Bacillus zonalis phage and uses thereof

By providing the CSP1 bacteriophage for Corynebacterium striatum, the treatment challenge of multidrug-resistant Corynebacterium striatum infection has been solved, enabling effective lysis of multidrug-resistant bacteria and laying the foundation for medical research.

CN117210413BActive Publication Date: 2026-04-21HUBEI UNIV OF ARTS & SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311000395.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-04
Publication Date
2026-04-21
Estimated Expiration
2043-08-04

AI Technical Summary

Technical Problem

Currently, there are no guidelines for the effective treatment of multidrug-resistant Corynebacterium striatum infection. Existing antibiotic treatments are limited, and Corynebacterium striatum is highly variable and adaptable, easily causing hospital-acquired pneumonia with high mortality rates due to nosocomial transmission.

Method used

A bacteriophage CSP1 for Corynebacterium striatum, with accession number CGMCC NO:45598, is provided. It can lyse multidrug-resistant Corynebacterium striatum, has strong tolerance and biosafety, and carries site-specific recombinant functional elements for medical research and treatment.

Benefits of technology

This bacteriophage was able to effectively lyse 20 strains of multidrug-resistant Corynebacterium banding, laying the foundation for subsequent medical research and treatment and providing new therapeutic methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117210413B_ABST
    Figure CN117210413B_ABST
Patent Text Reader

Abstract

The application discloses a corynebacterium striatum phage and application thereof. The corynebacterium striatum phage is a corynebacterium striatum phage CSP1, the preservation number of which is CGMCC NO: 45598, and the preservation time is July 4, 2023. The corynebacterium striatum phage has strong tolerance, biological safety and carries site-specific recombination functional elements (integrase and recombination sites). Meanwhile, the corynebacterium striatum phage can lyse 20 strains of multi-drug resistant corynebacterium striatum, and lays a foundation for subsequent medical researches using the corynebacterium striatum phage as a test and treatment carrier, a targeted pathogenic bacterium or symbiotic bacterium, and an immune regulator inducer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a banded rod-shaped bacteriophage and its applications. Background Technology

[0002] The widespread use of antibiotics exacerbates the spread and evolution of multidrug-resistant bacteria, expanding the types and strength of drug resistance and potentially leading to the emergence of "superbugs," rendering existing antibiotic treatments ineffective. Corynebacterium zoster infection typically affects immunocompromised individuals (long-term bedridden patients, intubated patients), as antibiotics cannot completely cure chronic infections or eradicate the pathogen.

[0003] Currently, there are no guidelines for treating multidrug-resistant Corynebacterium striatum infection. The optimal antimicrobial therapy remains controversial. Corynebacterium striatum is highly variable and adaptable, spreading between patients through contact with healthcare workers or the hospital environment. It readily develops multidrug resistance, leading to nosocomial transmission and outbreaks. This bacterium is a leading cause of severe hospital-acquired pneumonia (HAP), with a high mortality rate. It is commonly found in sputum and secretion samples and is distributed in departments such as critical care medicine, neurology, neurosurgery, orthopedics, nephrology, and intensive care units. The peak infection period is in summer, and diagnosis is primarily associated with immunocompromised individuals.

[0004] Corynebacterium striatum has developed high resistance to lincosamides, quinolones, tetracyclines, aminoglycosides, macrolides, and trimethoprim-sulfamethoxazole in clinical antibiotic treatment. Currently, vancomycin is the first-line antibiotic for treating Corynebacterium striatum infections, used as monotherapy or in combination with piperacillin-tazobactam. Alternatively, linezolid, teicoplanin, or daptomycin can be used for severe infections, while amoxicillin-clavulanic acid can be used to treat mild infections caused by Corynebacterium striatum. Based on resistance projections, vancomycin is likely to remain the only currently effective drug by 2030. Summary of the Invention

[0005] The main objective of this invention is to propose a bacteriophage for Corynebacterium striatum and its application, thereby addressing the current lack of guidelines for treating multidrug-resistant Corynebacterium striatum infections.

[0006] To achieve the above objectives, this invention proposes a *Corynebacterium bandingense* phage, wherein the *Corynebacterium bandingense* phage is *Corynebacterium bandingense* phage (… Corynebacterium striatum Phage CSP1, with accession number CGMCC NO:45598, was deposited on July 4, 2023, at the China General Microbiological Culture Collection Center, located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0007] Optionally, the DNA genome sequence of the Corynebacterium bandingense phage strain is shown in SEQ ID NO. 1, which is formed by combining SEQ ID NO. 1'-8'.

[0008] Optionally, the *Corynebacterium bandingense* phage strain can be stably active in a sodium chloride solution containing physiological concentrations.

[0009] Optionally, the *Corynebacterium bandingense* phage strain is stable and active in solutions with a pH of 4-12.

[0010] Optionally, the *Corynebacterium bandingense* phage strain includes a head and a tail, wherein the head is an icosahedral head.

