An engineered bacterium for producing ectoine, its preparation method and application

By genetically editing Corynebacterium glutamicum, LysC feedback inhibition was relieved, LysE activity was reduced, and related enzyme activities were enhanced, solving the problems of long fermentation cycle and endotoxin in ectoine production. This resulted in high-yield and stable ectoine production, making it suitable for industrial applications.

CN117448249BActive Publication Date: 2026-06-30CATAYA BIO (SHANGHAI) CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202311514052.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-14
Publication Date
2026-06-30
Estimated Expiration
2043-11-14

AI Technical Summary

Technical Problem

Existing ectoine production methods suffer from problems such as long fermentation cycles, cumbersome and complex operations, high-salt fermentation affecting the lifespan of fermentation vessels, and difficulties in subsequent waste liquid treatment. Furthermore, Escherichia coli, as a host strain, produces endotoxins, hindering industrial application.

Method used

Using Corynebacterium glutamicum as the starting strain, gene editing technology was used to relieve the feedback inhibition of aspartate kinase LysC, reduce the activity of lysine efflux permease LysE, express the ectoin synthesis gene cluster ectABC, and enhance the activities of aspartate semialdehyde dehydrogenase Asd, aspartate transaminase AspB, or 6-phosphoglucose dehydrogenase Gnd, in order to increase ectoin production.

Benefits of technology

It achieves efficient production of ectoine in a low-salt environment, with good fermentation stability and high yield, solving the production problems in existing technologies and making it suitable for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117448249B_ABST
    Figure CN117448249B_ABST
Patent Text Reader

Abstract

This invention provides an engineered bacterium for producing ectoine, its preparation method, and its application. The engineered bacterium is prepared using the following steps: using Corynebacterium glutamicum as the starting strain, feedback inhibition of aspartate kinase LysC is relieved, the activity of the gene lysE encoding lysine efflux permease is reduced, and the ectoine synthesis gene cluster ectABC is expressed; based on this, the activity of any one or at least two combinations of aspartate semialdehyde dehydrogenase Asd, aspartate transaminase AspB, or 6-phosphogluconate dehydrogenase Gnd is enhanced to further increase the yield of ectoine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an engineered bacterium for producing ectoine, its preparation method, and its application. Background Technology

[0002] Ectoine, chemically named 2-methyl-1,4,5,6-tetrahydropyrimidine-4-carboxylic acid, is also known as tetrahydromethylpyrimidinecarboxylic acid. Ectoine is an amino acid derivative with powerful stress-reducing protective functions, enabling it to protect microorganisms and plants from deadly and extreme environmental factors such as salt lakes, glaciers, and deserts. As a 100% natural and very safe skincare ingredient, ectoine is a white powder, water-soluble, and a cyclic amino acid. Its origins can be traced back to 1985 when Professor Galinski discovered desert halophilic bacteria in the Egyptian desert that thrived under harsh conditions of high temperature, dryness, strong UV radiation, and high salinity, generating a natural protective component in the outer layer of its cells.

[0003] CN112300957A discloses a halophilic Bacillus strain and a method for its industrial production of ectoine. First, a strain with ectoine secretion characteristics was isolated from coastal mud in Rizhao. Then, through mutation screening, a high-yielding ectoine-producing Halobacillus sp. FL-2423 with stable genetic characteristics was obtained. This strain is a moderately halophilic bacterium. When fermented in a medium with a NaCl concentration of 50-100 g / L, it synthesizes ectoine intracellularly, achieving a fermentation yield of 10-16 g / L. Currently, ectoine is mainly produced through high-density fermentation using halophilic microorganisms in a process known as "bacterial milking," which involves repeated high-salt induction of synthesis and low-salt promotion of release to obtain high concentrations of ectoine. However, this production method has a long fermentation cycle and is cumbersome and complex. Furthermore, high-salt fermentation not only affects the lifespan of the fermentation vessel but also poses a significant challenge to the subsequent treatment of fermentation waste.

[0004] With the development of genetic engineering technology, researchers have tried to use conventional fermentation hosts such as Escherichia coli and Corynebacterium glutamicum to produce ectoine through genetic engineering.

[0005] CN116555368A discloses a method for producing ectoine, wherein the method involves culturing and fermenting Escherichia coli BL21 metabolic engineered bacteria to produce ectoine. CN110914435A discloses an ectoine-producing yeast, in which the yeast is modified and the yield reaches 6.4 g / L after 24 hours of fermentation.

