Application of E4bp4 in hematological diseases such as multiple myeloma

By studying the expression and function of E4BP4 in multiple myeloma, we discovered that it serves as a prognostic risk diagnostic factor and a therapeutic target. We developed an E4BP4 inhibitor that can be used in combination with dexamethasone, which solved the treatment challenges of multiple myeloma and improved treatment efficacy and prognosis.

CN117723754BActive Publication Date: 2026-03-27THE AFFILIATED HOSPITAL OF GUIZHOU MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311582526.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-17
Publication Date
2026-03-27
Estimated Expiration
2044-01-17

AI Technical Summary

Technical Problem

Current treatments for multiple myeloma have not yet provided a complete cure, and the rates of relapse and drug resistance are high. Furthermore, there is a lack of effective prognostic risk diagnostic factors and therapeutic targets.

Method used

By studying the expression level and function of E4BP4 in multiple myeloma, we discovered that it serves as a prognostic risk diagnostic factor and developed an E4BP4 inhibitor to be used in combination with dexamethasone to enhance the apoptosis effect on multiple myeloma cells.

Benefits of technology

E4BP4 can serve as a prognostic marker for multiple myeloma and can be used for diagnosis and treatment. Knockdown of E4BP4 can enhance the anti-myeloma effect of dexamethasone by inducing autophagy and promoting apoptosis, providing a new treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117723754B_ABST
    Figure CN117723754B_ABST
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, in particular, the application of E4BP4 in hematological diseases such as multiple myeloma. The present application proves that E4BP4 can be used as a potential biomarker and prognostic indicator for predicting the development of multiple myeloma, which is helpful for the treatment of multiple myeloma. Moreover, the E4BP4 protein can be used in the preparation of MM promoting reagents, which can be further used in the amplification of MM cells, the preparation of MM tumor metastasis models, the screening of MM treatment drugs and the like. After knocking down E4BP4, autophagy is induced and MM cell apoptosis is promoted, thereby enhancing the anti-myeloma effect of dexamethasone on MM. E4BP4 inhibitory drugs can be used as anti-myeloma drugs together with dexamethasone.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular, the application of E4BP4 in hematological diseases such as multiple myeloma. BACKGROUND

[0002] Multiple myeloma is a malignant clonal disease of plasma cells, characterized by replacement of normal bone marrow by malignant plasma cells, leading to bone destruction and excessive production of abnormal immunoglobulins, and through extramedullary infiltration to invade organs such as liver, spleen, lymph nodes, etc. to cause osteolytic lesions, hypercalcemia, anemia, kidney damage and a series of clinical symptoms and signs. The annual incidence is about 4 / 10 million people, accounting for about 10% of the incidence of hematological diseases. With the continuous development of various treatment methods such as chemotherapy, targeted therapy, immunotherapy, the survival rate of multiple myeloma patients has been greatly improved. However, so far, a drug that can completely cure multiple myeloma patients has not been developed, and the relapse and drug resistance rates are high, and the prognosis of refractory patients with relapse is still poor. Therefore, through the study of the pathogenesis of multiple myeloma, exploring new targets is of great importance to improve the survival prognosis and treatment effect of patients with relapse and refractory.

[0003] E4BP4 (E4 Promoter-Binding Protein 4) is also known as NFIL3 (Nuclear factor, interleukin 3 regulate). It was initially identified as a transcriptional regulator of circadian rhythm, and more and more evidence has shown that E4BP4 plays a role in the occurrence and development of malignant tumors. E4BP4 is significantly increased in the expression of various types of tumor cells, including choriocarcinoma, osteosarcoma, lung cancer, thyroid cancer, etc. It enhances the apoptosis, invasion and metastasis of tumor cells by transcriptionally regulating target genes through different ways and pathways. In previous studies, it has been found that E4BP4 affects the growth of osteoblasts by affecting PTHrP, and there is no related research on the function and molecular mechanism of E4BP4 affecting MM cell apoptosis.

[0004] At present, there is no research on the role, function and mechanism of E4BP4 in the occurrence and development of multiple myeloma at home and abroad. Therefore, determining the expression level of E4BP4 in multiple myeloma tissue and the potential prognostic value of E4BP4, especially the relationship between E4BP4 and multiple myeloma and the molecular mechanism, finding new targets for the diagnosis and treatment of multiple myeloma, is the focus of current research and has very important practical significance. SUMMARY

[0005] In order to solve the above technical problems in the prior art, the present application provides the application of E4BP4 in hematological diseases such as multiple myeloma. Specifically, it is realized by the following technical scheme:

[0006] Application of E4BP4 in prognosis of multiple myeloma. E4BP4 is significantly highly expressed in MM patients and U266, RPMI8226 cell lines; the expression of E4BP4 is significantly related to CD8+ T cells in MM patients, and high expression of E4BP4 can cause a decrease in the number of CD8+ T cells; MM patients with high expression of E4BP4 have a poorer prognosis, and can be used as an independent prognostic risk diagnostic factor and are significantly related to MM progression.

[0007] Further, the multiple myeloma prognosis aspect is the aspect of using E4BP4 as a multiple myeloma prognosis marker.

[0008] Further, the multiple myeloma prognosis aspect is the aspect of using E4BP4 as a multiple myeloma prognosis marker.

[0009] When the expression level of E4BP4 is higher than the normal value, autophagy and apoptosis of multiple myeloma are inhibited, and the prognosis is poor; when the expression level of E4BP4 is normal or low, autophagy and apoptosis of multiple myeloma are promoted, and the prognosis is good. Overexpression of E4BP4 inhibits U266 cell apoptosis, and knockdown of E4BP4 promotes U266 cell apoptosis; overexpression of E4BP4 inhibits U266 cell autophagy, and knockdown of E4BP4 activates U266 cell autophagy.

[0010] A multiple myeloma prognosis evaluation reagent or kit contains a reagent for detecting whether the DNA / protein expression concentration / titer of E4BP4 is increased. The reagent for increasing is: gene editing technology, recombinant biotechnology, and increasing the expression of E4BP4 by controlling the upstream inhibitor of E4BP4 through shRNA technology. The method used in this experiment is virus infection, and we can adopt the corresponding method according to the actual situation.

[0011] Application of E4BP4 in diagnosis of multiple myeloma, specifically in application of multiple myeloma diagnosis reagent or kit, the reagent or kit contains a reagent for detecting whether the DNA / protein expression concentration / titer of E4BP4 is increased, when the expression level of E4BP4 is higher than the normal value, the possibility of multiple myeloma is higher, and when the expression level of E4BP4 is normal or low, the possibility of multiple myeloma is lower.

[0012] Application of E4BP4 protein in preparation / as a multiple myeloma promoting reagent. Further, the multiple myeloma promoting reagent is a reagent for promoting the development of multiple myeloma.

[0013] E4BP4 is highly expressed in multiple myeloma and promotes the progression of MM, and high expression of E4BP4 can inhibit MM cell apoptosis, can be used for preparing / as a multiple myeloma promoting agent, and can be further used for multiple myeloma cell amplification, preparation of multiple myeloma animal models, screening of multiple myeloma treatment drugs, etc.

