Ds-hpago1 for preventing and controlling white grubs and application thereof
By synthesizing dsHpAGO1 and injecting it into grubs, the AGO1 gene of grubs is interfered with via the RNAi pathway, solving the problem of low efficiency in the control of grubs in existing technologies and achieving a highly efficient biological control effect.
Patent Information
- Application Number
- CN202311342951.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-17
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2043-10-17
AI Technical Summary
Existing technologies are insufficient to effectively control peanut grubs, chemical control causes serious pollution, biological control is inefficient, and physical control is costly. Therefore, there is an urgent need to find environmentally friendly and efficient biological control methods.
dsHpAGO1 was synthesized using the dsHpAGO1 gene and dsRNA primers and injected into grubs. The expression of the AGO1 gene in grubs was interfered with via the RNAi pathway. The interference efficiency was high, resulting in abnormal growth and mass mortality of grubs.
The expression level of the HpAGO1 gene in grubs was significantly reduced, with an interference efficiency of 95.53%, a mortality rate of 91.7%, a target gene silencing efficiency of 42.6%, and abnormal growth and development, achieving a highly efficient biological control effect.
Smart Images

Figure CN117247943B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and agricultural applications, and particularly relates to dsHpAGO1 for the control of grubs and its applications. Background Technology
[0002] Peanuts, a legume, are a major source of high-quality edible oil, with an oil yield as high as 45%-50%, far exceeding that of other oil crops. The dark-spotted scarab beetle, *Holotrichia parallela*, is widely distributed in my country and is one of the major underground pests affecting peanuts, soybeans, and other cash and grain crops. Its larvae, the white grubs, inhabit the soil, causing concealed damage. The wounds they create increase the risk of pathogen infection, making them difficult to predict and control, and are recognized both domestically and internationally as a major and difficult-to-control underground pest. The damage caused by white grubs to peanuts mainly occurs in two stages: the first stage is after peanut sowing, when overwintering larvae feed on peanut seeds or the roots of seedlings, leading to missing seedlings and broken rows; the second stage is during the flowering and pod-setting stages, when second or third instar larvae enter a voracious feeding phase, feeding on tender peanut pods and damaging the peanut root system, leading to crop failure or even death. Currently, the control of white grubs mainly relies on chemical control, supplemented by physical and biological control methods. While the use of highly toxic pesticides in chemical control has shown good control effects, it also causes serious environmental and water pollution, and poses serious harm to beneficial insects, bees, and humans and livestock. Long-term, irrational use of chemical pesticides can also lead to pesticide resistance and residues. Physical control methods, mainly manual insect trapping and light trapping, are more environmentally friendly and non-toxic to humans and livestock than chemical methods, but they are costly and inefficient. Biological control methods mainly involve releasing beneficial organisms and using biological agents, but their control efficiency is relatively low, and there are few biological control products available. Therefore, finding new and effective biological control targets and developing environmentally friendly and sustainable new agents using biotechnology is urgently needed.
[0003] RNA interference (RNAi) is a highly conserved, sequence-specific RNA degradation mechanism induced by double-stranded RNA (dsRNA) after transcription of endogenous genes. After being introduced into the organism, dsRNA is broken down by RNase III, known as Dicer, into 21-23 bp small interfering RNAs (siRNAs). These siRNAs bind to the target mRNA under the action of the silencing complex (RISC), specifically degrading the target mRNA and preventing the synthesis of the corresponding protein product, thus causing the loss of function of the target gene. Since the discovery of this rapid and direct mechanism for silencing specific genes, RNAi technology has been widely used in gene function research in non-model animals. Bautista et al. synthesized dsRNA of the diamondback moth (Plutellaxylostella) P450 family gene CYP6BG1 in vitro and fed it to larvae. This not only downregulated the expression of the target gene CYP6BG1 but also significantly reduced the diamondback moth's resistance to the insecticide cypermethrin. Feeding artificial diets containing dsRNA of the pea aphid aquaporin gene ApAQPI induced downregulation of the target gene expression and significantly increased the osmotic pressure of the pea aphid's hemolymph. The use of bacterial expression and in vitro synthesis of dsRNA to feed insects is not only widely used in gene function research but also in the screening of pest control target genes. Feeding potato beetles with dsRNA of five target genes resulted in slower weight gain and a significantly higher mortality rate in the treated groups.
