A method for the whole-cell catalyzed synthesis of n-acetyl-trans-4-hydroxyproline

Abstract

The present application relates to a kind of whole cell catalytic synthesis N-acetyl-trans-4-hydroxyproline method, belong to biological catalysis technical field.The present application is constructed by mutating acyltransferase and heterologous expression gene engineering bacteria, successfully realized using whole cell catalytic synthesis N-acetyl-trans-4-hydroxyproline, avoids the problem of enzyme instability, reduces the separation cost of enzyme and product.On this basis, the present application improves the yield of N-acetyl-trans-4-hydroxyproline by optimizing catalytic time, cell addition amount, the type and addition amount of additive, and the yield reaches 239mg / L.The present application is a kind of N-acetyl-trans-4-hydroxyproline preparation method with lower cost, lower equipment demand, more suitable for industrial production.

Description

TECHNICAL FIELD

[0001] The present application relates to a method for synthesizing N-acetyl-trans-4-hydroxyproline by whole cell catalysis, belonging to the field of biocatalysis. BACKGROUND

[0002] N-acetyl-trans-4-hydroxyproline is an important amino acid derivative, widely used in the fields of medicine and biological engineering. N-acetyl-trans-4-hydroxyproline can be catalytically synthesized by transferring acetyl from acyl donor to hydroxyproline through acyltransferase, but its biocatalytic synthesis is often limited by acyltransferase enzyme activity. Therefore, it is particularly important to select a suitable acyl donor to improve the synthesis efficiency of N-acetyl-trans-4-hydroxyproline on the basis of improving acyltransferase enzyme activity.

[0003] Although the prior art (CN113403350A) has disclosed the production of N-acetyl-trans-4-hydroxyproline by biological enzyme catalysis, the production enzyme needs to be separated and extracted from natural microorganisms, fungi or plants, which usually requires expensive equipment and a large amount of labor, resulting in high enzyme cost, which is difficult to meet the needs of large-scale production. In addition, the stability and stress resistance of the enzyme are also important factors that need to be further considered. In enzyme catalytic reaction, the target product usually needs to be separated and purified from the reaction mixture, which includes removing unreacted substrates, enzymes themselves and other impurities. The separation and purification process usually requires a lot of time and resources, and these additional costs will affect the economy of production. Most enzymes need a long reaction time in industrial scale production, and how to reduce the sensitivity of enzymes to external conditions (such as temperature, pH, ion concentration, etc.) to enhance their stability becomes another important challenge. The substrate selectivity and catalytic specificity of the enzyme are also important factors to be considered when synthesizing N-acetyl-trans-4-hydroxyproline, which helps to improve the conversion rate and separation and extraction of the product by ensuring that unwanted by-products are not generated or generated less. SUMMARY

[0004] To solve the above problems, the present application adopts whole cell catalysis to synthesize N-acetyl-trans-4-hydroxyproline. By heterologous expression of the gene engineering bacteria of mutant acyltransferase, the whole cell catalytic synthesis of N-acetyl-trans-4-hydroxyproline is successfully realized. Further by optimizing the catalytic time, the amount of bacteria added, the type and amount of additives, the yield of N-acetyl-trans-4-hydroxyproline is improved.

[0005] The first object of the present application is to provide an acyltransferase mutant, which is obtained by mutating the wild-type acyltransferase (the amino acid sequence is shown in SEQ ID NO. 2) and has the sequence shown in SEQ ID NO. 3. Further, the acyltransferase mutant shown in SEQ ID NO. 3 is further mutated at any one or more of positions 97 and 154. It is detected that the whole-cell catalysis using the genetically engineered bacteria expressing the wild-type acyltransferase (SEQ ID NO. 2) without mutation does not produce N-acetyl-trans-4-hydroxyproline, while the genetically engineered bacteria expressing the acyltransferase mutant have good ability of whole-cell catalysis for synthesizing N-acetyl-trans-4-hydroxyproline.