[0011] Optionally, the diameter of the head is 48-52 nm, and the length of the tail is 240-250 nm.

[0012] Optionally, the DNA of the *Corynebacterium bandingense* phage strain is double-stranded circular.

[0013] Optionally, the genome of the *Corynebacterium bandingense* phage belongs to the HK97 type.

[0014] Optionally, the genome of the *Corynebacterium bandingense* phage encodes a tyrosine-type integrase and contains a 20 bp recombination core site.

[0015] This invention proposes the application of the aforementioned Corynebacterium banding phage in the lysis of drug-resistant Corynebacterium banding.

[0016] The technical solution provided by this invention involves enriching, purifying, and isolating a type of *Corynebacterium bandingense* bacteriophage from hospital environments, such as toilet puddles and sewers. Corynebacterium striatum The *Corynebacterium strumarium* phage (CSP1) exhibits strong tolerance, biosafety, and carries site-specific recombination functional elements (integrase and recombination site). It can also lyse 20 multidrug-resistant *Corynebacterium strumarium* strains, laying the foundation for subsequent medical research using this phage as a diagnostic and therapeutic vector, targeting pathogenic or symbiotic bacteria, and inducing immune regulation. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a diagram of 20 clinical Corynebacterium leuciscus isolates lysed by phage strain CSP1 in Example 2 of the present invention;

[0019] Figure 2 This is a diagram showing the state of bacteriophage strain CSP1 under different multiplicity of infection in Example 3 of the present invention;

[0020] Figure 3 This is a one-step growth curve of the bacteriophage strain CSP1 in Example 4 of the present invention;

[0021] Figure 4 This is a morphological image of bacteriophage strain CSP1 under a transmission electron microscope (TEM) in Example 5 of the present invention;

[0022] Figure 5 This is a gene restriction enzyme digestion identification diagram of the bacteriophage strain CSP1 in Example 6 of the present invention;

[0023] Figure 6 This is a genome arrangement diagram of the bacteriophage strain CSP1 in Example 6 of the present invention;

[0024] Figure 7 This is an evolutionary analysis diagram of the bacteriophage strain CSP1 in Example 6 of the present invention;

[0025] Figure 8 The mass spectrometry TIC pattern of phage strain CSP1 in Example 6 of this invention;

[0026] Figure 9 These are images showing the state of bacteriophage strain CSP1 under ultraviolet irradiation at different times in Example 7 of this invention;

[0027] Figure 10 This is a diagram showing the state of bacteriophage strain CSP1 under different pH conditions in Example 8 of the present invention;

[0028] Figure 11 This is a schematic diagram illustrating the sensitivity of bacteriophage strain CSP1 to sodium chloride and disinfectant in Example 9 of the present invention;

[0029] Figure 12 This is a diagram showing the state of bacteriophage strain CSP1 at different temperatures in Example 10 of the present invention;

[0030] Figure 13 This is a cell viability graph of phage strains CSP1 with different titers and HEK293T (human embryonic kidney 293T cells) after 24 hours of incubation and culture in Example 11 of the present invention.

[0031] Figure 14 This is a cell viability graph of phage strains CSP1 with different titers and HEK293T cells after 12 hours of incubation in Example 11 of this invention.

[0032] Figure 15 This is a cell viability graph of phage strains CSP1 and A549 (human lung adenocarcinoma cell line) with different titers after 24 hours of incubation in Example 11 of the present invention.

[0033] Figure 16 This is a cell viability graph of phage strains CSP1 with different titers and A549 cells after 12 hours of incubation in Example 11 of the present invention. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0035] The widespread use of antibiotics exacerbates the spread and evolution of multidrug-resistant bacteria, expanding the types and strength of drug resistance and potentially leading to the emergence of "superbugs," rendering existing antibiotic treatments ineffective. Corynebacterium striatum infection typically affects immunocompromised individuals (long-term bedridden patients, intubated patients), and antibiotics cannot completely cure chronic infections or eradicate the pathogen. Currently, there are no guidelines for treating multidrug-resistant Corynebacterium striatum infection. The optimal antimicrobial therapy remains controversial. Corynebacterium striatum exhibits strong variability and adaptability, spreading between patients through contact with healthcare workers or the hospital environment. It readily develops multidrug resistance, potentially causing nosocomial transmission and outbreaks. This bacterium is a leading cause of severe hospital-acquired pneumonia (HAP), with a high mortality rate. It is commonly found in sputum and secretion samples and is distributed across departments such as critical care medicine, neurology, neurosurgery, orthopedics, nephrology, and intensive care units. The peak infection period is in summer, and diagnosis is primarily associated with immunocompromised individuals. Corynebacterium striatum has developed high resistance to lincosamides, quinolones, tetracyclines, aminoglycosides, macrolides, and trimethoprim-sulfamethoxazole in clinical antibiotic treatment. Currently, vancomycin is the first-line antibiotic for treating Corynebacterium striatum infections, used as monotherapy or in combination with piperacillin-tazobactam. Alternatively, linezolid, teicoplanin, or daptomycin can be used for severe infections, while amoxicillin-clavulanic acid can be used to treat mild infections caused by Corynebacterium striatum. Based on resistance projections, vancomycin is likely to remain the only currently effective drug by 2030.