[0004] The Argonaute (AGO) protein family is a core element of RNAi, with AGO2 being the only member possessing catalytic activity and a crucial role in the RISC complex, regulating miRNA / siRNA-induced gene silencing. Upregulating AGO2 expression, a core gene in the RNAi pathway, enhances RNAi efficiency. Introducing dsGFP into the Asian corn borer induces AGO2 upregulation, thereby improving target gene silencing efficiency. In aphids, first inducing AGO2 upregulation with dsGFP, followed by the introduction of dsRNA of the target gene, resulted in increased silencing efficiency. AGO2-mediated RNAi possesses antiviral activity, providing self-protection against external pathogens and viral infections. AGO2 in Drosophila has been identified in antiviral RNA silencing pathways in insects. Silencing AGO2 expression in Anopheles gambiae makes them more susceptible to viral infection.
[0005] AGO1 is also a member of the Argonaute (AGO) protein family, but there are currently no reports on AGO1 improving RNAi efficiency. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a dsHpAGO1 gene for controlling grubs and its application. The dsHpAGO1 of this invention is synthesized from the HpAGO1 gene (nucleotide sequence shown in SEQ ID NO. 1) and dsRNA primers (nucleotide sequences shown in SEQ ID NO. 3–SEQ ID NO. 4). After grubs were injected with the dsHpAGO1 of this invention, compared with the control group, the expression level of the HpAGO1 gene was significantly reduced, with an interference efficiency of 95.53%; grub growth and development were significantly abnormal, and a large number of grubs died, with a mortality rate of 91.7%; the silencing efficiency of the HpVAA gene decreased by 42.6%. Therefore, the dsHpAGO1 of this invention is of great significance in the control of grubs.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] One of the objectives of this invention is to provide an HpAGO1 gene for the control of grubs, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0009] The second objective of this invention is to provide a dsHpAGO1 for the control of grubs, which is synthesized from the HpAGO1 gene with the nucleotide sequence shown in SEQ ID NO.1 and the dsRNA primers with the nucleotide sequences shown in SEQ ID NO.3 to SEQ ID NO.4.
[0010] The third objective of this invention is to provide an application of the aforementioned dsHpAGO1 in the control of grubs.
[0011] The fourth objective of this invention is to provide a biological product containing the aforementioned dsHpAGO1.
[0012] Furthermore, the biological product is an injectable insecticide or bait.
[0013] The fifth objective of this invention is to provide an application of the aforementioned biological product in the control of grubs.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] 72 h after injecting grubs with dsHpAGO1 of this invention, the expression level of HpAGO1 was significantly reduced compared with the control group, with an interference efficiency of 95.53%. Further observation of the phenotypic characteristics of the growth and development of the test insects showed that, compared with the control group, the growth and development of grubs injected with dsHpAGO1 of this invention was significantly abnormal, and a large number of them died, with a mortality rate of 91.7%. After injection with dsHpAGO1 of this invention, the silencing efficiency of the target gene HpVAA was detected by real-time quantitative PCR, and it was found that the silencing efficiency of HpVAA was reduced by 42.6%. Confocal microscopy results showed that 24 h after injection with dsHpAGO1 of this invention, the distribution of cy3-labeled dsRNA in various tissues of grubs was reduced, indicating that AGO1 affects the interference efficiency by mediating the uptake and transport of dsRNA. Attached Figure Description
[0016] Figure 1 This refers to the silencing efficiency of the HpAGO1 gene and the larval mortality rate after injection of dsHpAGO1 in Example 1 of the present invention.