[0006] The second object of the present application is to provide the use of the above-mentioned acyltransferase mutant in catalyzing the synthesis of N-acetyl-trans-4-hydroxyproline, and to provide a method for whole-cell catalysis for synthesizing N-acetyl-trans-4-hydroxyproline. The method uses the living cells of the genetically engineered strain expressing the acyltransferase mutant to catalyze the synthesis of N-acetyl-trans-4-hydroxyproline from trans-4-hydroxyproline, wherein the amino acid sequence of the acyltransferase mutant is shown in SEQ ID NO. 3, or the amino acid sequence of the acyltransferase mutant is further mutated at any one or more of positions 97 and 154 based on SEQ ID NO. 3.

[0007] In an embodiment, the lysine at position 97 is mutated to alanine.

[0008] In an embodiment, the phenylalanine at position 154 is mutated to alanine.

[0009] In an embodiment, the lysine at position 97 is mutated to alanine, and further the phenylalanine at position 154 is mutated to alanine.

[0010] In an embodiment, the amount of trans-4-hydroxyproline added is 5-200 g / L, and optionally, 30-50 g / L.

[0011] In an embodiment, the acyl donor is contained in the whole-cell catalysis system.

[0012] In an embodiment, the amount of acyl donor added is 0.5-20% v / v, and optionally, 5-15% v / v.

[0013] In an embodiment, the acyl donor can be one or more of the following: ethyl acetate, vinyl acetate, isopropyl acetate, isopropenyl acetate, isoamyl acetate, and p-nitrophenyl acetate.

[0014] In one embodiment, the whole cell catalytic system further comprises a surfactant.

[0015] In one embodiment, the surfactant is added in an amount of 0.5-5% v / v, optionally 0.5-2% v / v.

[0016] In one embodiment, the surfactant is one or more of DMSO, isopropanol, glycerol, PEG 4000, Triton X-100, Tween 80.

[0017] In one embodiment, the genetically engineered bacterial strain is added in an amount of 0.2-3*10 10 CFU / mL.

[0018] In one embodiment, the catalytic synthesis time is 3-24h.

[0019] In one embodiment, the catalytic synthesis reaction is carried out at 25-35℃, 180-220rpm.

[0020] In one embodiment, the genetically engineered bacteria is cultured in ZYBM9 medium at 37℃, 220rpm to OD 600 =0.8-1.0, and induced with lactose at a final concentration of 400μM at 20℃, 220rpm for 16h, and centrifuged to obtain the whole cell catalyst.

[0021] In one embodiment, the whole cell catalysis is carried out by resuspending the wet bacterial cells in phosphate buffer, and the reaction system comprises 40g / L trans-4-hydroxyproline, 10% (v / v) ethyl acetate, 0.5-2% (v / v) DMSO, and 0.2-3*10 10 CFU / mL.

[0022] The application also provides the use of the mutant in the synthesis of N-acetyl-trans-4-hydroxyproline.

[0023] Advantages

[0024] Unlike the enzymatic production of N-acetyl-trans-4-hydroxyproline, the application realizes the whole cell catalysis of N-acetyl-trans-4-hydroxyproline by constructing a genetically engineered bacteria expressing acyltransferase exogenously, optimizes the catalytic conditions, and further improves the yield of N-acetyl-trans-4-hydroxyproline. The application avoids the problem of unstable enzyme catalysis, and reduces the cost of enzyme and product separation.

[0025] The application finds that the genetically engineered bacteria expressing wild-type acyltransferase cannot detect the activity of N-acetyl-trans-4-hydroxyproline in whole cell catalysis; the application constructs acyltransferase mutants, and the genetically engineered bacteria expressing the mutated acyltransferase can better catalyze the synthesis of N-acetyl-trans-4-hydroxyproline; and the application further optimizes the conditions of whole cell catalysis.