[0036] In view of this, the present invention proposes a *Corynebacterium spp.* phage, which has been deposited at the China General Microbiological Culture Collection Center, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, classified as *Corynebacterium spp.* phage. Corynebacterium striatum Phage (CSP1), accession number CGMCC NO:45598, was deposited on July 4, 2023, at the China General Microbiological Culture Collection Center, located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0037] The technical solution provided by this invention involves enriching, purifying, and isolating a type of *Corynebacterium bandingense* bacteriophage from hospital environments, such as toilet puddles and sewers. Corynebacterium striatum phage ) CSP1 (hereinafter referred to as phage strain CSP1). This Corynebacterium spp. phage exhibits strong tolerance, biosafety, and carries site-specific recombinant functional elements (integrase and recombinant sites). It can also lyse 20 multidrug-resistant Corynebacterium spp. strains, laying the foundation for subsequent medical research using this Corynebacterium spp. phage as a diagnostic and therapeutic vector, targeting pathogenic or symbiotic bacteria, and inducing immune regulation.

[0038] like Figure 1 As shown, the 20 multidrug-resistant Corynebacterium tumefaciens strains that the phage strain CSP1 can lyse are Cs-1, Cs-2, Cs-3, Cs-6, Cs-7, Cs-9, Cs-16, Cs-18, Cs-22, Cs-25, Cs-31, Cs-35, Cs-38, Cs-39, Cs-41, Cs-10, Cs-11, Cs-14, Cs-52, and Cs-54.

[0039] The gene sequence of the *Corynebacterium bandingense* phage is shown in SEQ ID NO. 1. SEQ ID NO. 1 is formed by combining SEQ ID NO. 1'-8' (SEQ ID NO. 1 was split into multiple gene sequences because the gene sequence was too long to upload, and splitting it into multiple sequences made it easier to upload, but the complete gene sequence is as follows):

[0040]

[0041] The genome sequence (SEQ ID NO. 1) of the bacteriophage strain CSP1 was analyzed by BLAST (BLASTn) in the NCBI database. The results showed that bacteriophage CSP1 was similar to strain 216 of Corynebacterium striatum (…). Corynebacterium striatum strain 216 showed the highest sequence similarity, with a coverage of 82% and a sequence identity of 95.31%. This was followed by the temperate phage IME1320_01, with a sequence coverage of 41% and a sequence identity of 92.16%.

[0042] In the technical solution of the present invention, the *Corynebacterium spp.* bacteriophage is active in a solution containing sodium chloride. Compared with a solution containing the disinfectant glutaraldehyde, the activity is more stable in a culture medium containing sodium chloride. Preferably, when the concentration of sodium chloride is 0.9%, that is, at the concentration of human physiological saline, the bacteriophage strain CSP1 maintains a stable titer.

[0043] Furthermore, the *Corynebacterium bandingense* phage strain is active and stable in a culture medium with a pH of 4-12. When the pH value is 4 or 12, the titer of the phage strain CSP1 decreases by approximately one order of magnitude.

[0044] like Figure 4 As shown, the *Corynebacterium bandingense* phage strain includes a head and a tail. The head is an icosahedral head, and further, the diameter of the head is 48-52 nm, and the length of the tail is 240-250 nm.

[0045] like Figure 5 As shown, the phage strain CSP1 is a circular double-stranded DNA. Further sequencing and sequence analysis confirmed that the circular double-stranded DNA of phage strain CSP1 is of the HK97 type. Phage strain CSP1 belongs to the HK97 type, a system highly suitable for studying chitin assembly. Expression of HK97 phylum proteins, proteases, and major capsid protein genes in its natural host leads to the abundant production of assembly shells at different assembly stages. Currently, some researchers have proposed that phages form three polymorphic evolutionary lineages (PRD1-like, HK97-like, and BTV-like), among which tailed phages belong to the HK97-like type.

[0046] like Figure 6 As shown, the genome of the phage strain CSP1 encodes tyrosine-type recombinases / integrase, and contains a 20 bp recombination site. Attachment site, att :TGGGCGAATGAGCCGGCCTA).

[0047] This invention provides an application of the aforementioned Corynebacterium banding phage in lysing drug-resistant Corynebacterium banding.

[0048] The described *Corynebacterium bandingense* phage possesses all the beneficial effects of the *Corynebacterium bandingense* phage, which will not be elaborated here.

[0049] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0050] Experimental materials

[0051] The samples of the bacteriophage strain CSP1 were initially collected from puddles in the sewers and toilets of Xiangyang Central Hospital in Hubei Province.

[0052] Semi-solid LB: 10 g / L Tryptone, 5 g / L Yeast extract, 5 g / L NaCl, 7 g / L Agar.

