffer A and vortex to wash the magnetic particles. Discard the supernatant using a precision pipette. Repeat the washing process twice more, for a total of three washes (named: Magnetic Particle Tube X).

[0208] 2) At room temperature, add 100 μL of buffer A to the magnetic particle X tube using a precision pipette, then add the target protein and incubate at room temperature for 30 minutes. During incubation, tap the X tube a few times with your finger every minute.

[0209] 3) Place the X tube containing the coupling reaction on a magnetic rack, discard the buffer solution using a precision pipette, and wash with 200 μL of buffer A. Repeat twice (for a total of 3 times). Finally, add 100 μL of buffer B to the X tube using a precision pipette.

[0210] 4) Protein and aptamer incubation binding

[0211] The PLAC1 target protein bound to magnetic beads and the screened modified aptamers were added according to the table below, and their sequences are as follows:

[0212] S1:TTTTTAA CACGACACTGCTGTGGTCAGCACAGTCTGGGCAGGTCGTG CCATG (SEQ ID No. 60)

[0213] S2:TTTTTAA CACGACCAACGTTCGCCCAACGAACTCATCCAGCGTGGGC CCATG (SEQ ID No. 61)

[0214] The underlined portion in the sequence is the core sequence of the nucleic acid aptamer, and... Figure 3 The sequences of sequence 3 and sequence 9 are the same.

[0215] The final reaction volume was 200 μL, the final aptamer concentration was 100 nM, and the protein concentrations were 0.005, 0.05, 0.5, 5, 50, and 500 nM respectively (see Table 4 below for details). A qPCR standard curve experimental group was set up (Table 5). The mixture was vortexed at room temperature for 1.5 hours. Magnetic particles were separated using a magnetic rack. The supernatant did not contain biotin-labeled protein or magnetic particles and was used as the template for the qPCR reaction.

[0216] Table 4

[0217]

[0218]

[0219] Table 5

[0220]

[0221] 2.6 qPCR quantification

[0222] The primer design for the PLAC1 aptamer is shown in Table 6.

[0223] Table 6

[0224] aptamers F R S-1 TTTTTAACACGACACTGCT(SEQ ID No.62) CATGGCACGACCTGC(SEQ ID No. 63) S-2 TTTTTAACACGACCAACGT(SEQ ID No.64) CATGGGCCCACGCTG(SEQ ID No. 65)

[0225] 2.7 PCR reaction steps

[0226] Prepare the PCR reaction system according to Table 7, and then place it in an ABI Stepone Plus real-time PCR instrument for the reaction. Perform the PCR reaction according to Table 8.

[0227] Table 7

[0228]

[0229] Table 8

[0230]

[0231] Calculate the Kd value using the following formula:

[0232] Kd(i0-a0 B)=(C0-C i ) / C i

[0233] B = (C0 - C) i ) / C0

[0234] X = (i0 - a0B)

[0235] Y = (C0 - C i ) / C i

[0236] i0 = initial protein concentration, C0 = a0 = initial aptamer concentration, C i Aptamer concentrations in each group

[0237] Kd = Y / X

[0238] The slope of the X and Y functions is the Kd value.

[0239] K d The lower the value, the higher the affinity.

[0240] Figure 4 This is an amplification curve showing the affinity between the nucleic acid aptamer and the PLAC1 protein in this embodiment.

[0241] from Figure 4 The dissociation constants of nucleic acid aptamers DT-8 and DT-25 binding to PLAC1 protein were 2.23±0.91 nmol and 3.29±0.98 nmol, respectively, indicating that the nucleic acid aptamers have a high affinity for PLAC1 protein.

[0242] The next experiment will take the nucleic acid aptamer DT-8, which has a low dissociation constant, as an example to conduct a study on the specificity of nucleic acid aptamers with tissues.

[0243] Example 3: Specificity study of nucleic acid aptamers and tissues

[0244] In this embodiment, the nucleic acid aptamers screened in Example 1 and commercially available PLAC1 antibodies were used to stain different tissue sections to observe the specificity of the nucleic acid aptamers with the tissues. This included the following:

[0245] 3.1 Acquisition of the organization

[0246] The tissues include: mouse chorionic villus tissue, human chorionic carcinoma tissue, human chorionic villus tissue, ovary, testis, colon, brain, lung, spleen, liver, myocardium, kidney, and stomach.

[0247] The ovaries, testes, colon, brain, lungs, spleen, liver, myocardium, kidneys, and stomach were commercially available tissue sections purchased from a commercial company.

[0248] The chorionic villi and choriocarcinoma tissues were commercially available tissue sections purchased from commercial companies.

[0249] Mouse villus tissue was obtained from laboratory mice.