[0026] In particular, when the substrate trans-4-hydroxyproline is added in an amount of 40 g / L, ethyl acetate is added in an amount of 10% (v / v), DMSO is added in an amount of 1% (v / v), and the genetically engineered strain BL21 (DE3) / pET22b-MsAcT (S11C) wet bacteria are added in an amount of 2*10 10 CFU / mL, the reaction is carried out at 35°C and 220 rpm, and the conversion rate of N-acetyl-trans-4-hydroxyproline reaches 0.552% and the yield reaches 239 mg / L after 6 hours of catalysis. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 : The yield of N-acetyl-trans-4-hydroxyproline synthesized by whole cell catalysis of the genetically engineered bacteria expressing acyltransferase mutants;

[0028] Figure 2 : The HPLC and LC-MS graphs of N-acetyl-trans-4-hydroxyproline standard; the upper graph is HPLC analysis, and the lower graph is LC-MS analysis;

[0029] Figure 3 : The HPLC and LC-MS graphs of N-acetyl-trans-4-hydroxyproline in the whole cell catalysis sample of the genetically engineered strain expressing the acyltransferase S11C mutant; the upper graph is HPLC analysis, and the lower graph is LC-MS analysis. DETAILED DESCRIPTION

[0030] The technical solutions of the application will be described below in conjunction with the embodiments of the application. Obviously, the described embodiments are only a part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative efforts fall within the protection scope of the application.

[0031] 1. ZYBM9 medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 5 g / L, glucose 4 g / L, KH2PO4 3 g / L, NH4Cl 1 g / L, Na2HPO4 6 g / L, MgSO4·7H2O 0.246 g / L

[0032] 2. Pretreatment of the catalysis sample:

[0033] The supernatant was taken after centrifugation of the whole cell catalytic sample at 12000 rpm for 10 min, and 50 μL of the supernatant was subjected to pre-column derivatization. The derivatization procedure was as follows: 50 μL of the supernatant was mixed with 50 μL of 50 mM 2-NPH and 100 μL of 25 mM EDC-HCl, and then incubated at 80°C in a metal bath for 5 min. 200 μL of 1 M NaOH was added, and then incubated at 80°C in a metal bath for 5 min to obtain a derivatized solution. The derivatized solution was filtered through a 0.22 μm filter membrane and then used for HPLC detection.

[0034] 3. HPLC detection conditions for N-acetyl-trans-4-hydroxyproline:

[0035] An Agilent high-performance liquid chromatograph was used for liquid separation through a Diamond C-18, 4.6*250 mm column: a flow rate of 0.5 mL / min, a mobile phase A of 90% water and 10% acetonitrile (containing 25 mM pH=6 sodium phosphate buffer), a mobile phase B of 40% water and 60% acetonitrile (containing 25 mM pH=6 sodium phosphate buffer), a gradient elution strategy of increasing from 10% B to 100% B within 20 min, and decreasing from 100% B to 10% B within 20-25 min. The column temperature was 45°C, and the detection wavelength was 420 nm. A single sample was run for 25 min.

[0036] 4. Calculation of the conversion rate of N-acetyl-trans-4-hydroxyproline:

[0037] Actual molar amount of N-acetyl-trans-4-hydroxyproline in the system / total molar amount of N-acetyl-trans-4-hydroxyproline in the system * 100%.

[0038] 5. LC-MS analysis method:

[0039] Instrument name: Triple quadrupole liquid chromatograph-mass spectrometer (LCMSMS)

[0040] Brand: Thermo Scientific

[0041] Mass spectrometer model: TSQ Quantum Ultra EMR, liquid chromatograph model: Dionex UltiMate 3000;

[0042] Ion source type: Atmospheric pressure electrospray source H-ESI II probe.