[0014] The application of the E4BP4 inhibitor drug in the preparation / as an anti-multiple myeloma drug.

[0015] Further, the E4BP4 inhibitor drug is an E4BP4 inhibitor.

[0016] Further, the preparation / as an anti-multiple myeloma drug is the use of the E4BP4 inhibitor drug dexamethasone as an anti-multiple myeloma drug.

[0017] Further, the preparation / as an anti-multiple myeloma drug is the use of the E4BP4 inhibitor drug and the HDAC3 inhibitor drug and dexamethasone as an anti-multiple myeloma drug.

[0018] Further, the anti-multiple myeloma drug is an anti-drug-resistant multiple myeloma drug.

[0019] After using the E4BP4 inhibitor drug to inhibit E4BP4, autophagy is induced and MM cell apoptosis is promoted, and the anti-myeloma effect of dexamethasone on MM can be enhanced at the same time. We found that knocking down E4BP4 enhances the pro-apoptotic ability of dexamethasone on MM cells. The combination of E4BP4 knockdown and dexamethasone treatment will maximize the stress level of MM cells, leading to excessive activation of autophagy, and then further leading to cell death of MM.

[0020] Compared with the prior art, the technical effects of the present application are embodied in:

[0021] (1) The present application finds that E4BP4 is significantly highly expressed in MM patients and U266, RPMI8226 cell lines; the expression of E4BP4 is significantly related to CD8+ T cells in MM patients, and high expression of E4BP4 can cause a decrease in the number of CD8+ T cells; MM patients with high expression of E4BP4 have a poorer prognosis, and E4BP4 can be used as an independent prognostic risk diagnostic factor and is significantly related to MM progression. It is shown that an increase in the content or concentration of E4BP4 can cause multiple myeloma, and can be used for preparing a multiple myeloma diagnostic reagent / kit.

[0022] (2) The present application finds that overexpression of E4BP4 inhibits U266 cell apoptosis, and knockdown of E4BP4 promotes U266 cell apoptosis; overexpression of E4BP4 inhibits U266 cell autophagy, and knockdown of E4BP4 activates U266 cell autophagy; high expression of E4BP4 inhibits apoptosis by inhibiting autophagy of U266 cells; E4BP4 promotes transcription of HDAC3 by binding to the promoter of HDAC3, and can down-regulate the acetylation level of H3K9Ac and H3K27Ac of Beclin1 promoter; E4BP4 may have an inhibitory effect on U266 cell autophagy and apoptosis by up-regulating HDAC3. It is found for the first time that E4BP4 promotes the progression of MM, and E4BP4 protein can be used in the preparation of / as an MM promoting agent, and can be further used in MM cell expansion, preparation of MM tumor metastasis model, screening of MM treatment drugs, etc.

[0023] (3) Dexamethasone is a commonly used drug for treating multiple myeloma, but with the passage of time, its clinical application is more and more, and some patients develop drug resistance and recurrence, ultimately reducing its efficacy. The present application confirms that knockdown of E4BP4 enhances the pro-apoptotic ability of dexamethasone on MM cells. However, compared with dexamethasone alone or knockdown of HDAC3 alone, knockdown of HDAC3 combined with dexamethasone does not show further apoptosis of MM cells, but knockdown of E4BP4 combined with knockdown of HDAC3 maximally increases the pro-apoptotic ability of dexamethasone on MM cells. These results show that the combination of knockdown of E4BP4 combined with dexamethasone treatment maximally increases the stress level of MM cells, leading to excessive activation of autophagy, and then further leading to cell death of MM. It provides a new theoretical basis for the targeted therapy of MM at the in vitro level in the clinical treatment strategy. Knockdown of E4BP4 enhances the anti-myeloma effect of dexamethasone on MM by inducing autophagy and promoting MM cell apoptosis.

[0024] In summary, E4BP4 can be used as a potential biomarker for predicting the development of multiple myeloma and a prognostic indicator, which is helpful for the treatment of multiple myeloma. Moreover, E4BP4 protein can be used in the preparation of / as an MM promoting agent, and can be further used in MM cell expansion, preparation of MM tumor metastasis model, screening of MM treatment drugs, etc. Knockdown of E4BP4 enhances the anti-myeloma effect of dexamethasone on MM by inducing autophagy and promoting MM cell apoptosis, so E4BP4 inhibitor can be used as an anti-myeloma drug together with dexamethasone. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is the CCLE cell line database analyzing the differential expression of E4BP4 in MM cell lines and other solid tumors and other hematological tumor cell lines.

[0026] Figure 2 Figure 6 is Oncomine combined with GEO dataset analysis E4BP4 expression difference between MM patients and normal samples.

[0027] Figure 3 Figure 7 is E4BP4 protein expression difference between MM patients and U266, RPMI8226 cell lines and healthy donors.

[0028] Figure 4 Figure 8 is K-M curve of E4BP4 expression level in GSE136400 MM dataset and OS, PFS correlation and predicted 1 year, 3 year, 5 year ROC curve.

[0029] Figure 5 Figure 9 is K-M curve of E4BP4 expression in TCGA-MMRF-coMMpass validation set and MM prognosis and predicted 1 year, 3 year, 5 year ROC curve.

[0030] Figure 6 Figure 10 is correlation analysis of E4BP4 expression and each clinical factor in 30 collected patients.

[0031] Figure 7 Figure 11 is immunohistochemical staining to detect E4BP4 and Bcl2 protein expression in different stages of MM patients.

[0032] Figure 8 Figure 12 is correlation analysis of each immune cell in MM microenvironment and differential expression of E4BP4 in different immune cells and in CD8+ T cells.

[0033] Figure 9 Figure 13 is immunohistochemical staining to detect CD8 expression in MM patients in stage II (low E4BP4 expression) and stage III (high E4BP4 expression).

[0034] Figure 10 Figure 14 is Western blot to verify the efficiency of knocking down and overexpressing E4BP4.

[0035] Figure 11 Figure 15 is Western blot to detect the expression changes of apoptosis-related proteins Bcl2 and Bax in U266 cells after knocking down and overexpressing E4BP4.

[0036] Figure 12 Figure 16 is CCK-8 to detect the effect of knocking down and overexpressing E4BP4 on U266 cell proliferation.

[0037] Figure 13 Figure 17 is flow cytometry to detect the apoptosis rate of U266 cells after knocking down and overexpressing E4BP4.

[0038] Figure 14 Figure 9 is Tunel staining to detect the effect of knocking down and overexpressing E4BP4 on U266 cell apoptosis, scale bar = 50 pm.

[0039] Figure 15 Figure 10 is transmission electron microscopy to detect the changes in apoptosis-related features after knocking down and overexpressing E4BP4, red arrows represent nuclear fragments, scale bar = 2 pm.

[0040] Figure 16 Figure 11 is GSEA enrichment analysis of differentially expressed genes of E4BP4 high and low expression MM patients in GSE136400.

[0041] Figure 17 Figure 12 is Western blot to detect the expression changes of autophagy-related proteins LC3, Beclinl, P62, and phosphorylated mTOR and mTOR total protein in U266 cells after knocking down and overexpressing E4BP4.