[0006] Currently, processes have successfully achieved high yields of ectoine using recombinant *E. coli* as substrate cells in a low-salt environment. However, the endotoxin production of *E. coli* itself, coupled with its primary applications in biopharmaceuticals and aesthetic medicine, has significantly hampered its industrialization. Compared to *E. coli*, *Corynebacterium glutamicum* is a recognized strain suitable for safe microbial production, possessing advantages such as resistance to bacteriophage infection, fermentation stability, and no endotoxin production. Therefore, developing a high-yield ectoine-producing recombinant *Corynebacterium glutamicum* microorganism is of great practical significance for the industrial production and further market promotion of ectoine. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide an engineered microorganism for producing ectoine, its preparation method, and its applications. The engineered microorganism for producing ectoine described in this invention exhibits stable fermentation and high yield, and has significant application value in the industrial production of ectoine.

[0008] To achieve this objective, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides an engineered bacterium for producing ectoine, wherein the engineered bacterium is prepared by a method comprising the following steps:

[0010] (1) Using Corynebacterium glutamicum as the starting strain, the feedback inhibition of aspartate kinase LysC was relieved.

[0011] (2) Reduce the activity of the gene lysE, which encodes lysine efflux permease;

[0012] (3) Expressing the ectoin synthesis gene cluster ectABC;

[0013] (4) Enhance the activity of any one or at least two of the following: aspartate semialdehyde dehydrogenase Asd, aspartate transaminase AspB, or 6-phosphate gluconate dehydrogenase Gnd to further increase ectoin production.

[0014] Preferably, the Corynebacterium glutamicum is Corynebacterium glutamicum ATCC 13032.

[0015] Preferably, the release of feedback inhibition of aspartate kinase LysC is achieved through any one of the following methods (1) and (2):

[0016] (1) Introduce the LysC-S301Y site mutation;

[0017] (2) Introduce the LysC-T311I site mutation.

[0018] Preferably, the reduction of the activity of the lysine efflux permease LysE is achieved by any one of the following methods (1), (2), and (3):

[0019] (1) Insert, delete, or replace one or more bases in the gene encoding the target enzyme to inactivate or reduce the activity of the target enzyme.

[0020] (2) Replace the transcriptional or translational regulatory elements of the gene encoding the target enzyme with regulatory elements with lower activity;

[0021] (3) The target enzyme is inactivated or its activity is reduced by means of techniques such as CRISPRi gene inhibition or antisense RNA.

[0022] Preferably, the ectoin synthesis gene cluster ectABC is derived from Pseudomonas schlegelii.

[0023] Preferably, the nucleotide sequence of the ectoin synthesis gene cluster ectABC is shown in SEQ ID No. 37.

[0024] Preferably, the ectoin synthesis gene cluster ectABC is expressed via plasmid or chromosome integration.

[0025] Preferably, the enhancement of the activities of aspartate semialdehyde dehydrogenase Asd, aspartate transaminase AspB, and 6-phosphoglucate dehydrogenase Gnd is achieved through any one or more of the following methods (1) and (2):

[0026] (1) Increase the copy number of the gene encoding the target enzyme;

[0027] (2) Replace the transcriptional or translational regulatory elements of the gene encoding the target enzyme with more active regulatory elements.

[0028] Preferably, the increase in the copy number of the coding gene of the target enzyme is achieved by introducing a plasmid carrying the coding gene and / or integrating the coding gene into the genome.

[0029] Preferably, the transcriptional or translational regulatory element is selected from any one or more combinations of promoters, ribosome binding sites, and enhancers.

[0030] Preferably, the nucleotide sequence encoding the aspartic semialdehyde dehydrogenase Asd is shown in SEQ ID No. 38.

[0031] Preferably, the nucleotide sequence encoding the aspartate transaminase AspB is shown in SEQ ID No. 39.

[0032] Preferably, the nucleotide sequence encoding the 6-phosphoglucate dehydrogenase Gnd is shown in SEQ ID No. 40.

[0033] Specifically, in this invention, feedback inhibition of aspartate kinase LysC is relieved by introducing a LysC-S301Y site mutation or a LysC-T311I site mutation.

[0034] The gene lysE, which encodes lysine efflux permease, was then knocked out using SacB reverse screening, thereby reducing the activity of lysine efflux permease LysE.

[0035] Regarding the method of introducing plasmids carrying the coding gene of the target enzyme, these target enzymes can exist on the same plasmid or on different plasmids. The present invention has no particular limitations on the plasmid; any plasmid capable of cloning and expressing the target enzyme in the starting strain can be used. The present invention also has no particular limitations on the copy number of the plasmid; it can be a high-copy, medium-copy, or low-copy plasmid. For obtaining a high-yielding ectoine-producing strain, plasmids with a copy number of 10 to 100 are preferred.