[0043] Chromatographic column model: Waters ACQUITY UPLC BEH C18 100 mm*2.1 mm*1.7 μm;

[0044] Liquid chromatograph flow rate: 0.2 mL / min;

[0045] Injection volume: 0.5 μL;

[0046] Spray Voltage: 3200 V in positive ion mode, 2800 V in negative ion mode;

[0047] Vaporizer Temperature: 50℃;

[0048] Sheath Gas Pressure: 35;

[0049] Ion Sweep Gas Pressure: 0;

[0050] Aux Gas Pressure: 15;

[0051] Capillary Temperature: 350℃.

[0052] Example 1: Point mutation S11C, construction of acyltransferase mutant, construction of acyltransferase expression engineering bacteria

[0053] The nucleotide sequence of the wild-type acyltransferase (MsAcT) is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2. The serine at position 11 of the wild-type acyltransferase is point mutated to cysteine, obtaining an acyltransferase mutant with the sequence shown in SEQ ID NO. 3, which is named S11C according to "amino acid before mutation + mutation site + amino acid after mutation", and a genetically engineered strain is constructed, named BL21(DE3) / pET22b-MsAcT(S11C), as follows:

[0054] (1) Construction of pET22b-MsAcT

[0055] Table 1 Primer sequences

[0056]

[0057] Using the above primers, the wild-type acyltransferase MsAcT sequence is connected to the pUC19 vector (named pUC19-MsAcT plasmid) using the commercial plasmid pET22b as the backbone, and the target gene template is used to perform linear amplification by PCR technology. After linear amplification, the One Step Seamless Cloning Mix homologous recombination enzyme is used to incubate at 50℃ for 30 min, so that the target gene MsAcT is connected to the pET22b vector, obtaining pET22b-MsAcT.

[0058] (2) 11th serine is mutated to cysteine

[0059] Table 2 S11C primer sequence

[0060]

[0061] Based on the above primer, site-directed mutation was carried out by PCR technology, and after site-directed mutation, Dpnl fast cutting enzyme was used to digest the template at 37°C for 1h to obtain the mutant recombinant vector pET22b-MsAcT(S11C).

[0062] (3) Construction of engineering strain (BL21(DE3) / pET22b-MsAcT(S11C))

[0063] The prepared BL21(DE3) competent cells stored at -80°C were taken for transformation of the recombinant vector.

[0064] 10μL of pET22b-MsAcT(S11C) recombinant plasmid was taken and added to the BL21(DE3) competent cells melted on ice, and then incubated on ice for 30min. Heat shock at 42°C for 90s, ice bath for 5min. Add 500μL of LB medium, mix gently, and incubate at 37°C, 200rpm on a shaker for 40min.

[0065] Centrifuge the bacterial solution, discard 500μL of supernatant, mix by blowing and sucking, and then spread on LB solid plate with ampicillin (Amp) resistance, and incubate at 37°C overnight. It is verified that the genetically engineered strain BL21(DE3) / pET22b-MsAcT(S11C) containing the recombinant plasmid pET22b-MsAcT(S11C) is obtained.

[0066] In the same way, based on the amino acid sequence SEQ ID NO. 3, the mutation sites N94A, K97A, F154A, K97A / F154A were mutated, wherein K97A / F154A was mutated at two sites; N94A was mutated to alanine at the 94th asparagine, and the corresponding genetically engineered strain was constructed, and was named BL21(DE3) / pET22b-MsAcT(S11C / N94A), BL21(DE3) / pET22b-MsAcT(S11C / K97A), BL21(DE3) / pET22b-MsAcT(S11C / F154A), BL21(DE3) / pET22b-MsAcT(S11C / K97A / F154A). The primer sequences of mutation sites N94A, K97A, F154A are as follows:

[0067] Table 3 N94A, K97A, F154A primer sequences

[0068]

[0069] Example 2: Optimization of whole cell catalytic reaction conditions

[0070] 1. Optimization of catalytic time:

[0071] (1) Preparation of wet cells

[0072] The genetically engineered strain BL21(DE3) / pET22b-MsAcT(S11C) prepared in Example 1 was used to prepare wet cells, and the specific steps were as follows:

[0073] The genetically engineered strain BL21(DE3) / pET22b-MsAcT(S11C) was inoculated into 5 mL of LB medium and incubated overnight at 37°C with 220 rpm shaking. Then, it was inoculated into 50 mL of ZYBM9 medium at a 1% v / v inoculation amount and incubated at 37°C with 220 rpm shaking until the OD 600 = 0.8-1.0, 400 μM of lactose was added, and the induction was carried out at 20°C with 220 rpm for 16 h. All the wet cells were collected by centrifugation at 4°C and 8000 rpm for whole cell catalysis.