[0053] 200μL SM Buffer: pH7.5, 200mM NaCl, 10mM MgSO4, 50mM Tris-HCl.

[0054] Example 1: Isolation, purification, and concentration of bacteriophage strain CSP1

[0055] The samples of the bacteriophage strain CSP1 described in this invention were initially collected from puddles in the sewers and toilets of Xiangyang Central Hospital in Hubei Province. A total of 8 samples were collected, including both liquid and solid (sludge) samples. For the liquid samples, they were first centrifuged at low speed at 4°C and then filtered through a 0.22 μm filter to obtain the supernatant. For the solid (sludge) samples, sterile PBS solution was added, stirred and mixed for 1 hour, and then centrifuged. The processing procedure was the same as for the liquid samples to obtain the supernatant.

[0056] Phage enrichment: Take 20 mL of supernatant from each sample and add it to 100 mL of logarithmic mixed clinical Corynebacterium tumefaciens culture. Incubate at 37℃ and 200 r / min for 10 h with shaking. Centrifuge at 12000 r / min for 5 min to collect the supernatant and filter. Repeat 3 times to complete the enrichment of phage samples in the environment.

[0057] Phage screening: 50 μL of host bacteria (Cs-11) was mixed with 4 mL of semi-solid culture medium and poured into double-layer plates. After solidification, 2-3 μL of the filtrate from each of the eight enriched samples was spotted onto the double-layer plates and incubated overnight at 30°C. The next day, the presence of phage plaques was observed.

[0058] Phage isolation: Using a sterile toothpick, collect individual, clear phage plaques from a double-layer plate into 1 mL of sterile liquid culture medium. After vortexing to mix thoroughly, perform 10-fold serial dilutions to 10⁻⁶. -6 Take 100 μL of the stock solution and each graded dilution, mix with 50 μL of host bacteria, pour into double-layer plates, and incubate overnight at 37°C. Observe the phage plaques on the double-layer plates. Repeat this step at least 3 times until the phage plaques on the same double-layer plate have a basically consistent appearance and size.

[0059] Phage concentration: Ultrafiltration or PEG concentration methods can be used.

[0060] The steps for ultrafiltration concentration are as follows: Transfer 20 mL of the phage filtrate to a 50 mL ultrafiltration centrifuge tube (15 mL, 10 kDa, Millipore UFC901096), and centrifuge at 3000 rpm for 20 min. When only 1500 μL remains in the concentrated ultrafiltration tube, add more phage solution to be concentrated. Repeat centrifugation; the concentration can be approximately 30 times the volume. Remove the final phage concentrate from the ultrafiltration tube, handling it on ice. Use a yellow pipette tip (200 μL) to gently insert the tip along the edge and gently pipette to mix the phage solution. Be careful not to touch the ultrafiltration membrane when aspirating the concentrate. Use a 10 μL pipette tip to aspirate the small amount of concentrate remaining at the bottom of the tube; discard any remaining residue.

[0061] The steps for the PEG concentration method are as follows: Transfer 20 mL of the phage filtrate to a sterile centrifuge tube and allow it to reach room temperature. Add NaCl to a final concentration of 1 M, dissolve the mixture, and place it on ice for 1 hour. Centrifuge at 11,000 rpm for 15 minutes at 4°C. Then collect the supernatant in a clean centrifuge tube and add PEG 8000 (final concentration 10% (w / v)). Slowly stir with a magnetic stir bead until the PEG 8000 dissolves slowly (stir on ice for 1 hour or overnight at 4°C). Centrifuge the treated mixture at 11,000 rpm for 2 hours at 4°C, and recover the precipitate containing phage particles (discard the supernatant immediately after centrifugation, invert the tube onto a thick sheet of tissue paper, and circle the areas with precipitate particles with a marker). Add 200 μL of SM Buffer (200 mM NaCl, 10 mM MgSO4, 50 mM Tris-HCl, pH 7.5) to submerge the precipitate and place it on ice overnight (if there is little precipitate, add 100 μL of SM Buffer; if there is a lot of precipitate, increase to 500 μL). The next day, resuspend and mix by pipetting to obtain the concentrated phage solution (phage strain CSP1 solution).

[0062] Example 2: Detection of host spectrum of bacteriophage strain CSP1 by dilution spotting method

[0063] 1. Dispensing bacterial suspensions: Pipette 50 μL of each of the 52 activated Cs (multidrug-resistant Corynebacterium spp.) bacterial suspensions into 10 mL EP tubes, and dispense 3 tubes of each strain (i.e., 3 parallel runs).

[0064] 2. Preparation of the upper semi-solid LB and bacterial mixture for the spotting plate: Add 5 mL of semi-solid LB culture medium to the 10 mL EP tube containing the bacterial solution, and immediately pour the mixture onto the solid LB bottom plate and spread it evenly;

[0065] 3. CSP1 phage supernatant plating: Dilute the CSP1 phage supernatant to different gradients (i.e., 100~100). -4 ), respectively, 2 μL of the original solution and dilution of bacteriophage strain CSP1 were spotted onto double-layer plates of different Cs strains.