[0042] Figure 18 Figure 13 is RT-qPCR to detect the mRNA expression changes of autophagy-related genes Beclinl, P62, ATG5, ATG7 in U266 cells overexpressing E4BP4.

[0043] Figure 19 Figure 14 is endogenous LC3 immunofluorescence to detect the intensity changes of U266 cell autophagy after knocking down and overexpressing E4BP4, scale bar = 25 pm.

[0044] Figure 20 Figure 15 is transmission electron microscopy to observe the changes in U266 cell autophagy-related features after knocking down E4BP4, red arrows represent primary lysosomes, blue arrows represent autophagosomes, scale bar = 2 pm.

[0045] Figure 21 Figure 16 is Western blot to detect the expression changes of LC3, Beclinl, P62, Bcl2, Bax in U266 cells knocking down E4BP4 treated with autophagy inhibitor 3-MA (10 mmol / L) for 24 hours.

[0046] Figure 22 Figure 17 is Western blot to detect the expression changes of LC3, Beclinl, P62, Bcl2, Bax, phosphorylated mTOR, and total protein mTOR in U266 cells overexpressing E4BP4 treated with autophagy activator RAPA (10 nmol / L) for 24 hours.

[0047] Figure 23 Figure 18 is Spearman correlation expression analysis of E4BP4 and histone deacetylase family molecules in the GSE136400 data set.

[0048] Figure 24 Spearman correlation analysis of E4BP4 and HDAC3 mRNA expression levels in 30 collected MM samples.

[0049] Figure 25 RT-qPCR and Western blot detection of HDAC3 expression changes at protein and mRNA levels after E4BP4 knockdown and overexpression.

[0050] Figure 26 CoIP detection of E4BP4 and HDAC3 interaction in U266 cells.

[0051] Figure 27 Immunofluorescence detection of E4BP4 and HDAC3 co-localization in U266 cells.

[0052] Figure 28 hTftarget database prediction showing that E4BP4 and HDAC3 promoters exist interaction.

[0053] Figure 29 ChIP-qPCR verification of E4BP4 and HDAC3 binding sites in U266 cells.

[0054] Figure 30 Western blot detection of HDAC3, H3K9Ac and H3K27Ac expression changes in the cytoplasm and nucleus of U266 cells with E4BP4 knockdown and overexpression.

[0055] Figure 31 Visual analysis of H3K9Ac and H3K27Ac ChIP-seq in Beclin1 promoter of U266 and MM.1S cells using Cistrome Data Browser.

[0056] Figure 32 ChIP-qPCR detection of H3K9Ac and H3K27Ac levels in Beclin1 promoter in U266 cells after overexpression of E4BP4.

[0057] Figure 33 Flow cytometry detection of apoptosis rate changes in U266 cells after E4BP4 knockdown combined with dexamethasone (1 μmol / L) treatment for 24 hours.

[0058] Figure 34 Flow cytometry detection of apoptosis rate changes in U266 cells after HDAC3 knockdown combined with E4BP4 knockdown and addition of dexamethasone (1 μmol / L) treatment for 24 hours.

[0059] Figure 35 Figure 16B is Western blot detection of LC3, Beclinl, P62, Bcl2, Bax expression changes after knocking down E4BP4 and HDAC3 respectively and then combined with dexamethasone treatment (1 μmol / L) U266 cells for 24 hours.

[0060] Figure 36 Figure 16C is a mechanism model diagram of E4BP4 affecting autophagy and apoptosis of multiple myeloma through HDAC3. DETAILED DESCRIPTION

[0061] The technical solutions of the application will be further limited in combination with specific embodiments, but the scope of protection is not only limited to the description.

[0062] 1. Materials and methods

[0063] 1.1. Materials

[0064] 1.1.1 Obtaining of public database data sets

[0065] General transcriptome (GSE5900, GSE6477, GSE39683, GSE136400) and ChIP-seq (GSM2527590 and GSM2527591) sequencing data were downloaded from GEO (https: / / www.ncbi.nlm.nih.gov / geo / ), another set of MM RNA-seq data was obtained from the Oncomine database, MM patient sequencing data set of MMRF-coMMpass was obtained from the UCSC Xena database (https: / / xenabrowser.net / datapages / ), and the gene expression matrix of 32 tumor cell lines was obtained from the CCLE data set (https: / / portals.broadinstitute.org / ccle / about).

[0066] 1.1.2 Collection of 30 patient clinical samples

[0067] All 30 multiple myeloma patient mononuclear cell samples came from inpatients of the Affiliated Hospital of Guizhou Medical University (16 males and 14 females, aged 36-72 years, with a median age of 60 years, and patients with ISS staging of Ⅰ-Ⅲ), the hospitalization time was from January 2019 to June 2012, and these patients all met the NCCN 2022 recommended multiple myeloma diagnostic criteria. The normal control group was 15 healthy donor bone marrow samples, all samples were extracted by extracting mononuclear cells, then extracting RNA, reverse cDNA, and stored at -80°C.

[0068] 1.1.3 Multiple myeloma cells and normal control cells

[0069] Human multiple myeloma cell lines U266 and RPMI8226 were purchased from the Cell Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. Normal human bone marrow cells were obtained from healthy donors in the Department of Hematology, and were isolated into single nuclear cells as normal control cells.

[0070] 1.1.4 Main reagents

[0071] (1) RPMI1640 basic medium (Gibco, USA)

[0072] (2) Fetal bovine serum (BI, USA)

[0073] (3) Penicillin / streptomycin mixture (Gibco, USA)

[0074] (4) RNAiso Reagent (Takara, Japan)

[0075] (5) RNA reverse transcription kit (Takara, Japan)

[0076] (6) Real-time fluorescent quantitative PCR kit (Takara, Japan)

[0077] (7) High-efficiency RIPA lysis buffer (Solabio, Beijing)

[0078] (8) 5x protein loading buffer (Solabio, Beijing)

[0079] (9) Membrane regeneration solution (Solabio, Beijing)

[0080] (10) PMSF (Biuntian Biotechnology Co., Ltd., Shanghai)

[0081] (11) Phosphatase / protease inhibitor cocktail (Biuntian Biotechnology Co., Ltd., Shanghai)

[0082] (12) Antibodies: E4BP4, HDAC3, LC3, Beclin1, P62, Bcl2, Bax, mTOR, p-mTOR, GAPDH antibodies were purchased from Wuhan Sanying Biotechnology Co., Ltd.; H3K9Ac, H3K27Ac antibodies were purchased from Hangzhou Jingjie Biotechnology Co., Ltd.

[0083] (13) Anti-rabbit secondary antibody (Bioworld, USA)

[0084] (14) Glycine (Solabio, Beijing)

[0085] (15) Tris (Solabio, Beijing)

[0086] (16) SDS (Beijing Solabio Technology Co., Ltd.)

[0087] (17) NaCl (Shanghai Lujing Laboratory Equipment Co., Ltd.)

[0088] (18) KCl (Shanghai Lujing Laboratory Equipment Co., Ltd.)

[0089] (19) Tween-20 (Beijing Solabio Technology Co., Ltd.)

[0090] (20) Skim milk (Inner Mongolia Yili Industrial Group Co., Ltd.)