[0074] (2) Optimization of whole cell catalytic time

[0075] Using a 10 mL reaction system, the wet cells prepared in step (1) were resuspended in 100 mM potassium phosphate buffer (pH = 7) to carry out catalytic reactions in a whole cell reaction system. The reaction system included 40 g / L trans-4-hydroxyproline, 10% (v / v) ethyl acetate, 1% (v / v) DMSO, 2*10 10 CFU / mL, and the reaction was carried out at 35°C with 220 rpm for 3-24 h. The yield of N-acetyl-trans-4-hydroxyproline was detected at different reaction times.

[0076] The results are shown in Table 4. The highest yield was obtained after 6 h of whole cell catalysis, and the yield reached 239 mg / L.

[0077] Table 4 Whole cell catalytic production of N-acetyl-trans-4-hydroxyproline

[0078] Time (h) 3 6 9 12 15 18 21 24 Yield (g / L) 0.143 0.239 0.153 0.102 0.092 0.083 0.063 0.062

[0079] 2. Optimization of wet cell concentration:

[0080] (1) Preparation of wet cells

[0081] The method is consistent with step (1) of "1. Optimization of catalysis time".

[0082] (2) Optimization of wet cell concentration

[0083] Using 10 mL reaction system, the reaction system contains: 100 mM potassium phosphate buffer (pH = 7), ethyl acetate 10% (v / v), trans-4-hydroxyproline 40 g / L, DMSO 1% (v / v), and the wet cell concentration of genetically engineered strain BL21 (DE3) / pET22b-MsAcT (S11C) is 0.5*10 10 CFU / mL, 1*10 10 CFU / mL, 1.5*10 10 CFU / mL, 2*10 10 CFU / mL, 3*10 10 CFU / mL, catalysis is carried out at 35°C, 220 rpm, and the yield of N-acetyl-trans-4-hydroxyproline is detected after 6h.

[0084] The results are shown in Table 5. When the wet cell concentration is 2*10 10 CFU / mL, the yield reaches 230 mg / L, and when the wet cell concentration is 3*10 10 CFU / mL, the yield is 238 mg / L, which is very small. Therefore, 2*10 10 CFU / mL is the optimal wet cell concentration.

[0085] Table 5 Effect of wet cell concentration on catalysis

[0086] wet cell concentration (10 10 CFU / mL) 0.5 1 1.5 2 3 Yield (g / L) 0.133 0.212 0.230 0.238 0.240

[0087] 3. Optimization of additive type:

[0088] (1) Preparation of wet cells

[0089] The method is consistent with step (1) of "1. Optimization of catalysis time".

[0090] (2) Optimization of additive type

[0091] Using 10 mL reaction system, the reaction system contains: 100 mM potassium phosphate buffer (pH = 7), ethyl acetate 10% (v / v), trans-4-hydroxyproline 40 g / L, and 1% (v / v) of isopropyl alcohol, glycerol, DMSO, PEG 4000, TritonX-100, Tween 80 is added respectively, and the wet cell concentration of genetically engineered strain BL21 (DE3) / pET22b-MsAcT (S11C) is 2*10 10CFU / mL, catalysis was carried out at 35℃, 220 rpm, and the yield of N-acetyl-trans-4-hydroxyproline was detected after 6h. The results are shown in Table 3.