[0250] Various tissues are prepared into paraffin sections using existing technologies.

[0251] 3.2 Obtaining FAM-labeled nucleic acid aptamers

[0252] 1) Synthesis of nucleic acid aptamer DT-8

[0253] The nucleic acid aptamer DT-8 was synthesized using a DNA synthesis instrument. The sequence of nucleic acid aptamer DT-8 is CACGACACTGCTGTGGTCAGCACAGTCTGGGCAGGTCGTG (SEQ ID No. 3).

[0254] 2) FAM-labeled nucleic acid aptamers (DT-8-FAM)

[0255] The 5' end of the nucleic acid aptamer DT-8 is labeled with the fluorescent molecule FAM. The FAM-labeled nucleic acid aptamer (abbreviated as DT-8-FAM) is used to double-stain the tissue sections obtained in step 2.1 of this embodiment with PLAC1 antibody.

[0256] The PLAC1 antibody was purchased from Abcam, product number ab117528.

[0257] 3.3 Staining

[0258] The staining steps are as follows:

[0259] 1) Place various tissue slices in an oven at 62℃ for 120 minutes, or at 70℃ for 60 minutes.

[0260] 2) After baking, place the slices in xylene III (wax melting) for 5 min, xylene II for 5 min, xylene I for 5 min, anhydrous ethanol for 5 min, 90% ethanol for 5 min, 80% ethanol for 5 min, and 70% ethanol for 5 min. Rinse 3 times with tap water.

[0261] 3) After boiling the citric acid repair solution (pH 6.0) in a rice cooker, place the glass slide in the solution for 18 minutes, let it cool naturally to room temperature (about 30 minutes), and rinse it three times with tap water.

[0262] 4) Wash with PBS 3 times for 5 minutes each time, remove excess PBS, circle the tissue with an immunohistochemical pen, add 0.25% Triton X-100, and incubate at room temperature for 10 minutes. Wash with PBS three times, 5 minutes each time.

[0263] 5) Block with serum or BSA for 30-60 minutes.

[0264] 6) After removing the blocking solution, add 100 μL of binding buffer (20% fetal bovine serum, 1 mM fish sperm DNA, diluted with PBS) to each tablet and incubate at room temperature for 1 h.

[0265] 7) Wash twice with binding buffer, and add 100 μL of 1 μM randomized sequence (diluted with PBS) to each tablet.

[0266] 8) Directly add approximately 50-100 μL of the primary antibody and nucleic acid probe mixture to each slide (dilute the antibody and nucleic acid probe appropriately with 2% BSA according to their characteristics; dilute the nucleic acid probe and primary antibody together, with a final dilution ratio of 1:200 for primary antibody and 1:50 for nucleic acid probe). Add PBS to the blank control group and incubate in a dark box (overnight at 4°C or 1 hour at 37°C).

[0267] 9) The next day, place the dark box at room temperature and gently shake it for 1.5 hours to rewarm it. Recover the primary antibody.

[0268] 10) Wash three times with PBS for a total of 10 min, shaking gently. Dilute Rabbit fluorescent secondary antibody 1:600 ​​with 2% BSA, add 10 μL of secondary antibody to each slide, place in a dark box, and shake gently at room temperature for 1 h. Recover the secondary antibody.

[0269] 11) Wash three times with PBS for a total of 10 minutes, shaking slowly.

[0270] 12) DAPI staining: Add 100 μL of 1×DAPI to each slide and incubate at room temperature in the dark for two minutes. (Dilute 1000×DAPI with PBS to 1×) Recover DAPI.

[0271] 13) Wash three times quickly with PBS.

[0272] 14) Mounting: Place a small drop of anti-quenching agent in the center of the slide. Use tweezers to remove the slide and invert it onto the anti-quenching agent. The anti-quenching agent will slowly spread across the entire slide. Carefully apply a drop of nail polish to the edge of the slide. Label the slide and observe and photograph it under a microscope. If you are not going to photograph it immediately, you can place it in a special orange box and store it in a refrigerator at 4°C.

[0273] After staining, the binding of DT-8-FAM to mouse villus tissue, human choriocarcinoma tissue, human villus tissue, ovary, testis, colon, brain, lung, spleen, liver, myocardium, kidney, and stomach was observed using a laser confocal microscope.

[0274] Figure 5 The images shown are laser confocal microscope images of human lung tissue, human spleen tissue, human liver tissue, human myocardial tissue, human kidney tissue, and human stomach tissue stained with FAM-labeled nucleic acid aptamers and PLAC1 antibody in this embodiment.