[0091] (21) BCA protein quantification kit (Thermo fisher, USA)

[0092] (22) ECL chemiluminescence solution (Millipore, USA)

[0093] (23) PVDF membrane (Millipore, USA)

[0094] (24) Protein marker (Thermo fisher, USA)

[0095] (25) DMSO (Beijing Solabio Technology Co., Ltd.)

[0096] (26) Human peripheral blood lymphocyte separation medium (Beijing Solabio Technology Co., Ltd.)

[0097] (27) CCK-8 cell proliferation toxicity detection kit (Dojindo, Japan)

[0098] (28) Annexin V APC-7AAD flow cytometry apoptosis kit (BioGems, USA)

[0099] (29) 812 epoxy resin embedding kit (SPI, USA)

[0100] (30) Uranium acetate (SPI, USA)

[0101] (31) Lead citrate (EMS, Switzerland)

[0102] (32) Tunel staining kit (Wuhan Elabscience Biotechnology Co., Ltd.)

[0103] (33) 4% paraformaldehyde (Beijing Solabio Technology Co., Ltd.)

[0104] (34) Triton X-100 (Beijing Solabio Technology Co., Ltd.)

[0105] (35) 5% BSA blocking solution (Beijing Solabio Technology Co., Ltd.)

[0106] (36) DAPI solution (Beijing Solabio Technology Co., Ltd.)

[0107] (37) ChIP kit (Shanghai Aibixun Biotechnology Co., Ltd.)

[0108] (38) Sh-E4BP4, OE-E4BP4 lentivirus plasmids were constructed by Shanghai Huwu Biotechnology Co., Ltd.

[0109] (39) Lipofectamin RNAiMAX (Thermo fisher, USA)

[0110] (40) OPTI-MEM (Gibco, USA)

[0111] (41) 3-Methyladenine (3-MA, MCE, USA)

[0112] (42) Rapamycin (RAPA, MCE, USA)

[0113] (43) Dexamethasone (Dex, MCE, USA)

[0114] (44) RT-qPCR primer sequences (Shanghai Sangon Biological Engineering Co., Ltd.):

[0115] E4BP4: Forward: 5'-GGCCACGCAAAAACTTTCCT-3'

[0116] Reverse: 5'-ATGCCAGTGCTCCGATTTGA-3'

[0117] GAPDH: Forward: 5'-GGAGCGAGATCCCTCCAAAAT-3'

[0118] Reverse: 5'-GGCTGTTGTCATACTTCTCATGG-3'

[0119] HDAC3: Forward: 5'-AGGCCTCCCAACATGACATG-3'

[0120] Reverse: 5'-TGTGTAACGCGAGCAGAACT-3'

[0121] Beclinl: Forward: 5'- ATCTAAGGAGCTGCCGTTATAC -3'

[0122] Reverse: 5'- CTCCTCAGAGTTAAACTGGGTT -3'

[0123] P62: Forward: 5'- TGATTGAGTCCCTCTCCCAGATGC -3'

[0124] Reverse: 5'- CCGCTCCGATGTCATAGTTCTTGG -3'

[0125] ATG5: Forward: 5'- GATGGGATTGCAAAATGACAGA -3'

[0126] Reverse: 5'- GAAAGGTCTTTCAGTCGTTGTC -3'

[0127] ATG7: Forward: 5'- GGCAGGATAGCAAAACCAATAG -3'

[0128] Reverse: 5'- TGTATAACACCAACACACTCGA -3'

[0129] (45) HDAC3 promoter ChIP-qPCR primers (Shanghai Biotech Engineering Co., Ltd.):

[0130] Binding site 1: Forward: 5'- CTTCAGCCCCGTGAGTGAG -3'

[0131] Reverse: 5'- CCCCAC TTGCTAACTCAAGAGT -3'

[0132] Binding site 2: Forward: 5'- CTAGGATGCGAGGGCCATTT -3'

[0133] Reverse: 5'- AGGAATCTTCTCCGAGGGCT -3'

[0134] Control: Forward: 5'- ACTGTGTTCTCTGTGGGCAG -3'

[0135] Reverse: 5'- GGCTACTTCCCTCTGGCCTA -3'

[0136] (46) Beclin1 promoter ChIP-qPCR primers (Shanghai Biomed Co., Ltd. ) :

[0137] Beclin1 promoter: Forward: 5'- ATCGGCTCCTTTGAACCTCG-3'

[0138] Reverse: 5'- CTTGGTGTCATCCCACTCCC-3'

[0139] 1.1.5 Preparation method of main reagents

[0140] Preparation method of main reagents

[0141] (1) 10x electrophoresis buffer

[0142]

[0143] After stirring, store at room temperature, dilute 10 times and use.

[0144] (2) 10x transfer buffer

[0145]

[0146] After stirring, store at room temperature, and configure according to 200 mL methanol + 100 mL 10x transfer buffer + 700 mL H2O.

[0147] (3) 10x TBS

[0148]

[0149] After stirring, store at room temperature, and configure according to 100 mL 10x TBS + 900 mL H2O + 0.5 mL Tween-20.

[0150] (4) Blocking solution

[0151] Skimmed milk powder 5.0 g

[0152] 1x TBST 100 mL

[0153] Vibrate on a shaker to completely dissolve, and configure as needed.

[0154] (5) 10% separation gel (total volume 10 mL)

[0155]

[0156] According to the above, add in order, vortex thoroughly, then pour into glass plates, press the gel with anhydrous ethanol, and place at room temperature until it solidifies.

[0157] (6) 15% Separation gel (total volume 10 ml)

[0158]

[0159] According to the above, add sequentially, mix well, then pour into the glass plate, press the glue with anhydrous ethanol, and place at room temperature until it solidifies.

[0160] (7) 5% Concentrated glue (total volume 5 ml)

[0161]

[0162] According to the above, add sequentially, mix well, then pour into the glass plate, press the glue with anhydrous ethanol, and place at room temperature until it solidifies.

[0163] (8) PBS buffer (ph 7.2-7.4): NaCl 37 mmol / L, KCl 2.7 mmol / L, Na2HPO4 4.3 mmol / L, KH2PO4 1.4 mmol / L.

[0164] (9) 0.01 mol / L sodium citrate buffer (CB, ph 6.0, 1000 mL): trisodium citrate 3 g, citric acid 0.4 g.

[0165] (10) 1 mol / L TBS buffer (ph 8.0): dissolve 121 g Tris base in 800 mL water, adjust to ph 8.0 with 1N HCl, and add water to 1000 mL.

[0166] (11) Enzymatic digestion solution: a. 0.1% trypsin: prepared with 0.1% CaCl 12 (ph 7.8); b. 0.4% pepsin solution: prepared with 0.1N HCl.

[0167] (12) 3% methanol-H2O2 solution: prepared with 30% H2O2 and 80% methanol solution.

[0168] (13) TBS / PBS: PH 9.0-9.5.

[0169] 1.1.6 Main instrument equipment

[0170] (1) Carbon dioxide incubator (Thermo fisher, USA)

[0171] (2) Ultracentrifuge (Beckman, USA)

[0172] (3) Ultra-low temperature-80℃ refrigerator (Haier, USA)

[0173] (4) Ultra-low temperature -20℃ refrigerator (Haier, USA)

[0174] (5) Vortex shaker (Ningbo Qunan Laboratory Instrument Co., Ltd.)