[0092] As shown in Table 6, the yield reached 0.242 mg / L with the addition of 1% DMSO, which was better than isopropanol, glycerol, PEG 4000, Triton X-100 and Tween 80.

[0093] Table 6 Effect of additive type on catalysis

[0094] Additive type Isopropanol Glycerol DMSO PEG 4000 Triton X-100 Tween 80 Yield (g / L) 0.236 0.088 0.242 0.180 0.132 0.126

[0095] 4. Optimization of additive concentration:

[0096] (1) Preparation of wet bacteria

[0097] The method is consistent with step (1) of "1. Optimization of catalysis time".

[0098] (2) Optimization of additive amount

[0099] A 10 mL reaction system was used, which contained: 100 mM potassium phosphate buffer (pH = 7), 10% (v / v) ethyl acetate, 40 g / L trans-4-hydroxyproline, and 0.5%, 1%, 1.5%, and 2% (v / v) DMSO, respectively. The concentration of the wet bacteria of the genetically engineered strain BL21(DE3) / pET22b-MsAcT(S11C) was 2*10 10 CFU / mL, catalysis was carried out at 35℃, 220 rpm, and the results are shown in Table 7.

[0100] The yields of 1%, 1.5%, and 2% (v / v) DMSO had little difference, among which the conversion rate was the highest at 1.5% addition, reaching 0.564%, and the yield reached 242 mg / L. Considering the cost of addition, 1% v / v DMSO was the most suitable addition amount.

[0101] Table 7 Effect of additive concentration on catalysis

[0102] Additive concentration % 0.5 1 1.5 2 Yield (g / L) 0.197 0.241 0.242 0.240

[0103] Example 2: Application of whole-cell catalysis in the synthesis of N-acetyl-trans-4-hydroxyproline

[0104] (1) Cultivation of engineered strain

[0105] The wet bacteria of genetically engineered strains BL21(DE3) / pET22b-MsAcT(S11C), BL21(DE3) / pET22b-MsAcT(S11C / N94A), BL21(DE3) / pET22b-MsAcT(S11C / K97A), BL21(DE3) / pET22b-MsAcT(S11C / F154A), BL21(DE3) / pET22b-MsAcT(S11C / K97A / F154A) were prepared respectively, and the method was consistent with step (1) of "1, catalytic time optimization" in Example 1.

[0106] (2) Whole-cell catalysis in the synthesis of N-acetyl-trans-4-hydroxyproline

[0107] The whole-cell catalysis was carried out using the optimal reaction conditions in Example 1, and the specific steps were as follows:

[0108] The wet bacteria prepared in step (1) were suspended in 100 mM potassium phosphate buffer (pH = 7) respectively, and the catalytic reaction was carried out in the whole-cell reaction system, which included 40 g / L trans-4-hydroxyproline, 10% (v / v) ethyl acetate, 1% (v / v) DMSO, 2*10 10 CFU / mL, and the reaction was carried out at 35°C, 220 rpm, and after 6 h of catalysis, the yield of synthesized N-acetyl-trans-4-hydroxyproline was detected.

[0109] 1 mL of sample of genetically engineered strain BL21(DE3) / pET22b-MsAcT(S11C) was centrifuged at 12000 rpm for 10 min, and the supernatant was taken, 50 μL of which was used for HPLC and LC-MS analysis after pre-column derivatization. The results, as shown in Figure 2 、 Figure 3 , showed that N-acetyl-trans-4-hydroxyproline was successfully synthesized.

[0110] The catalysis results of different genetically engineered strains are shown in Figure 1 . The yield of N-acetyl-trans-4-hydroxyproline synthesized by genetically engineered strain BL21(DE3) / pET22b-MsAcT(S11C) reached 239 mg / L.

[0111] Example 3: Synthesis of N-acetyl-trans-4-hydroxyproline with different acyl donors

[0112] (1) Cultivation of engineered strains

[0113] The genetically engineered strain BL21(DE3) / pET22b-MsAcT(S11C) was prepared, and the method was consistent with step (1) of "1, catalytic time optimization" in Example 1.