[0066] 4. Observe the dilution plate results: Observe the plaque formation on the double-layer plate of the Cs strain to be tested, such as... Figure 1 As shown.

[0067] Example 3 Determination of the optimal multiple of infection (MOI) of bacteriophage strain CSP1

[0068] Activation and transfer of strains: Pipette 50 μL of different Cs bacterial cultures into 5 mL LB liquid test tubes and incubate at 37°C in a shaker until mid-log (OD2). 600 nm: 0.8~1.0), then transfer 50μL to a 5mL liquid LB tube, and measure the OD of the bacterial culture after 3 hours. 600 nm value (i.e., taking 1 mL of the above bacterial solution and adding it to a cuvette to measure the OD value of the bacterial solution). 600 (nm value). OD was calculated based on the growth curve of strain Cs. 600 The number of bacteria at the nm value.

[0069] Different ratios of CSP1 phage strain and bacterial suspension were mixed: MOI ratios of 0.001, 0.01, 0.1, 1, 10, and 100 were set based on the titer of CSP1 phage strain and the number of bacteria in the bacterial suspension. A mixture of 1 mL of CSP1 phage strain and 1 mL of bacterial suspension was inoculated into 100 mL of fresh LB broth and incubated at 37°C for 8 hours. The titer of CSP1 phage strain was then measured. The formula for calculating the titer of CSP1 phage strain is: Titer of CSP1 = Number of CSP1 plaques on the double-layer plate. Dilution concentration 10. The optimal MOI (Multiple of Infection) is determined by measuring the titer of the CSP1 phage strain. For example, the MOI at which the CSP1 release is highest is calculated. Figure 2 As shown.

[0070] The method for determining phage titer is as follows: CSP1 used for titer determination needs to be sterilized by filtration through a 0.22 μm filter. First, prepare a solid LB plate. Add 100 μL of CSP1 supernatant of different dilution gradients and 50 μL of bacterial suspension to a 4.5 mL EP tube and mix well. Then add 4 mL of semi-solid LB medium (temperature 50-55℃) and pour the mixture into the prepared solid LB plate, spreading it evenly. After the medium solidifies, transfer it to a 37℃ incubator and incubate for 12 h. The titer (pfu / mL) of the phage strain CSP1 is characterized by observing and counting the number of phage plaques on the double-layer plate.

[0071] The Multiplicity of Infection (MOI) refers to the ratio between the number of viral particles present in a given cell and the number of cells under experimental conditions of viral infection. It is commonly used to describe the degree and efficiency of infection in viral experiments. For example, if 100 viral particles are added to a culture dish containing 100 cells, the MOI is 1, meaning that each cell is infected with an average of 1 viral particle.

[0072] Example 4: Determination of the one-step growth curve of bacteriophage strain CSP1

[0073] Based on the optimal MOI of phage strain CSP1, we investigated the timing of the burst point during the amplification process of CSP1.

[0074] Bacteriophage strain CSP1 adsorbed bacteria: CSP1 and Cs-11 bacterial suspensions were added to liquid LB at the optimal MOI ratio (MOI of 0.1), incubated at 37°C for 30 min, centrifuged at 13000 rpm for 20 min in a high-speed centrifuge tube, and the supernatant was discarded to remove unadsorbed phage strain CSP1.

[0075] Washing and resuspending the bacterial precipitate: Wash the precipitate twice with fresh LB liquid, then resuspend the precipitate in fresh LB liquid by pipetting and continue culturing in a shaker at 37°C.

[0076] Sampling and titer determination: Take 1 mL samples of the resuspended culture every 10 minutes for titer determination, for a total of 100 min, i.e., 11 samples (with the sample taken before incubation after resuspending as time 0). After centrifuging at 13000 rpm for 5 min, filter using a 0.22 μL filter. To determine the titer of phage strain CSP1, a dilution gradient of 10 for phage strain CSP1 can be set as follows. 0 -10 -6 After incubating at 37℃ for 12 hours, the number of phage plaques on double-layer plates was observed to determine the outbreak period of phage strain CSP1. The results are as follows: Figure 3 As shown.

[0077] The method for determining the titer of the bacteriophage strain CSP1 is similar to that in Example 3.

[0078] Example 5 Morphological observation of bacteriophage strain CSP1

[0079] Take 10 μL of concentrated PEG phage strain CSP1 and drop it onto a clean plastic wrap. Place a 300-mesh carbon-coated nickel grid on the droplet. After 2 minutes, remove the nickel grid and blot off excess liquid from the side with filter paper. Take 10 μL of 2% phosphotungstic acid and drop it onto a sealing film. Place the nickel grid with CSP1 on the phosphotungstic acid droplet and remove it after 1 minute. Blot off excess dye from the side with filter paper again. Let the nickel grid air dry on the filter paper, face up, at room temperature for 15-20 minutes. Observe the morphology of phage strain CSP1 using a transmission electron microscope with 80KV microscope software and take pictures. Figure 4 As shown.