[0175] (6) Multifunctional enzyme label instrument (Bio Rad, USA)

[0176] (7) Ice maker (Scottsman Group, USA)

[0177] (8) Constant temperature oscillator (Jilinbel Instrument Manufacturing Co., Ltd., Jiangsu)

[0178] (9) Micro-spectrophotometer (Thermo fisher, USA)

[0179] (10) General PCR instrument (Bio Rad, USA)

[0180] (11) Real-time fluorescent quantitative PCR instrument (Thermo fisher, USA)

[0181] (12) Ultra-pure water instrument (Sichuan Water Equipment Co., Ltd.)

[0182] (13) HVE-50 vertical pressure steam sterilizer (Hirayama, Japan)

[0183] (14) Horizontal shaking table (Beijing Liyi Instrument Factory)

[0184] (15) Super clean bench (Labconco, USA)

[0185] (16) Inverted microscope (Nikon, USA)

[0186] (17) Vertical electrophoresis tank (Bio Rad, USA)

[0187] (18) Electrophoresis instrument (Bio Rad, USA)

[0188] (19) Ultrasonic crusher (sonics, USA)

[0189] (20) Ultra-thin microtome (Leica, Germany)

[0190] (21) Tissue dehydrator (Leica, Germany)

[0191] (22) Transmission electron microscope (JEOL, Japan)

[0192] (23) Confocal fluorescence microscope (Zeiss, Germany)

[0193] 1.2 Method

[0194] 1.2.1 Gene expression analysis of CCLE cell line database

[0195] All tumor cell line mRNA expression matrices were derived from the CCLE dataset (https: / / portals.broadinstitute.org / ccle) and analysis was built by the Rv4.0.3 package ggplot2 (v3.3.3).

[0196] 1.2.2 Differential expression analysis of E4BP4 gene in MM patients transcriptome dataset

[0197] Transcriptome sequencing and microarray datasets used contain data downloaded from GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ) and UCSC Xena database (https: / / xenabrowser.net / datapages / ) in MINiML format, boxplots were plotted by boxplot.

[0198] 1.2.3 Prognostic survival analysis

[0199] Data profiles of multiple myeloma and corresponding clinical information were downloaded from GEO (https: / / www.ncbi.nlm.nih.gov / geo / ) and UCSC Xena (https: / / xenabrowser.net / datapages / ). Log-rank test was used to compare the difference in survival rate between these groups. The timeROC (v0.4) analysis was used to compare the predictive accuracy of E4BP4 mRNA. For Kaplan-Meier curves, the p-value and hazard ratio (HR) of 95% confidence interval (CI) were generated by log-rank and univariate cox proportional hazards regression. All analysis methods and R packages were performed using R software (R Foundation for Statistical Computing, 2020) version v4.0.3. p<0.05 was considered statistically significant.

[0200] (1) Collect cell suspension in T25, add 1 mL Trizol (guanidine isothiocyanate), and repeatedly beat lysis 20 times with a 1 mL syringe, stand at room temperature for 5 minutes;

[0201] (2) Add 0.2 mL chloroform, manually shake up and down for 15 seconds, stand for 2-3 minutes, centrifuge at 12000g at 4°C for 15 minutes;

[0202] (3) The sample is divided into three layers, and the middle aqueous phase layer is carefully aspirated, accounting for 60% of the total volume;

[0203] (4) Transfer the supernatant to a new 1.5 mL centrifuge tube, add 0.5 mL isopropanol, mix well and stand at room temperature for 10 minutes;

[0204] (5) Centrifuge at 12000 g at 4°C for 10 minutes. After centrifugation, a gelatinous precipitate is observed at the bottom of the tube;

[0205] (6) Discard the supernatant, add 1 mL of pre-cooled 75% anhydrous ethanol, wash the precipitate thoroughly, centrifuge at 12000 g at 4°C for 5 minutes;

[0206] (7) Discard the supernatant, centrifuge at 12000 g at 4°C for 1 minute, carefully aspirate the supernatant, and slightly air dry at room temperature;

[0207] (8) Add an appropriate amount of DEPC water to dissolve the RNA.

[0208] (9) Use a spectrophotometer to detect the concentration and purity of the RNA.

[0209] 1.2.5 Removal of genomic DNA and reverse transcription of cDNA reaction

[0210] (1) Prepare the reaction system on ice according to the following table:

[0211] Table 1. Genomic DNA removal reaction system

[0212]

[0213] Mix well, centrifuge briefly, and perform the reaction according to the program of 42°C for 2 minutes;

[0214] (2) Reverse transcription reaction

[0215] 1) Prepare the reverse transcription reaction system on ice according to the following table:

[0216] Table 2. Reverse transcription system

[0217]

[0218] Centrifuge briefly, perform the reaction according to the program of 37°C for 15 minutes, 85°C for 5 seconds, and store the cDNA solution in a -80°C refrigerator.

[0219] 1.2.6 Real-time fluorescent quantitative PCR reaction (RT-qPCR)

[0220] Prepare the reaction system on ice according to the following table:

[0221] Table 3. Real-time fluorescent quantitative PCR system

[0222]

[0223] Mix well by transient centrifugation, and perform real-time fluorescence quantitative PCR reaction according to the following program settings:

[0224]

[0225] 1.2.7 Western blot

[0226] (1) Extraction of total cell protein

[0227] 1) Collect the cell suspension into a 15 mL centrifuge tube, centrifuge at 1500 g for 5 minutes, discard the supernatant, and obtain the cell precipitate;

[0228] 2) Resuspend the cells in 1 mL of PBS and transfer to a 1.5 mL EP tube, centrifuge at 12000 g at 4°C for 5 minutes;

[0229] 3) Discard the supernatant, add an appropriate amount of RIPA lysis buffer containing protease and phosphatase inhibitors, and place on ice. Shake on a shaker every 15 seconds for 30 seconds to ensure complete lysis, and repeat for 10 cycles;

[0230] 4) Centrifuge at 12000 g at 4°C for 20 minutes, take the supernatant and transfer to a new centrifuge tube, and store at -80°C. Before use, determine the protein concentration by BCA method.

[0231] (2) BCA method for protein concentration quantification

[0232] 1) Prepare the concentration gradient standard according to the following table, and mix well after adding the BSA standard;

[0233] Table 4. BCA quantification reaction system

[0234]

[0235] 2) Add 81 uL of RIPA lysis buffer to the centrifuge tube, and mix 9 uL of the sample to be tested with it to dilute the sample to be tested by 10 times. The diluted sample is detected;

[0236] 3) Calculate according to the formula: total volume of BCA working solution required = [(number of standard + number of sample to be tested) x number of experimental replicates] x 200 uL, and set 3 replicate wells for detection;

[0237] 4) According to the calculated total volume of the working solution, add Reagent A and Reagent B at a ratio of 50:1, and mix well by inverting;

[0238] 5) Add 200 uL of working solution per well to the 96-well plate;

[0239] 6) Again, add gradient concentration standard and diluted sample to corresponding wells at 25uL / well, mix well and incubate in 37℃ incubator for 30 minutes;

[0240] 7) Detect OD value of each well at 550nm;

[0241] 8) Draw standard curve, calculate protein concentration of sample according to standard curve formula, and prepare protein sample with equal concentration and volume.