[0036] Specifically, in this invention, the ectoin synthesis gene cluster ectABC is expressed using plasmid pXMJ19 as an expression vector. The ectoin synthesis gene cluster ectABC is derived from Pseudomonas schlegelii.

[0037] The purpose of increasing the activity of 6-phosphoglucate dehydrogenase Gnd was achieved by introducing a mutation at the GndS361F site.

[0038] Using plasmid pJC1 as the expression vector, we further enhanced the production of ectoin by combining any one or at least two of the following: aspartate semialdehyde dehydrogenase Asd, aspartate transaminase gene AspB, and 6-phosphoglucose dehydrogenase Gnd mutant GndS361F.

[0039] The nucleotide sequence of the ectoin synthesis gene cluster ectABC is shown in SEQ ID No. 37. The nucleotide sequence encoding the aspartate semialdehyde dehydrogenase Asd is shown in SEQ ID No. 38. The nucleotide sequence encoding the aspartate transaminase AspB is shown in SEQ ID No. 39. The nucleotide sequence encoding the 6-phosphoglucose dehydrogenase Gnd is shown in SEQ ID No. 40.

[0040] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0041] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout, thus obtaining an engineered bacterium that produces ectoin.

[0042] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0043] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-T311I mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-T311I mutation and the lysE gene knockout, thus obtaining an engineered strain that produces ectoin.

[0044] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0045] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, the gene lysE encoding lysine efflux permease was knocked out, and the ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced. At the same time, a GndS361F mutation was further introduced through gene recombination to improve the activity of 6-phosphoglucose dehydrogenase Gnd, thus obtaining an engineered strain that produces ectoin.

[0046] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0047] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced to knock out the lysE gene encoding lysine efflux permease. The ectABC gene cluster derived from Pseudomonas stutzeri was introduced, and the gnd gene, which is mutated from serine at position 361 to phenylalanine, was further introduced through a plasmid to improve the activity of 6-phosphoglucose dehydrogenase Gnd, thus obtaining an engineered bacterium that produces ectoin.

[0048] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0049] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y site mutation was introduced to knock out the lysE gene encoding lysine efflux permease. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced, and the asd gene was further introduced through a plasmid to enhance the activity of aspartate semialdehyde dehydrogenase Asd, thus obtaining an engineered bacterium that produces ectoin.

[0050] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0051] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y site mutation was introduced to knock out the lysE gene encoding lysine efflux permease. The ectABC gene cluster derived from Pseudomonas stutzeri was introduced, and the aspB gene was further introduced through a plasmid to enhance the activity of aspartate transaminase AspB, thus obtaining an engineered bacterium that produces ectoin.

[0052] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0053] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, the LysC-S301Y site mutation was introduced, the lysE gene encoding lysine efflux permease was knocked out, and the ectoin synthesis gene cluster ectABC derived from Pseudomonas stutzeri was introduced. The GndS361F site mutation was introduced into the genome through gene recombination, and the asd gene and aspB gene were further introduced through plasmid to obtain an engineered bacterium that produces ectoin.

[0054] In one embodiment, the engineered bacteria that produce ectoine are prepared using a preparation method comprising the following steps:

[0055] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced to knock out the lysE gene encoding lysine efflux permease. The ectABC gene cluster derived from Pseudomonas stutzeri was introduced. Furthermore, the gnd gene, which is a serine mutation at position 361 to phenylalanine, as well as the asd and aspB genes, were introduced via plasmid to obtain an engineered bacterium that produces ectoin.

[0056] In a second aspect, the present invention provides the application of engineered bacteria for producing ectoine as described in the first aspect in the fermentation of ectoine.

[0057] Compared with the prior art, the present invention has the following beneficial effects:

[0058] Compared to *Escherichia coli*, *Corynebacterium glutamicum* is a recognized strain suitable for safe microbial production, possessing advantages such as resistance to bacteriophage infection, stable fermentation, and no endotoxin production. This invention constructs a high-yielding basic strain of ectoine using gene editing and other methods, and further develops several improved strains with enhanced performance. After 96 hours of fermentation in a 2L fermenter, the highest yield reached 142 g / L, demonstrating short fermentation time and high production intensity. Attached Figure Description

[0059] Figure 1 This is the HPLC chromatogram of the product from Example 1.

[0060] Figure 2 This is the mass spectrometry analysis chromatogram of the product in Example 1. Detailed Implementation

[0061] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.