[0080] Example 6: Genome extraction and identification of bacteriophage strain CSP1

[0081] Genomic extraction of CSP1 phage strain: The EasyPure Viral DNA / RNA Kit (Code # ER201-01) was used. 200 μL of concentrated CSP1 phage sample (titer reaching 10) was extracted. 10 The above, ideally reaching 10. 14Add 0.8 μL DNase, 2 μL RNase, and 4 μL DNase buffer to the solution and digest for 4 h. Incubate at 37°C using a PCR instrument. Transfer 20 μL Proteinase K to a sterile 1.5 mL centrifuge tube, add 200 μL BB5, vortex and centrifuge for 15 seconds. Add 200 μL of the previously digested phage strain CSP1 to the centrifuge tube, vortex and centrifuge for 15 seconds, and incubate at 56°C for 15 minutes. After cooling to room temperature, add 250 μL of anhydrous ethanol (flocculation may occur at this point), vortex and centrifuge for 15 seconds, incubate at room temperature for 5 minutes, and then add the solution and precipitate together to a centrifuge column. Centrifuge at 12000 rpm for 1 minute and discard the eluent. (If the total solution volume is >650μL, it can be divided into two loadings). Add 500μL of WB5 to the centrifuge column, centrifuge at 12000rpm for 1 minute, discard the effluent, and repeat the previous step once (add 500μL of WB5 to the centrifuge column again, centrifuge at 12000rpm for 1 minute, discard the effluent). Centrifuge at 12000rpm for 1 minute at room temperature to completely remove residual ethanol. Open the cap and let it air dry for 2 minutes. Transfer the centrifuge column to a new 1.5 mL RNase-free centrifuge tube, add 35μL of RNase-free water to the center of the centrifuge column, let it stand at room temperature for 2-5 minutes, and then centrifuge at 12000rpm for 2 minutes at room temperature to elute the DNA.

[0082] Genomic DNA extracted and analyzed: Prepare a 0.7% agarose gel for gel loading. Load 5 μL of phage strain CSP1 genomic DNA + 2 μL of 5× Loading Buffer, and 5 μL of 15K marker as an indicator. Run the gel at 110V for 45 min. Scan the gel and save the image after running. Store the phage strain CSP1 genomic DNA at -20℃ or -70℃.

[0083] Nucleic acid type identification: Take 8 μL of phage strain CSP1 genome, and add 0.5 μL to different 20 μL enzyme digestion systems. DNaseI 0.5μL RNase A 0.2 μL (0.1 μg / μL) mung bean nuclease, 0.5 μL Exonuclease III ( Exo III Except for the mung bean nuclease system, which was digested at 30℃ for 30 minutes, all other enzymes were digested in a water bath at 37℃ for 1 hour. This was used to determine the genome type and structure of the bacteriophage strain CSP1 (Exonuclease III digestion of linear DNA fragments; mung bean nuclease digestion of single-stranded DNA), and the results are as follows: Figure 5 As shown.

[0084] Restriction fragment polymorphism analysis: 8 μL of the CSP1 phage genome was taken and added to different 20 μL rapid restriction endonuclease digestion systems. BamHI , EcoRI , HindIII , KpnI , XbaI , SalI , MluI , NdeI The genome of phage strain CSP1 was digested with enzymes and incubated at 37°C for 2 hours. The digestion products were analyzed by agarose gel electrophoresis, and the results are as follows: Figure 5 As shown.

[0085] Genome sequencing: The extracted CSP1 phage genome was randomly fragmented into approximately 500 bp segments. DNA fragments of the desired length were collected, and then specific adapters were selected using the NEB standard library preparation kit. Library preparation was performed, and the library fragment size was detected using Aglent 2100, while the library molar concentration was determined using qPCR. After passing the library inspection, Illumina NovaSeq was used for PE 2. 150 sequences were sequenced. This sequencing was ultra-deep NGS. Spades software was used for sequence assembly. The corrected final result was used as the standard sequence. The mapping rate of the cleaning data was calculated. The sequence is shown in SEQ ID NO. 1, which is formed by merging SEQ ID NO. 1'-8'.

[0086] Genome annotation and analysis: The corrected final sequences were annotated based on the current NCBI NR database and manually reviewed and verified against the KEGG and NCBI databases. Annotations achieved a protein full-length coverage of at least 80% and a similarity of at least 60% (ideally at least 80%). These annotations were used; otherwise, the protein was considered a hypothetical protein. Results are as follows: Figure 6 As shown. For the evolutionary analysis of the CSP1 phage genome, VCTOR online analysis was used (https: / / ggdc.dsmz.de / victor.php), and the results are as follows. Figure 7 As shown.