[0242] (3) Protein denaturation

[0243] Mix sample and 5x loading buffer at 1:4 volume ratio, heat in metal bath for 10 minutes to denature protein, and store in -80℃ refrigerator.

[0244] (4) SDS-PAGE gel electrophoresis

[0245] 1) Clean glass plate with detergent, tap water and pure water in sequence, and bake in 50℃ oven;

[0246] 2) After glass plate is dried, assemble glass plate, pour pure water between two glass plates, and check for leaks for 5 minutes;

[0247] 3) After leak checking, pour out pure water and dry with absorbent paper, prepare separation gel according to 1.1.5, mix well, pour into glass plate immediately, add anhydrous ethanol to press gel, and stand at room temperature until gel solidifies;

[0248] 4) Pour out anhydrous ethanol used for pressing gel, prepare concentrated gel according to 1.1.5, mix well, pour into glass plate immediately, insert comb immediately, and stand at room temperature until gel solidifies;

[0249] 5) After gel solidifies, install glass plate to electrophoresis frame, add appropriate amount of electrophoresis solution to inner slot, check for leaks, and pull comb vertically upward;

[0250] 6) According to experimental grouping, load 20ug protein sample, add 2ul protein marker to head and tail wells, connect power supply, and perform electrophoresis at constant voltage of 80V;

[0251] 7) After protein marker is basically separated, adjust voltage to 120V, and stop electrophoresis when bromophenol blue reaches the bottom of separation gel.

[0252] (5) Transmembrane

[0253] 1) Prepare 1x transmembrane solution according to 1.1.5, and precool in 4℃ refrigerator;

[0254] 2) After electrophoresis, carefully separate the gel and glass plate, discard the concentrated gel, measure the length and width of the separation gel with a ruler, cut the 0.22 μm PVDF membrane with the same length and width as the separation gel, and then soak the PVDF membrane in methanol for 30 seconds to activate it;

[0255] 3) Stack them in the order of "sponge-filter paper-PVDF membrane-separation gel-filter paper-sponge", carefully remove the air bubbles, clamp them, and then put them into the electrotransfer tank (the black side of the transfer clamp faces the black side of the transfer tank), pour the pre-cooled transfer buffer, and transfer at 250 mA for 85 minutes.

[0256] (6) Blocking of the PVDF membrane

[0257] Prepare the blocking solution according to the formula in 1.1.5, immediately remove the PVDF membrane after the transfer time is over, soak the PVDF in 5% skimmed milk (blocking solution), and incubate it in a shaker at room temperature for 2 hours.

[0258] (7) Incubation of the primary antibody

[0259] After the blocking time is over, discard the blocking solution, wash the PVDF membrane with TBST for 3 times, each for 5 minutes, prepare the primary antibody according to the appropriate dilution ratio, soak the PVDF membrane in the primary antibody solution, and incubate it at 4°C overnight.

[0260] (8) Incubation of the secondary antibody

[0261] After the incubation time of the primary antibody is over, remove the PVDF membrane from the primary antibody solution, recover the primary antibody and continue to store it in the refrigerator at 4°C, wash the membrane with TBST for 3 times, each for 5 minutes, prepare the secondary antibody according to the reaction species and dilution ratio, put the PVDF membrane into the secondary antibody solution after washing, and incubate it at room temperature for 1 hour.

[0262] (9) Exposure and development of the PVDF membrane

[0263] After the incubation time of the secondary antibody is over, remove the PVDF membrane from the secondary antibody solution, continue to store it in the refrigerator at 4°C, wash the membrane with TBST for 3 times, each for 5 minutes, put the PVDF membrane on the exposure plate of the exposure instrument with the protein side facing up, add the ECL luminescent solution, and use the ImageJ software to quantitatively analyze the relative gray value of the obtained results.

[0264] 1.2.8 Immunohistochemical staining

[0265] (1) De-waxing and hydration;

[0266] (2) Wash with PBS for 2-3 times, each for 5 minutes;

[0267] (3) Add 3% H2O2 (80% methanol) dropwise on the TMA, and stand at room temperature for 10 minutes;

[0268] (4) Wash with PBS for 2-3 times, each for 5 minutes;

[0269] (5) antigen retrieval;

[0270] (6) wash with PBS for 2-3 times, 5 minutes each time;

[0271] (7) add normal goat serum blocking solution dropwise, stand at room temperature for 20 minutes, and shake off the excess liquid;

[0272] (8) add primary antibody E4BP4, Bcl2, CD8 dropwise, 50 μL each, stand at room temperature for 1 hour or at 4°C overnight or at 37°C for 1 hour;

[0273] (9) after standing at 4°C overnight, it is necessary to warm up at 37°C for 45 minutes;

[0274] (10) wash with PBS for 3 times, 2 minutes each time;

[0275] (11) add secondary antibody dropwise, 45-50 μL, stand at room temperature or at 37°C for 1 hour;

[0276] (12) 0.05% Tween-20 can be added in the secondary antibody;

[0277] (13) wash with PBS for 3 times, 5 minutes each time;

[0278] (14) develop color with DAB for 5-10 minutes, and master the degree of staining under a microscope;

[0279] (15) wash with PBS or tap water for 10 minutes;

[0280] (16) hematoxylin re-staining for 2 minutes, and differentiate with hydrochloric acid alcohol;

[0281] (17) wash with tap water for 10-15 minutes;

[0282] (18) dehydrate, transparentize, mount, and examine under a microscope.

[0283] 1.2.9 Extraction of bone marrow mononuclear cells

[0284] (1) dilute 2 mL of bone marrow with physiological saline at a ratio of 1:1;

[0285] (2) add 4 mL of lymphocyte separation medium Ficoll into a 15 mL centrifuge tube;

[0286] (3) carefully and slowly add the diluted bone marrow sample along the wall of the centrifuge tube to the Ficoll;

[0287] (4) centrifuge at 2000 g at room temperature for 20 minutes;

[0288] (5) After centrifugation, a layer of white film cells was obviously visible on the middle layer of the liquid surface, which was a mononuclear cell layer with a density lower than the Ficoll solution. The mononuclear cell layer was sucked out with a Pasteur pipette and transferred to another centrifuge tube;

[0289] (6) The cells were washed with PBS and centrifuged at 1500g for 10 minutes at room temperature;

[0290] (7) The supernatant was discarded, and the cells were resuspended with PBS, and the cells were washed repeatedly;

[0291] (8) Finally, the cell pellet was resuspended with a freezing solution prepared with DMSO + fetal bovine serum and stored in a -80°C refrigerator.

[0292] 1.2.10 U266, RPMI8226 cell culture

[0293] U266 cells were cultured in a complete culture medium (10% fetal bovine serum + RPMI1640) in a 37°C, 5% CO2 incubator, and the complete culture medium was replaced every two days. When the cells grew to 80%-90% of the culture bottle, the cells were passaged, centrifuged at 800g for 5 minutes, washed with PBS twice, and finally resuspended with a complete culture medium. The cells were finally placed in the incubator for continuous culture. Cells in the logarithmic growth phase were used for the next experiment.