[0062] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0063] Example 1: Construction and fermentation of the basic strain lysCS301Y-ΔlysE-ectABC

[0064] (1) Construction of mutant strain lysC-S301Y

[0065] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, homologous arms lysC-S301Y-UF / lysC-S301Y-UR and lysC-S301Y-RF / lysC-S301Y-RR were amplified by PCR using primer pairs lysC-S301Y-UF / lysC-S301Y-UR and lysC-S301Y-RF / lysC-S301Y-RR (PCR system used was 2×Phanta Max Master Mix (Dye Plus), Vazyme). The plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB. The three fragments lysC-S301Y-Up, lysC-S301Y-Down, and line-pK18mobsacB were then cloned using a recombinant cloning kit (ClonExpress Multis One Step Cloning). The recombinant plasmid pK18mobsacB-lysC-S301Y was seamlessly assembled using the Vazyme Kit (catalog number: C113-02). The reaction system and conditions were performed according to the kit's instructions. After seamless assembly, the plasmid was transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-lysC-S301Y. The validated plasmid was electroporated into Corynebacterium glutamicum ATCC13032, and subsequent screening using kanamycin and SacB resistance yielded the mutant strain lysC-S301Y, where serine at position 301 was changed to tyrosine.

[0066] Primer pair lysC-S301Y-UF / lysC-S301Y-UR:

[0067] lysC-S301Y-UF: gaaacagctatgacatgattacgaattcgcgatgtcaccacgttgggtcg (SEQID No. 1);

[0068] lysC-S301Y-UR: tggtgccgtcttctacagaaTagacgttctgcagaaccat (SEQ ID No. 2);

[0069] Primer pair lysC-S301Y-RF / lysC-S301Y-RR:

[0070] lysC-S301Y-RF: atggttctgcagaacgtctattctgtagaagacggcacca (SEQ ID No. 3);

[0071] lysC-S301Y-RR: atgcctgcaggtcgactctagaaatcttacggcctgcggaacgt (SEQ ID No. 4).

[0072] (2) Construction of mutant strain lysC-S301Y-ΔlysE

[0073] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, upstream homologous arms lysE-Up and lysC-Down were obtained by PCR amplification using primer pairs lysE-UF / lysE-UR (PCR system used 2×Phanta Max Master Mix (Dye Plus), Vazyme). Plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB. The above three fragments, lysE-Up, lysE-Down, and line-pK18mobsacB, were seamlessly assembled using a recombinant cloning kit (ClonExpress Multis One Step Cloning Kit, Vazyme, catalog number: C113-02). The reaction system and reaction conditions were performed according to the kit instructions. After seamless assembly, Trans1 T1 competent cells were transformed to obtain the recombinant plasmid pK18mobsacB-ΔlysE. The validated plasmid was electroporated into the previously obtained mutant strain lysC-S301Y, and then screened using kanamycin resistance and SacB resistance to further obtain the lysE knockout mutant strain lysC-S301Y-ΔlysE.

[0074] Primer pair lysE-UF / lysE-UR:

[0075] lysE-UF: gaaacagctatgacatgattacgaattcatctgcgttgatggcgatggtt(SEQ IDNo.5);

[0076] lysE-UR:tattgcgcgccgacgccgccgatgatgaacaaaaagacgtca (SEQ ID No. 6);

[0077] Primer pair lysE-RF / lysE-RR:

[0078] lysE-RF: tgacgtctttttgttcatcatcggcggcgtcggcgcgcaata (SEQ ID No. 7);

[0079] lysE-RR: atgcctgcaggtcgactctagatgagggcatgttgaacgtgaac (SEQ ID No. 8).

[0080] (3) Construction of recombinant strain lysC-S301Y-ΔlysE-ectABC

[0081] The ectABC gene cluster, derived from *Pseudomonas stutzeri*, was codon-optimized, and XbaI and EcoRI restriction sites were reserved at the 5' and 3' ends of the gene cluster, respectively, before artificial synthesis (Suzhou Genewiz Biotechnology Co., Ltd.). The commercially available high-expression plasmid pXMJ19 from *Corynebacterium glutamicum* was double-digested with the restriction endonucleases XbaI / EcoRI. Seamless assembly was performed using a recombinant cloning kit (ClonExpress Multis One Step Cloning Kit, Vazyme, catalog number: C113-02), and the ectABC gene fragment was ligated into pXMJ19. The resulting recombinant plasmid was named pXMJ19-ectABC. The plasmid pXMJ19-ectABC was transformed into the aforementioned mutant strain lysC-S301Y-ΔlysE via electroporation using an electroporator (Bio-Rad). The electroporation conditions were 2.5 kV, 200 Ω, and 25 μF (electroporation cup width was 2 mm). Recombinant bacteria were then screened on LBHIS plates containing 5 mg / L chloramphenicol and named lysC-S301Y-ΔlysE-ectABC.