[0275] Figure 6 The images shown are laser confocal microscope images of human chorionic villus tissue, human chorionic carcinoma tissue, mouse chorionic villus tissue, human ovarian tissue, human testicular tissue, human colon tissue, and human brain tissue after staining with FAM-labeled nucleic acid aptamers and PLAC1 antibody in this embodiment.

[0276] from Figure 5 and 6 As shown in the figure, the nucleic acid aptamer can specifically bind to human chorionic villus tissue and has the ability to recognize human chorionic carcinoma tissue and mouse chorionic villus tissue. However, it does not specifically bind to other major human organs and tissues such as ovary, testis, colon, brain, lung, spleen, liver, myocardium, kidney, and stomach. This suggests that the nucleic acid aptamer obtained by this invention has good tissue specificity and can specifically bind to chorionic carcinoma tissue and chorionic villus tissue.

[0277] Figure 7 This is a laser confocal microscope image (400x) of a human chorionic villus tissue section after co-staining with FAM-labeled nucleic acid aptamers and PLAC1 antibody in this embodiment.

[0278] As shown in Figure 7, the binding sites of the nucleic acid aptamer and the PLAC1 antibody overlap, indicating that the nucleic acid aptamer specifically binds to the PLAC1 protein, enabling the imaging of human trophoblast cells.

[0279] In summary, the nucleic acid aptamers obtained by this invention have good specificity for human or mouse tissues expressing PLAC1 protein.

[0280] This invention employs X-aptamer screening technology, combined with high-throughput sequencing and bioinformatics analysis, to obtain nucleic acid aptamers that specifically recognize placental-specific protein 1. Analysis of the affinity of the nucleic acid aptamers of this invention for PLAC1 protein and their tissue specificity reveals that the nucleic acid aptamers of this invention possess advantages such as high affinity and specificity, and good stability. Furthermore, the nucleic acid aptamers of this invention are convenient to synthesize and easily labeled with functional groups, enabling them to specifically recognize and bind to placental-specific protein 1, and can be used for the detection of placental-specific protein 1 and the preparation of biosensors. Simultaneously, the nucleic acid aptamers of this invention also contain potential therapeutic agents for placental-specific protein 1-related diseases, and can be used to prepare reagents for clinical diagnosis or drugs for disease treatment.

[0281] This invention provides a highly specific nucleic acid aptamer for the detection of placental-specific protein 1, which can be screened in vitro, obtained in high throughput, has a short screening cycle, is easy to synthesize, exhibits good stability, high affinity, and is easy to modify and label. Furthermore, the nucleic acid aptamer of this invention can be used alone or with related drugs, showing promise for the treatment of diseases involving placental-specific protein 1.

[0282] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A nucleic acid aptamer that specifically recognizes placenta-specific protein 1, characterized in that, The nucleic acid aptamer is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID No. 3 or SEQ ID No.

9.

2. The nucleic acid aptamer as described in claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer is modified, and the modified nucleic acid aptamer specifically recognizes placental-specific protein 1. The modification is selected from at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization. And / or, the nucleotide sequence of the nucleic acid aptamer is linked to a signal molecule and / or an active molecule and / or a functional group, and the linked nucleic acid aptamer specifically recognizes placental-specific protein 1; And / or, the placenta-specific protein 1 is derived from humans or mice.

3. Use of the nucleic acid aptamer as described in claim 1 or 2 in at least one of B1)-B3): B1) Use in the preparation of products for binding placental-specific protein 1 in vitro for non-disease diagnostic and therapeutic purposes; B2) Use in the preparation of products for the in vitro detection of placental-specific protein 1 for non-disease diagnostic and therapeutic purposes; B3) Use in the purification of placental-specific protein 1.

4. A probe, characterized in that, The probe is a substance obtained by labeling a nucleic acid aptamer as described in claim 1 or 2.

5. The probe as described in claim 4, characterized in that, The markers are selected from signaling molecules and / or functional groups.

6. A product for binding to or detecting placenta-specific protein 1, characterized in that, The product includes the nucleic acid aptamer as described in claim 1 or 2, and the product is selected from reagent kits and sensors.

7. A drug delivery system specifically targeting placental-specific protein 1, characterized in that, The drug delivery system includes the nucleic acid aptamer as described in claim 1 or 2.

8. A medicament for the prevention, improvement, or treatment of placental-specific protein 1-related diseases, characterized in that, The drug contains the nucleic acid aptamer as described in claim 1 or 2.

9. A method for detecting placental-specific protein 1 in vitro for purposes other than disease diagnosis and treatment, characterized in that, The method includes labeling a signal molecule onto a nucleic acid aptamer as described in claim 1 or 2, causing the nucleic acid aptamer labeled with the signal molecule to interact with the sample to be tested, and detecting placental-specific protein 1 by detecting the signal of the signal molecule.

Images