[0087] Proteomic analysis of bacteriophage strain CSP1:

[0088] Preparation of CSP1 protein samples: Take 500 μL of purified and concentrated CSP1 phage solution, centrifuge at 10000 rpm / min for 3 min to remove the precipitate, add 50 μL of 5×SDS loading buffer (containing DTT) to the supernatant, mix, heat at 95℃ for 10 min, and store at -20℃.

[0089] SDS-PAGE protein gel preparation: A 10% protein (separating) gel (composition shown in Table 1) was used for the mass spectrometry analysis of phage strain CSP1, with no gel buildup. After gel running, Coomassie Brilliant Blue was used for staining. 20 μL of protein sample was loaded into the wells of the separating gel (a total of 8 wells). The running voltage and time were 80 V and 40 min, respectively. After gel running, Coomassie Brilliant Blue was added for staining, followed by rinsing twice with deionized water. Protein gel fragments from the stained areas were then excised. The samples were sent to Beijing Vibio Biotechnology Co., Ltd. for mass spectrometry analysis and identification, including trypsin digestion within the gel. Analysis and identification were performed using liquid chromatography-mass spectrometry (LC-MS / MS: Dionex Ultimate 3000 RLSCnano System, MS / MS: Orvitrap Exploris 480, Thermo Scientific). An MS / MS peak list was generated using Proteome Discoverer 2.0, with a minimum signal-to-noise ratio of 1.5. All tandem spectra were retrieved from the database (phage strain CSP1 fasta file) using the X!Tandem V3.0 (GPM Furry, Craig and Beavis, 2004) search engine.

[0090] Table 1

[0091]

[0092] Example 7: Determination of the sensitivity of bacteriophage strain CSP1 to ultraviolet light

[0093] Prepare a series of sterile petri dishes. Pour 1 mL of phage strain CSP1 into each sterile petri dish (with the lid off). Place the petri dishes in a laminar flow hood (internal dimensions L). D H: 1340mm 540mm The bacteriophage strain CSP1 (545mm) was placed horizontally perpendicular to a 30W UV lamp (at the same location). The titers of the phage strain CSP1 were measured sequentially at different UV lamp irradiation times of 0, 2, 4, 6, 7, 8, 10, and 15 min (each group was repeated three times). The results are as follows: Figure 9 As shown, the method for determining potency is similar to that in Example 3.

[0094] Example 8: Determination of pH sensitivity of bacteriophage strain CSP1

[0095] Prepare culture media with different pH values: Adjust the pH of the culture media using 1M sodium hydroxide solution and hydrochloric acid solution, preparing pH values ​​ranging from 2.0 to 12.0 respectively. Dispense each pH value into 5mL test tubes (pH change was not significant after sterilization). Also dispense 5mL of unadjusted culture medium into test tubes, sterilizing them as a control group. Incubate the CSP1 phage strain in liquid culture media of different pH values: add 50μL of CSP1 phage supernatant to 5mL of liquid culture medium at different pH values ​​in test tubes, incubate at 37℃ for 1 hour, then mix with the host bacteria. Determine the titer of CSP1 phage strain by pouring double-layer plates (each group was repeated three times). Results are shown below. Figure 10 As shown, the method for determining potency is similar to that in Example 3.

[0096] Example 9: Effects of NaCl concentration and disinfectant on the titer of bacteriophage strain CSP1

[0097] The stock solution of the bacteriophage strain CSP1 to be tested was added at a ratio of 1% to 0.9% NaCl solution and 2% glutaraldehyde solution, respectively, and incubated at room temperature for 1 hour. After incubation with the treated bacteriophage strain CSP1 and its dilutions, the titer of the bacteriophage strain CSP1 was determined by pouring double-layer plates (each group was repeated three times). The results are as follows: Figure 11 As shown, the method for determining potency is similar to that in Example 3.

[0098] Example 10: Determination of the temperature sensitivity of bacteriophage strain CSP1

[0099] The CSP1 phage strain was placed in water baths at different temperatures: 1 mL of CSP1 supernatant was added to a 1.5 mL EP tube and placed in water baths at -40℃, -20℃, 4℃, 25℃, 37℃, 42℃, 55℃, and 60℃ respectively. After incubation at 37℃ for 1 hour, each group was repeated three times. The titer of the CSP1 phage strain was determined using the double-layer plate method. The titer results of the CSP1 phage strain were observed: the titer change of the CSP1 phage strain after incubation in solutions at different temperatures was calculated using the above-mentioned double-layer plate method to determine the activity of the CSP1 phage strain in solutions at different temperatures (the dilution gradient of the CSP1 phage strain was 10). -2 10-4, 10 -6 10 -8 10 -10 (The experiment was repeated three times in each group), and the results were as follows: Figure 12 As shown, the method for determining potency is similar to that in Example 3.