[0017] Figure 2 The image shows the effect of dsHpAGO1 injection on grubs in Example 1 of this invention.
[0018] Figure 3 This illustrates the effect of injecting dsHpAGO1 on gene silencing in larvae in Example 1 of this invention.
[0019] Figure 4 This shows the distribution of dsRNA in the epidermis of the dark-browed scarab beetle larvae after injection of dsHpAGO1 in Example 1 of the present invention. Detailed Implementation
[0020] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the invention without departing from its spirit and essence are within the scope of the invention. The reagents, kits, and instruments used in the following examples are commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventional methods.
[0021] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0022] Example 1
[0023] 1. Synthesis of the HpAGO1 gene
[0024] The open reading frame of the grub AGO1 gene is 2514 bp, encoding 837 amino acids, with a predicted protein molecular weight of 95.4 kDa. The HpAGO1 gene was synthesized based on the grub AGO1 gene. The nucleotide sequence of the synthesized HpAGO1 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0025] SEQ ID NO.1:
[0026] ATGTCAACAGTAACACGAGTAACTTCTCCACGGCCTATTACAGCAGGTGGCGATGCGCCAAGCCATATTTTGCCGCAAACACCGAGTGACGGAAGACGAGGCGGCAGGGAAGGAAGACTTGTAACAAGAGTAATAACAAACTTTTTCCCGCTGAACATAGGGAAGTTGCAAAATGCAATTCATTATGATGTCGCAATTGTG CCTGATAAACCTAAGAAACTGTTGCGCACAGTAATGGAAGAATTTAGGAGAAAGAAATACGGGAATAGGTATCCAGCATACGATGGAAGCAAAAACTTGTACAGTTCATCTCCTTTATTTCAAAGTGCAGAAATCTCTGATATGATAAGTGTTATGGAAGATAATAGAGAAAAAGAATTTCATGTTACTGTTAAGTTCGCTA
[0027] CTTACGTGGACCTGACATGTCTTCACAATTATACGAAGAATGTTGGCGGCAAATCCGCT
[0028] TTAGAATTGGAAAAACCTATGCAAGCGTTACAATGTGTCGATATAGTGTTGCGAAGTG
[0029] CCCCAGCACTTTCCTGTATACCCGTTGGTAGATCGTACTTTACACGACCGAACGAACCA
[0030] TTTAGACTTGGAGATGGAGCCGTACTATACAATGGTTTCTTTCAAGCTGCCATACTAGG
[0031] ATGGAAACCGTTTGTTAATATAGATGTCGCAAATAAAGCCTTTCCAGCCGCTCTTAATG
[0032] TGATTGACCTTGTAAAAGAAATGTGTAATGATGATTTAAATGGCGAACTATACAAGGC
[0033] ATCTGTGGACACGATCAATAAACATATGAGGACACTTAAGATTCATATGAATTACCC
[0034] AGAAATCTAGCTAGTCGAAGAGTATACAGAGTAAATGAGCTTGGTGCTACGTCAAGCA
[0035] GGGCCACATTTAAGGAAGATGGTGGAAGAACTATGACTGTCACAGAGTATTTTAAAAC
[0036] AAAGAAGAATATCCAATTAAAATTCCCCAATCTACCAACTTTATGGGTCGGTAGTCGA
[0037] AGCCGGGAAAATAAAATTCTACTGCCCATGGAATTCTGTACAATTCTGCCCGATCAAG
[0038] TCGTGAACAAGAAAATGACAGAAGAACAGACTAGAATATATGATAAACGTGCGGCGA
[0039] CCGATACGAAAACTCGATTACATAATATTTCGCAATCCGTTACGAAAGCTAGTTATAAC
[0040] GAAAGCCCTACAATGAGAGAATTTGGAATAACAGTTAATCCAACACCGCAAGAAGTTG