[0294] 1.2.11 CCK-8 proliferation experiment

[0295] (1) Collect the cell suspension into a centrifuge tube, centrifuge at 800g for 5 minutes, and discard the supernatant;

[0296] (2) Add 1 mL of complete culture medium to resuspend the cell pellet, and count the cells using a hemocytometer;

[0297] (3) Calculate the required number of cells and the volume of cell suspension according to 5x10 3 cells per well, and calculate the total system according to 100uL of system per well, and add an appropriate amount of culture medium to make up;

[0298] (4) Add 100uL of cell suspension to the 96-well plate, and add 10uL of CCK-8 reagent per well. After incubation at 37°C for 2 hours, detect the OD value of each well at 450nm using a microplate reader;

[0299] (5) Detect the OD value of each well at 0, 1, 3, and 5 days. Set 3 replicates for each time point for each type of cell.

[0300] 1.2.12 Sh-E4BP4, OE-E4BP4 stable cell strain screening

[0301] (1) U266 cells were prepared at 1x10 4Cells were seeded at a density of 1.5 x 105cells / mL into T25 flasks with a total volume of 10 mL;

[0302] (2) 12 hours later, the cells were infected with control virus, Sh-E4BP4 virus and OE-E4BP4 virus, and the drug concentration and drug amount were calculated according to (cell number x MOI value / virus stock titer) x 10 3 = virus drug amount (μL).

[0303] (3) All cells in the culture flask were collected into a centrifuge tube, the medium supernatant was removed by centrifugation, 2 mL of fresh medium was added to resuspend the cells, and 2 μL of 1 mg / mL polybrene was added to each well, and the final polybrene concentration in the cell sample was 5 μg / mL;

[0304] (4) The sample was incubated at room temperature for 30 minutes, and then centrifuged at 200 g and 28°C for 1 hour to increase the effective infection efficiency;

[0305] (5) After centrifugation, the cells were resuspended in the medium in the centrifuge tube and transferred to a new culture flask, the medium was supplemented to 10 mL, and the sample was incubated in the incubator;

[0306] (6) After 24 hours of infection, the medium was changed, the cells were washed twice with PBS, and 10 mL of fresh medium was added to each well, and the cells were incubated for another 72 hours;

[0307] (7) After 72 hours, 0.2 μg / mL of puromycin was added to the medium, and the cells were continuously cultured for 2 weeks for selection;

[0308] (8) After about two weeks of drug selection, the cells were expanded and passaged, and the stably transfected cell line was stored at -80°C.

[0309] 1.2.13 Transmission electron microscopy observation of autophagy and apoptosis characteristics of U266 cells

[0310] (1) Fixation: The sample was pre-fixed with 3% glutaraldehyde and then fixed with 1% osmium tetroxide;

[0311] (2) Dehydration: The sample was dehydrated with acetone in a gradient of 30%→50%→70%→80%→90%→95%→100% (100% concentration was replaced 3 times);

[0312] (3) Penetration and embedding: The sample was dehydrated with a dehydration agent and embedded with Epon 812 at a ratio of 3:1, 1:1 and 1:3, respectively, and finally embedded with Epon 812;

[0313] (4) Ultrathin sectioning: An ultramicrotome was used to prepare ultrathin sections with a thickness of about 60-90 nm, the sections were spread, and then collected on a copper grid;

[0314] (5) Staining: first stained with uranium acetate for 10-15 minutes, then stained with lead citrate for 1-2 minutes at room temperature;

[0315] (6) Electron microscope observation: JEM-1400 FLASH transmission electron microscope produced by Japan Electronics was used for image collection of copper mesh. Each copper mesh was observed at 6000 times first, and pictures were collected in the selected observation area to observe specific lesions.

[0316] 1.2.14 Tunel kit for detecting apoptosis

[0317] (1) The amount of each sample was calculated and configured according to the method of the kit, i.e. TdT Equilibration Buffer 35 μL, Labeling Solution 10 μL, TdT Enzyme 5 μL;

[0318] (2) 100 μL of TdT Equilibration Buffer was added to each sample, and the reaction was carried out at 37°C for 10-30 minutes;

[0319] (3) The TdT Equilibration Buffer was absorbed with water paper (attention not to dry the slice). 50 μL of labeling working solution was added to each sample, and the sample was placed in a wet box and reacted at 37°C for 60 minutes in the dark;

[0320] (4) The sample was immersed in PBS for 3 times, 5 minutes each time;

[0321] (5) After the water was absorbed with water paper, DAPI working solution was added, and the cell nucleus was re-stained at room temperature for 5 minutes in the dark;

[0322] (6) The sample was immersed in PBS for 4 times, 5 minutes each time;

[0323] (7) The excess liquid was absorbed with water paper, and the sample was sealed with a sealing agent containing an anti-fluorescence quencher (self-prepared);

[0324] (8) The results were observed under a fluorescence microscope by selecting an appropriate fluorescence channel.

[0325] 1.2.15 U266 cell immunofluorescence staining

[0326] (1) The cells were cultured in a 6-well plate, and when the cell density reached 60-80% after different treatment conditions, the cells were stained;

[0327] (2) The cell suspension was collected into a 15 mL centrifuge tube, centrifuged at 800g for 5 minutes, the supernatant was discarded, the cells were washed with PBS for 2 times, and transferred to a 1.5 mL centrifuge tube;

[0328] (3) Add 4% paraformaldehyde 1 mL into the centrifuge tube, fix at room temperature for 30 minutes;

[0329] (4) 12000g centrifuge for 5 minutes, discard the supernatant, wash with PBS for 3 times, transfer to 24-well plate or confocal culture dish, evenly spread the cells;

[0330] (5) Add 100 μL Triton X-100 in 24-well plate or confocal culture dish, incubate at room temperature for 10 minutes to permeabilize the cells, wash with PBS for 3 times;

[0331] (6) Add 200 μL 5% BSA in 24-well plate, block the cells at room temperature for 1 hour;

[0332] (7) Add 100 μL of primary antibody with appropriate dilution ratio, incubate at room temperature overnight;

[0333] (8) Wash the cells with PBS for 3 times, add 100 μL of Alexa 488 labeled secondary antibody, incubate at room temperature for 1 hour;

[0334] (9) Wash with PBS for 3 times, add 100 μL of DAPI to stain the nucleus for 5 minutes;

[0335] (10) Wash the cells with PBS for 3 times, place the 24-well plate or confocal culture dish under fluorescence inverted or laser confocal microscope, select the corresponding fluorescence channels and take pictures at different magnifications to obtain images.

[0336] 1.2.16 Annexin V APC / 7-AAD double staining method for detecting apoptosis rate

[0337] (1) Collect the cells treated in different groups in 6-well plates, centrifuge and wash the cells with PBS for 2 times;

[0338] (2) Add 500 μL of Annexin V binding buffer to resuspend the cells, adjust the cell concentration to 1×10 6 per liter;

[0339] (3) Add 5 μL of Annexin V APC staining solution to each tube, mix the cells gently, incubate at room temperature for 15 minutes in the dark;

[0340] (4) Add 5 μL of 7-AAD staining solution to each tube, incubate at 4°C for 5 minutes in the dark, then use flow cytometry to detect, each group is parallelly tested for 3 times, and the results are analyzed using FlowJo software.