[0100] Example 11: Virulence assay of bacteriophage strain CSP1

[0101] The Cell Counting Kit-8 (CCK-8) (GLPBIOGK10001) was used. 100 μL of HEK293T or A549 cell suspension (5000 cells / well) was seeded into each 96-well plate, and 10 μL of the test material (different titers of phage strain CSP1) was added to each well. The initial titer of phage strain CSP1 was 3 × 10⁻⁶. 12 pfu / mL, serially diluted to 4 gradients, each gradient containing 3 x 10^9 CSP1 phage strains. 10 3x10 9 3x10 8 3x10 7 The control group consisted of 100 μL of cell suspension and 10 μL of LB broth. 96-well plates were incubated in a cell culture incubator for 12 or 24 hours, then incubated with CCK8 at 37°C for 1 hour before measuring OD. 420 (Each group was tested three times), and the results were as follows: Figure 13-16 As shown, the method for determining potency is similar to that in Example 3.

[0102] result

[0103] 1. Detection of host spectrum of bacteriophage strain CSP1 by dilution spotting method

[0104] pass Figure 1 It can be seen that the phage strain CSP1 can lyse Cs-1, Cs-2, Cs-3, Cs-6, Cs-7, Cs-9, Cs-16, Cs-18, Cs-22, Cs-25, Cs-31, Cs-35, Cs-38, Cs-39, Cs-41, Cs-10, Cs-11, Cs-14, Cs-52, and Cs-54.

[0105] 2. Determination of the optimal multiple of infection (MOI) of phage strain CSP1

[0106] like Figure 2 As shown, the optimal MOI value for the phage strain CSP1 is 0.1.

[0107] 3. Determination of the one-step growth curve of bacteriophage strain CSP1

[0108] like Figure 3 As shown, the one-step growth curve indicates that the phage strain CSP1 has a latency period of approximately 10 min, a lysis period of 30 min, and a titer of 10 when phage CSP1 is released. 9 pfu / mL.

[0109] 4. Morphological observation of bacteriophage strain CSP1

[0110] like Figure 4As shown, the phage strain CSP1 can form phage plaques with a diameter of 1-1.5 mm on a double-layer plate; under a transmission electron microscope, this phage is observed to have an icosahedral head (about 50 nm in diameter) and a slender tail (about 245 nm in length).

[0111] 5. Extraction and identification of the genome of bacteriophage strain CSP1

[0112] like Figure 5 and 6 As shown, the concentrated phage strain CSP1 genome was extracted and analyzed by enzyme digestion to reveal circular double-stranded DNA (CSP1). Figure 5 Further sequencing analysis confirmed it to be a 39752 bp double-stranded circular DNA genome, belonging to the HK97 type. It is predicted to encode 61 open reading frames (ORFs). orf ) and 1 tRNA (tRNA-Lys). The CSP1 phage genome encodes tyrosine-type recombinases / integrases, containing a 20 bp recombination site. Attachment site, att : TGGGCGAATGAGCCGGCCTA)( Figure 7 The genome sequence (SEQ ID NO. 1) of phage strain CSP1 was extracted from the NCBI database using BLAST(n). The results showed that phage strain CSP1 was similar to strain 216 of Corynebacterium striatum (…). Corynebacterium striatum strain 216 showed the highest sequence similarity, with a coverage of 82% and a sequence identity of 95.31%. The second highest was the temperate phage IME1320_01, with a sequence coverage of 41% and a sequence identity of 92.16%. Sequences of the top three species (known phages) with the highest blast similarity in NCBI were selected, and analysis using VICTOR software showed that phage strain CSP1 belongs to... Siphoviridae Longtail bacteriophages are a new species distinct from IME1320_01, such as... Figure 7 As shown. Phage proteomic analysis identified 32 plausible phage proteins, such as... Figure 8 The TIC mass spectra of the two samples are shown.

[0113] 6. Determination of susceptibility of bacteriophage strain CSP1

[0114] like Figure 9-11As shown, the titer remained stable under UV irradiation for 0-10 min and incubation at 40℃-55℃ for 1 h. After incubation for 1 h in 0.9% NaCl and 2% glutaraldehyde solutions, the titer remained stable only in sodium chloride solution, while it lost activity in 2% glutaraldehyde. The cells were stable at pH 5-11, but the titer decreased by approximately one order of magnitude at pH 4 and pH 12. Cell viability was measured using a CCK8 assay kit after incubation of different titers of phage strain CSP1 with HEK293T and A549 cells for 12 h and 24 h. Figure 12-15 As shown, this indicates that the phage strain CSP1 is non-toxic to cells.

[0115] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. A tailed Corynebacterium phage, characterized in that, The corynebacterium striatum bacteriophage is a corynebacterium striatum bacteriophage (CSP1) with a preservation number of CGMCC NO: 45598 and a preservation time of July 4, 2023. Corynebacterium striatum phage)CSP1, with a preservation number of CGMCC NO: 45598 and a preservation time of July 4, 2023.

2. Use of a phage according to claim 1 for the lysis of drug resistant C. striatum for non-therapeutic purposes.