[0082] The mutant strain lysC-S301Y-ΔlysE-ectABC, stored at -80℃, was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed culture. Then, OD0.05 was used as the soluble concentrate. 600 An inoculum of 0.3 μL was introduced into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The supernatant was collected after centrifugation and analyzed by HPLC.

[0083] The analytical conditions were as follows: Ultra-high performance liquid chromatography (UHPLC) (Agilent UHPLC 1290), equipped with a DAD detector. Column: Agilent SB-Aq; 4.6*250mm; 5μm. Mobile phase: 5% acetonitrile, 95% sodium dihydrogen phosphate aqueous solution (20mmol), pH adjusted to 2.0 with phosphoric acid. Column temperature: 30℃. UV: 210nm. Flow rate: 0.6mL / min, isogradient elution. Injection volume: 2μL. Run time: 8 minutes. The ectoine yield was determined by HPLC to be 2.8 g / L. The UHPLC results are as follows. Figure 1 As shown. Further mass spectrometry was used to detect the product, and the results are as follows. Figure 2 As shown.

[0084] The seed culture medium contains the following components: brain and heart extract powder (brand: Oxoid, item number: CM1135) 15g / L, tryptone (brand: Oxoid, item number: LP0042) 5g / L, NaCl 5g / L, and yeast powder (brand: Oxoid, item number: LP0021) 2.5g / L.

[0085] The fermentation medium consists of the following components: glucose 20 g / L, MgSO4·7H2O 0.45 g / L, yeast extract 5 g / L, tryptone 3 g / L, K2HPO4 0.5 g / L, (NH4)2SO4 5 g / L, NaCl 1 g / L, biotin 0.0004 g / L, and vitamin B1 0.0001 g / L.

[0086] Example 2: Construction and fermentation of the basic strain lysCT311I-ΔlysE-ectABC

[0087] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, homologous arms lysC-T311I-UF / lysC-T311I-UR and lysC-T311I-RF / lysC-T311I-RR were amplified by PCR using primer pairs lysC-T311I-UF / lysC-T311I-UR and lysC-T311I-RF / lysC-T311I-RR (PCR system used was 2×Phanta Max Master Mix (Dye Plus), Vazyme). The plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB. The three fragments lysC-T311I-Up, lysC-T311I-Down, and line-pK18mobsacB were then cloned using a recombinant cloning kit (ClonExpress Multis One Step Cloning). The recombinant plasmid pK18mobsacB-lysC-T311I was seamlessly assembled using the Vazyme Kit (catalog number: C113-02). The reaction system and conditions were performed according to the kit's instructions. After seamless assembly, the plasmid was transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-lysC-T311I. The validated plasmid was electroporated into Corynebacterium glutamicum ATCC13032, and subsequent screening using kanamycin and SacB resistance yielded the mutant strain lysC-T311I, with a threonine mutation at position 311 in LysC replaced by isoleucine.

[0088] Primer pair lysC-T311I-UF / lysC-T311I-UR:

[0089] lysC-T311I-UF: aacagctatgacatgattacgaattcagtcccttggcgcagaa (SEQ ID No. 9);

[0090] lysC-T311I-UR:cgtcggaacgagggcaggtgaagAtgatgtcggtggtgccgtcttcta(SEQID No.10);

[0091] Primer pair lysC-RF / lysC-RR:

[0092] lysC-T311I-RF: tagaagacggcaccaccgacatcaTcttcacctgccctcgttccgacg (SEQID No. 11);

[0093] lysC-T311I-RR: gtaaaacgacggccagtgccaagctttcgtccttgcgccaag (SEQ ID No. 12).

[0094] The recombinant plasmid pK18mobsacB-ΔlysE obtained in Example 1 was electroporated into the obtained mutant strain lysC-T311I. The mutant strain lysE knockout lysC-T311I-ΔlysE was further obtained by reverse screening using kanamycin resistance and SacB resistance.

[0095] The overexpression plasmid pXMJ19-ectABC obtained in Example 1 was transformed into the aforementioned mutant strain lysC-T311I-ΔlysE by electroporation using an electroporator (Bio-Ray). The electroporation conditions were 2.5 kV, 200 Ω, and 25 μF (electroporation cup width was 2 mm). Recombinant bacteria were then screened on LBHIS plates containing 5 mg / L chloramphenicol and named lysC-T311I-ΔlysE-ectABC.

[0096] The mutant strain lysCT311I-ΔlysE-ectABC-lysC was inoculated into seed culture medium and cultured at 30°C for 24 hours to obtain seed liquid. Then, OD0.05 was used as the OD0.05. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 2.6 g / L as determined by HPLC.

[0097] Example 3: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-gndS361F.