[0041] AAGCAAGAATATTACATCCGCCAAAGCTAGAATATAGCAATAAACAAGAAAATGTCTT
[0042] TAAAGGTACTTGGCGTGCCAGTCAGTTTGTACAAGGCGTATCATTAACCTCTTGGAGTG
[0043] TATTATGTCTAGACCGTCGCACTCGCGAAGAAAACATTCACCGTTTAGAACAAGAGTT
[0044] AATGAAGACTGCAAGGACACTGGGAATGAATATAGGTTCTCCCGCTCCCTTTACTCTCC
[0045] TTGGAGATAGAAATCTACGGCTAGATTTACGTAAGCATTTTGCAGAAAATAAAGGATT
[0046] ACAGATGATTATAGTTATATTGAACAGCAGAAGCGAATGTTACAACTGGGTGAAAGAA
[0047] GCATCCGAAATTGCTGTAGGTTGTCTAACGCAATGTTTAAAATCTAATACTGTCTACAA
[0048] ACTGTCAACATCAACAGTTGGTAATATCTTATTAAAAATAAACGCAAAGTTAAATGGG
[0049] GAGAATCATCATTTATACGGGCTAAAGAGCTTTTTAGTTCGGCCATGTATGATAATGGG
[0050] TGCAGATGTTACACATCCAGGTCCAGATTCCAAGGATTTTCCTAGTGTCGCAGCTGTTA
[0051] CTGCTTCGTTTGACGCGCATTTCTTCAAGTACGCATTCGAATGGCGTCTACAACAAGCT
[0052] CGACAAGAGATGATAGAAGATCTACAGGAGATCACAAAACAGCATCTTCTTAATTTCT
[0053] ATAGAAAAAATAATCAGGTGAAACCGGAAAAGCTAATATATGTCCGTGATGGCGTGTC
[0054] AGATGGGCAATTTGAACAGGTGCTAAATGTAGAATTGACGGCTATAAGAACGGCGTGC
[0055] GTGAGACTTCAACCTAATTACAATCCGCCTATTATTTTTGTTGTGGTGCAGAAACGACA
[0056] CCACACCAGATTCTTTCCGAAGGATCCGAGAATATCAGAAGACAGAAATTGTAATGTCCCAGCAGGTACGTGCGTAGACACCGAGATCACGCATCCGTCAATAATCGATTTTTACTTGGTCTCTCACGCCAGCATCCAGGGAGTTGCAAAACCCACAAAGTACGTCAAATTGTGGGACGATTGCAATATGTCAGAAGATGATCTAGAAAAGCTTATGTATTACTTGTGTCACATGTTTGCACGTTGCAACAGATCTGTCAGTTATCCTGCTCCAACATATTATGCCCATCTTGCTGCAGCGAGAGCACGAGTATATTGTGAAATTGATCGCATTGACATGAGGAATTTGCAGGCGGAGCAAAGACGTTTGACAATTAAAGAAAATATCTCAAAAAATCTACCCATGTTCTTTGTTTAA
[0057] SEQ ID NO.2:
[0058] MSTVTRVTSPRPITAGGDAPSHILPQTPSDGRRGGREGRLVTRVITNFFPLNIGKLQNAIHYDVAIVPDKPKKLLRTVMEEFRRKKYGNRYPAYDGSKNLYSSSPLFQSAEISDMISVMEDNREKEFHVTVKFATYVDLTCLHNYTKNVGGKSALELEKPMQALQCVDIVLRSAPALSCIPVGRSYFTRPNEPFRLGDGAVLYNGFFQAAILGWKPFVNIDVANKAFPAALNVIDLVKEMCNDDLNGELYKASVDTINKHMRTLKIQYELPRNLASRRVYRVNELGATSSRATFKEDGGRTMTVTEYFKTKKNIQLKFPNLPTLWVGSRSRENKILLPMEFCTILPDQVVNKKMTEEQTRNMIKRAATDTKTRLHNISQSVTKASYNESPTMREFGITVNPTPQEVEARILHPPKLEYSNKQENVFKGTWRASQFVQGVSLTSWSVLCLDRRTREENIHRLEQELMKTARTLGMNIGSPAPFTLLGDRNLRLDLRKHFAENKGLQMIIVILNSRSECYNWVKEASEIAVGCLTQCLKSNTVYKLSTSTVGNILLKINAKLNGENHHLYGLKSFLVRPCMIMGADVTHPGPDSKDFPSVAAVTASFDAHFFKYAFEWRLQQARQEMIEDLQEITKQHLLNFYRKNNQVKPEKLIYVRDGVSDGQFEQVLNVELTAIRTACVRLQPNYNPPIIFVVVQKRHHTRFFPKDPRISEDRNCNVPAGTCVDTEITHPSIIDFYLVSHASIQGVAKPTKYVKLWDDCNMSEDDLEKLMYYLCHMFARCNRSVSYPAPTYYAHLAAARARVYCEIDRIDMRNLQAEQRRLTIKENISKNLPMFFV
[0059] Chemical synthesis of 2.dsHpAGO1
[0060] Using the dsRNA specific primers of the HpAGO1 gene synthesized in step 1 and the control GFP gene, referring to T7RiboMAX TMThe Express RNAi System instructions describe the synthesis of dsRNA for use in RNAi experiments. The specific primer sequences used are shown in Table 1.