[0114] (2) Whole cell catalysis in synthesis of N-acetyl-trans-4-hydroxyproline

[0115] The effect of different acyl donors on the synthesis of N-acetyl-trans-4-hydroxyproline was detected respectively. 10% (v / v) of ethyl acetate, vinyl acetate, isopropyl acetate, isopropenyl acetate, isoamyl acetate, p-nitrophenyl acetate was added respectively, and the rest was consistent with step (2) of Example 2. The yield of N-acetyl-trans-4-hydroxyproline synthesized was detected.

[0116] Table 8 Effect of different acyl donors on catalysis

[0117]

[0118] As shown in Table 8, different acyl donors can catalyze the synthesis of N-acetyl-trans-4-hydroxyproline.

[0119] Comparative Example 1: Whole cell catalysis by using genetically engineered bacteria expressing wild-type acyltransferase

[0120] Based on the nucleotide sequence of the wild-type acyltransferase shown in SEQ ID NO. 1, a genetically engineered bacterial strain was constructed, and the construction method was consistent with "(3) Construction of engineered strain (BL21(DE3) / pET22b-MsAcT)" in Example 1. The same method as in Example 2 was used to collect the genetically engineered bacterial cells and perform whole cell catalysis experiment, and the yield of N-acetyl-trans-4-hydroxyproline synthesized by whole cell catalysis of the strain BL21(DE3) / pET22b-MsAcT was detected. The results showed that no N-acetyl-trans-4-hydroxyproline was detected in the product.

[0121] SEQ ID NO. 1 Nucleotide sequence of wild-type acyltransferase MsAcT

[0122] ATGGCCAAACGCATCTTATGTTTCGGAGACTCCCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCTGCCCGTACGACAAACATCGATGATCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCACTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACGGAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA

[0123] SEQ ID NO. 2 Acyltransferase MsAcT wild type amino acid sequence

[0124] MAKRILCFGD S LTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0125] SEQ ID NO. 3 Acyltransferase Mutant S11C Amino Acid Sequence

[0126] MAKRILCFGD C LTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0127] Part of the steps in the embodiments of the present application can be realized by software, and the corresponding software program can be stored in a readable storage medium, such as an optical disc or a hard disk.

[0128] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A process for the whole cell catalyzed synthesis of N-acetyl-trans-4-hydroxyproline, characterized in that, The application discloses a method for catalyzing synthesis of N-acetyl-trans-4-hydroxyproline by using a genetically engineered strain expressing an acyltransferase mutant as a substrate of trans-4-hydroxyproline; the amino acid sequence of the acyltransferase mutant is shown as SEQ ID NO. 3, or the amino acid sequence of the acyltransferase mutant is further mutated at any one or more of positions 97, 154 based on SEQ ID NO.

3. The lysine at position 97 is mutated into alanine. The phenylalanine at position 154 is mutated into alanine.

2. The method of claim 1, wherein, The lysine at position 97 is mutated into alanine, and the phenylalanine at position 154 is further mutated into alanine.

3. The method of claim 1, wherein, The addition amount of the trans-4-hydroxyproline is 5-200 g / L.

4. The method of claim 1, wherein, The method further adds an acyl donor.

5. The method of claim 4, wherein, The addition amount of the acyl donor is 0.5%-20% v / v.

6. The method of claim 1, wherein, The method further adds a surfactant.

7. The method of claim 6, wherein, The addition amount of the surfactant is 0.5%-5% v / v.

8. The method of claim 1, wherein, The genetically engineered bacterial strain is added in an amount of 0.2 x 10 10 3 x 10 10 CFU / mL to obtain a final concentration of 0.2 x 10 3 x 10 CFU / mL.

9. The acyltransferase mutant with the amino acid sequence shown as SEQ ID NO. 3 is applied to catalyze synthesis of N-acetyl-trans-4-hydroxyproline.

Images