[0098] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the promoter fragment gnd-up was obtained by PCR amplification using gnd-up-1 / gnd-up-2 primers; the insert fragment gnd-down was obtained by PCR amplification using the same genome as a template and gnd-down-1 / gnd-down-2 primers; the plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB; the three fragments gnd-up, gnd-down, and line-pK18mobsacB were seamlessly assembled using a recombinant cloning kit (ClonExpress Multis One Step Cloning Kit, Vazyme, catalog number: C113-02). The reaction system and conditions were performed according to the kit instructions. After seamless assembly, the cells were transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-gndS361F. The validated plasmid was electroporated into the previously obtained mutant strain lysCS301Y-ΔlysE-ectABC. Kanamycin resistance, chloramphenicol resistance and SacB resistance were used for reverse screening to further obtain the mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F with serine at position 361 mutated to phenylalanine.

[0099] Primer pair gnd-up-1 / gnd-up-2:

[0100] gnd-up-1:gaaacagctatgacatgattacgaattccaagatggtccacaacggca(SEQ IDNo.13);

[0101] gnd-up-2:acgtcccagttgttctcgtcgAagccagccttgatctcgtcgaa (SEQ ID No. 14);

[0102] Primer pair gnd-down-1 / gnd-down-2:

[0103] gnd-down-1:ttcgacgagatcaaggctggctTcgacgagaacaactgggacgt(SEQ IDNo.15);

[0104] gnd-down-2: gcttgcatgcctgcaggtcgactctagattatcgacgcccacctccggcga (SEQ ID No. 16).

[0105] The mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the OD0.05. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used during the fermentation process were the same as in Example 1. The yield of ectoine was determined to be 3.0 g / L by HPLC.

[0106] Example 4: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-gndS361F(pJC1)

[0107] Using the genome of *Corynebacterium glutamicum* ATCC13032 as a template, PCR amplification was performed using primers Pcg2195-1 / Pcg2195-2 to obtain the promoter fragment Pcg2195-gnd. Using the genome of *Corynebacterium glutamicum* strain lysCS301Y-ΔlysE-ectABC-gndS361F from Example 3 as a template, PCR amplification was performed using primers gnd-1 / gnd-2 to obtain the insert fragment gndS361F. Plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1. The above three fragments, Pcg2195-gnd, gndS361F, and line-pJC1, were seamlessly assembled using the same recombinant cloning kit described above, and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pJC1-gndS361F. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F(pJC1).

[0108] Primer pair Pcg2195-1 / Pcg2195-2:

[0109] Pcg2195-1: gcgatcagcgacgccgcagggggatccgagtatcgaaaaatttccacgtcaag (SEQID No. 17);

[0110] Pcg2195-2:tattgatcgtacttgacggcatgagaatagtccttcggaaatagtcg (SEQ IDNo. ​​18);

[0111] Primer pair gnd-1 / gnd-2:

[0112] gnd-1: cgactatttccgaaggactattctcatgccgtcaagtacgatcaata (SEQ ID No. 19);

[0113] gnd-2: GATTTGGGAGGCCTTAttgttcgtcgtcgacttaagcttcaacctcggagcggtcg (SEQ ID No. 20).

[0114] The mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the seed culture medium. 600 An inoculum of 0.3 g / L was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was determined to be 3.3 g / L by HPLC.

[0115] Example 5: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-asd(pJC1)

[0116] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers Pcg2195-3 / Pcg2195-4 to obtain the promoter fragment Pcg2195-asd; using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers asd-1 / asd-2 to obtain the insert fragment asd; plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1; the above three fragments, Pcg2195-asd, asd, and line-pJC1, were seamlessly assembled using the same recombinant cloning kit described above, and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pJC1-asd. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-asd(pJC1).

[0117] Primer pair Pcg2195-3 / Pcg2195-4:

[0118] Pcg2195-3: gcgatcagcgacgccgcagggggatccgagtatcgaaaaatttccacgtcaag (SEQID No. 21);

[0119] Pcg2195-4: caacaactgcgatggtggtcatgagaatagtccttcggaaatagtcg (SEQ ID No. 22);

[0120] Primer pair asd-1 / asd-2:

[0121] asd-1: cccgactatttccgaaggactattctcatgaccaccatcgcagttgttg (SEQ IDNo. ​​23);

[0122] asd-2: gatttggggaggccttattgttcgtcgtcgacttacttaaccagcagctcagcgat (SEQ ID No. 24).

[0123] The mutant strain lysCS301Y-ΔlysE-ectABC-asd(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid, which was then used as OD. 600An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 3.7 g / L as determined by HPLC.