[0061] Table 1 Primer Details
[0062]
[0063]
[0064] 3. RNAi assay
[0065] The silencing efficiency of dsGFP and dsHpAGO1 72 h after injection was determined by qRT-PCR, and the results are as follows: Figures 1-2 As shown.
[0066] The results showed that the HpAGO1 gene silencing efficiency in larvae was 95.53%, the mortality rate was 91.7%, the grub body color darkened, growth slowed, movement became sluggish, and less active.
[0067] 4. Effects of dsHpAGO1 injection on gene silencing in larvae
[0068] HpVAA was selected as the target gene. After injection of dsHpAGO1, the relative expression level of HpVAA was detected. The results are as follows: Figure 3 As shown.
[0069] The results showed that after injection of dsHpAGO1, the silencing efficiency of HpVAA decreased by 42.6%, indicating that HpAGO1 inhibited the silencing of HpVAA.
[0070] 5. Effect of HpAGO1 on the distribution of dsRNA in larval epidermis
[0071] The distribution of dsHpAGO1 in the epidermis of the larvae of the dark-browed scarab beetle was observed using confocal microscopy. The results are as follows: Figure 4 As shown.
[0072] The results showed that cy3-labeled dsRNA was reduced in various tissues of grubs 24 h after injection of dsHpAGO1. This indicates that AGO1 affects interference efficiency by mediating the uptake and transport of dsRNA.
[0073] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. An HpAGO1 gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
1.
2. A dsHpAGO1 for controlling grubs, characterized in that, The dsHpAGO1 is a dsRNA synthesized from the HpAGO1 gene as described in claim 1 and dsRNA primers with nucleotide sequences as shown in SEQ ID NO. 3~SEQ ID NO.
4.
3. The application of dsHpAGO1 as described in claim 2 in the control of grubs.
4. A biological product, characterized in that, The biological product contains the dsHpAGO1 as described in claim 2.
5. The biological product according to claim 4, characterized in that, The biological product is an injectable insecticide or bait.
6. The application of the biological product according to any one of claims 4 to 5 in the control of grubs.
Citation Information
Patent Citations
GHO / SEC24B2 and SEC24B1 nucleic acid molecules to control coleopteran and hemipteran pests
CN107109409A
RNAi target gene capable of efficiently killing grubs and application of RNAi target gene
CN113122540A