[0124] Example 6: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-aspB(pJC1)

[0125] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers Pcg2195-5 / Pcg2195-6 to obtain the promoter fragment Pcg2195-aspB; using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers aspB-1 / aspB-2 to obtain the insert fragment aspB; plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1; the above three fragments, Pcg2195-aspB, aspB, and line-pJC1, were seamlessly assembled using the same recombinant cloning kit described above, and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pJC1-aspB. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-aspB(pJC1).

[0126] Primer pair Pcg2195-5 / Pcg2195-6:

[0127] Pcg2195-5: gcgatcagcgacgccgcagggggatccgagtatcgaaaaatttccacgtcaag (SEQID No. 25);

[0128] Pcg2195-6: tcctgcagcgaaactgaactcatgagaatagtccttcggaaatagtcg (SEQ ID No. 26);

[0129] Primer pair aspB-1 / aspB-2:

[0130] aspB-1: cccgactatttccgaaggactattctcatgagttcagtttcgctgcagga (SEQ ID No. 27);

[0131] aspB-2: cgatttgggaggccttattgttcgtcgtcgacttagttagcgtaatgctccgctgc (SEQ ID No. 28).

[0132] The mutant strain lysCS301Y-ΔlysE-ectABC-aspB(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the seed culture medium. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 3.2 g / L as determined by HPLC.

[0133] Example 7: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-gndS361F-asd_aspB(pJC1).

[0134] Using plasmid pJC1-asd constructed in Example 5 as a template, PCR amplification was performed using pJC1-asd-1 / pJC1-asd-2 as primers to obtain the insert fragment pJC1-asd(part); using plasmid pJC1-aspB constructed in Example 6 as a template, PCR amplification was performed using pJC1-aspB-1 / pJC1-aspB-2 as primers to obtain the insert fragment pJC1-aspB(part); plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1; the above three fragments: pJC1-asd(part), pJC1-aspB(part), and line-pJC1 were seamlessly assembled using the same recombinant cloning kit described above, and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pJC1-asd-aspB. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F constructed in Example 3, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F-asd_aspB(pJC1).

[0135] Primer pair pJC1-asd-1 / pJC1-asd-2:

[0136] pJC1-asd-1:gtcgcgagggcgatcagcgacgccgcagggggatccgagtatcgaaaaatttccacgtcaagttaact (SEQ ID No. 29);

[0137] pJC1-asd-2: gacgtggaaatttttcgatactcttacttaaccagcagct (SEQ ID No. 30);

[0138] Primer pair pJC1-aspB-1 / pJC1-aspB-2:

[0139] pJC1-aspB-1: agctgctggttaagtaagagtatcgaaaaatttccacgtca (SEQ ID No. 31);

[0140] pJC1-aspB-2: CGATTTGGGAGGCCTTAttgttcgtcgtcgacttagttagcgtaatgctccgctgc (SEQ ID No. 32).

[0141] The mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F-asd_aspB(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the seed culture medium. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 4.9 g / L as determined by HPLC.

[0142] Example 8: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-gndS361F_asd_aspB(pJC1).

[0143] Using plasmid pJC1-asd-aspB constructed in Example 7 as a template, PCR amplification was performed using pJC1-asd-aspB-1 / pJC1-asd-aspB-2 primers to obtain the insert fragment pJC1-asd-aspB(part); using plasmid pJC1-gndS361F constructed in Example 4 as a template, PCR amplification was performed using pJC1-gndS361F-1 / pJC1-gndS361F-2 primers to obtain the insert fragment pJC1-gndS361F(part); plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1; the above three fragments: pJC1-asd-aspB(part), pJC1-gndS361F(part), and line-pJC1 were seamlessly assembled using the same recombinant cloning kit described above and transformed into Trans1. T1 competent cells were used to obtain the recombinant plasmid pJC1-gndS361F-asd-aspB. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC constructed in Example 1, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F_asd_aspB(pJC1).

[0144] Primer pair pJC1-asd-aspB-1 / pJC1-asd-aspB-2:

[0145] pJC1-asd-aspB-1: cgcgagggcgatcagcgacgccgcaggggggatccgagtatcgaaaaatttccacgtcaagttaact (SEQ ID No. 33);

[0146] pJC1-asd-aspB-2: taacttgacgtggaaatttttcgatactcttagttagcgtaatgctccgctgctgccaa (SEQ ID No. 34);

[0147] Primer pair pJC1-gndS361F-1 / pJC1-gndS361F-2:

[0148] pJC1-gndS361F-1:ttggcagcagcggagcattacgctaactaagagtatcgaaaaatttccacgtcaagtta (SEQ ID No. 35);

[0149] pJC1-gndS361F-2:GGAGGCCTTAttgttcgtcgtcgacttaagcttcaacctcggagcggtcgc (SEQ ID No. 36).

[0150] The mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F_asd_aspB(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the seed culture medium. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was determined to be 5.8 g / L by HPLC.

[0151] Example 9: Fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-gndS361F_asd_aspB(pJC1) in a 2L bioreactor.

[0152] The strain used for fermentation in the bioreactor was derived from a 1 mL cryovial of the mutant strain lysCS301Y-ΔlysE-ectABC-gndS361F_asd_aspB(pJC1). This was inoculated into a 1 L shake flask containing 100 mL of culture medium and incubated for 20 hours at 28°C and 160 rpm in a constant-temperature shaking incubator. The inoculum was then transferred to a 2 L bioreactor with an initial volume of 0.8 L and an inoculum size of 5%. The temperature was set at 28°C, the aeration ratio at 1.0 vvm, and the pH was maintained at 6.8 using 0.5 M H₂SO₄ and 25% NH₄OH. The stirring speed was linked to dissolved oxygen levels (DO was controlled to be no less than 20%). When the initial sugar was depleted, feeding was initiated at a rate of 10 g / h until fermentation was complete. During fermentation, 50% polysiloxane defoamer solution was added to control foam formation. After 96 hours of fermentation in a 2 L fermenter, the highest yield reached 142 g / L.

[0153] In summary, this invention uses *Corynebacterium glutamicum* as the starting strain and removes the feedback inhibition of aspartate kinase LysC through point mutation, thereby reducing or knocking out the activity of the gene lysE encoding lysine efflux permease. Then, the ectoin synthesis gene cluster ectABC is introduced. Based on this, the yield of ectoin is further increased by enhancing any one or at least two of the following genes: aspartate semialdehyde dehydrogenase Asd, aspartate transaminase AspB, and 6-phosphogluconate dehydrogenase Gnd. After 96 hours of fermentation in a 2L fermenter, the enhanced strain achieved a maximum yield of 142 g / L.

[0154] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. An engineered bacterium for producing an ectoine, characterized by, The engineered bacteria were prepared using a method comprising the following steps: (1) Using Corynebacterium glutamicum ATCC 13032 as the starting strain, the feedback inhibition of aspartate kinase LysC was relieved; the relief of feedback inhibition of aspartate kinase LysC was achieved by any one of the following methods (1) and (2): (1) introducing a LysC-S301Y site mutation; (2) introducing a LysC-T311I site mutation; (2) Knock out the gene lysE encoding lysine efflux permease; (3) Expressing the ectoin synthesis gene cluster ectABC; the nucleotide sequence of the ectoin synthesis gene cluster ectABC is shown in SEQ ID No. 37; (4) Introduce the GndS361F mutation to enhance the activity of 6-phosphoglucate dehydrogenase Gnd, introduce the asd gene to enhance the activity of aspartate semialdehyde dehydrogenase Asd, and introduce the aspB gene to enhance the activity of aspartate transaminase AspB, so as to further increase the yield of ectoin.

2. The engineered bacterium for producing an ectoine according to claim 1, characterized in that, In step (4), the asd gene is introduced via plasmid.

3. The engineered bacterium for producing an ectoine according to claim 1, characterized by, In step (4), the aspB gene is introduced via plasmid.

4. The engineered bacteria for producing ectoine according to claim 1, characterized in that, In step (4), the GndS361F site mutation is introduced through gene recombination or plasmid.

5. The engineered bacteria for producing ectoine according to claim 1, characterized in that, In step (3), the ectoin synthesis gene cluster ectABC is expressed by plasmid or chromosome integration.

6. The engineered bacteria for producing ectoine according to claim 1, characterized in that, The nucleotide sequence encoding the aspartic semialdehyde dehydrogenase Asd is shown in SEQ ID No.

38.

7. The engineered bacteria for producing ectoine according to claim 1, characterized in that, The nucleotide sequence encoding the aspartate transaminase AspB is shown in SEQ ID No.

39.

8. The engineered bacteria for producing ectoine according to claim 1, characterized in that, The nucleotide sequence encoding the 6-phosphoglucate dehydrogenase Gnd is shown in SEQ ID No.

40.

9. The use of an engineered strain for producing ectoine as described in any one of claims 1-8 in the fermentation of ectoine.

Citation Information

Patent Citations

  • Ectoine-producing yeast

    CN110914435A

  • Halobacillus and method for industrially producing Ectoin by using halobacillus

    CN112300957A

  • Tetrahydropyridine high-yield Corynebacterium glutamicum and application thereof

    CN110699310A

  • Engineered biosynthetic pathways for production of ectoine by fermentation

    WO2022173436A1