[0341] 1.2.17 Co-IP (immunoprecipitation)

[0342] (1) Select U266 cell line for endogenous experiment, all processes are operated on ice;

[0343] (2) Collect the cell suspension in T25 flask, centrifuge at 800g for 5 minutes, discard the supernatant;

[0344] (3) Take 600 μL of pre-cold lysis buffer to lyse the cells, and transfer the cell lysate to a 1.5 mL centrifuge tube;

[0345] (4) Ultrasonic breakage of cells: power 30%, 15 seconds of ultrasonic breakage and 5 seconds of stop for each time, for a total of 3 times;

[0346] (5) Centrifuge at 12000g for 20 minutes, collect the supernatant into a new 1.5 mL centrifuge tube;

[0347] (6) Prepare another batch of centrifuge tubes, take 30 μL of the centrifuged supernatant into a new centrifuge tube, and add 5×loading buffer at a ratio of 5:1;

[0348] (7) Add the remaining supernatant to the IP tube, and add 5 μL of washed and mixed A+G beads to each tube;

[0349] (8) Add the antibody of the target protein to be IPed to each tube, about 5 μL, and use the corresponding IgG antibody as a control for each experiment;

[0350] (9) Rotate the mixer vertically at 4°C for overnight;

[0351] (10) Wash the beads after overnight rotation with lysis buffer, then discard the supernatant, add 5×loading buffer at a ratio of 5:1, and heat each tube of sample in a 100°C metal bath for 10 minutes to denature the protein. Use Western blot to detect the results.

[0352] 1.2.18 ChIP chromatin immunoprecipitation experiment

[0353] (1) Collect the U266 cell suspension in a T75 flask, centrifuge at 800g for 5 minutes, discard the supernatant, and wash the cells with PBS twice;

[0354] (2) Add formaldehyde to make the final concentration of formaldehyde 1%, incubate at room temperature for 10 minutes, add 2 mL of 10×glycine, mix gently, react at room temperature for 5 minutes, quench the unreacted formaldehyde, and terminate the cross-linking;

[0355] (3) Discard the culture medium, wash the cells with 20 mL of pre-cooled 1×PBS, and repeat the washing once;

[0356] (4) Add 2 mL of pre-cooled 1×PBS containing protease inhibitor cocktail to the culture dish, centrifuge at 800g for 5 minutes at 4°C;

[0357] (5) Remove supernatant, resuspend cells with 0.5 mL cell lysis buffer containing protease inhibitor cocktail, lyse on ice for 15 min, vortex every 5 min;

[0358] (6) 800 g centrifuge at 4°C for 5 min, remove supernatant, resuspend cells with 0.5 mL nuclear lysis buffer containing protease inhibitor cocktail;

[0359] (7) Sonicate DNA, 50% power, 2 sec on, 2 sec off, time cycle 2, 4, 6, 8 min;

[0360] (8) After sonication, centrifuge the solution at 12000 g for 10 min at 4°C, take 5 μL of chromatin solution for agarose gel analysis to check the efficiency of sonication;

[0361] (9) Take 50 μL of the supernatant after centrifugation and transfer to a new centrifuge tube, containing 1 x 10 6 cells per 50 μL of lysis solution, the ChIP reaction includes a positive control antibody tube, a negative control IgG tube and a target protein antibody tube;

[0362] (10) Add 450 μL of prepared dilution buffer to the centrifuge tube containing 50 μL of fragmented DNA sample, mix well, take 5 μL of sample from each tube to a new centrifuge tube as 1% "input" for the experiment, for experimental optimization and data processing;

[0363] (11) Add 5 μL of immunoprecipitation antibody to the centrifuge tube containing inpμt, incubate overnight on a 4°C rotating mixer;

[0364] (12) Add 20 μL of protein A / G magnetic beads to each centrifuge tube, incubate for 2 h on a 4°C rotating mixer;

[0365] (13) Absorb with a magnetic stand, stand for 2 min, remove supernatant;

[0366] (14) Wash the A / G magnetic bead-antibody-protein / DNA complex with low-salt washing buffer, high-salt washing buffer, LiCl washing buffer and TE buffer in sequence, respectively, incubate for 5 min on a 4°C rotating mixer;

[0367] (15) Add ChIP elution buffer (containing protease K) to the sample tube and the input tube, incubate at 62°C for 2 h;

[0368] (16) Incubate at 95°C for 10 min, let the sample cool to room temperature;

[0369] (17) 10000g centrifuge for 10 seconds to collect the residual sample on the tube cap and tube wall, and separate the magnetic beads using a magnetic stand. Carefully transfer the supernatant to a new test tube;

[0370] (18) Use a purification column to purify the DNA, and balance the DNA adsorption column: add 200 μL of buffer CBS to the Gel Recovery Column, centrifuge at 12000g for 1 minute, discard the waste liquid in the collection tube, and put the Gel Recovery Column back into the collection tube. Add 200 μL of ddH2O to the Gel Recovery Column, centrifuge at 12000g for 1 minute, discard the waste liquid in the collection tube, and put the Gel Recovery Column back into the collection tube;

[0371] (19) Add 2 volumes of Binding Solution to the supernatant and mix well;

[0372] (20) Transfer the above mixture (no more than 700 μL each time) to an adsorption column (Gel Recovery Column) with a collection tube, and place it at room temperature for 2 minutes, centrifuge at 12000g for 1 minute, discard the waste liquid, and put the adsorption column back into the collection tube;

[0373] (21) Put the adsorption column back into the collection tube, add 500 μL of WA Solution, centrifuge at 12000g for 1 minute, and discard the waste liquid in the collection tube;

[0374] (22) Put the adsorption column back into the collection tube, add 500 μL of Wash Solution, centrifuge at 12000g for 1 minute, discard the waste liquid in the collection tube, and repeat once;

[0375] (23) Put the adsorption column back into the collection tube, centrifuge at 12000g for 1 minute, open the adsorption column cap, and place it at room temperature for 10 minutes to completely remove the Wash Solution;

[0376] (24) Put the adsorption column into a clean 1.5 mL collection tube, and add 30-50 mL of Elution Buffer to the membrane center, place it at 37°C for 2 minutes, centrifuge at 12000g for 1 minute, and the liquid in the centrifuge tube is the solution containing the target gene;

[0377] (25) Use qPCR and agarose gel electrophoresis to detect and analyze the enrichment effect.

[0378] 1.2.19 Data statistical analysis

[0379] Data were analyzed and plotted using GraphPad Prism and R (version 4.2.1) and are presented as mean ± standard error. For two-group data, independent sample t-test was used when data met normal distribution and equal variance, and Welch t'test was used when data met normal distribution but not equal variance, and Wilcoxon rank sum test was used when data did not meet normal distribution. For three or more groups, one-way ANOVA was used when data met normal distribution and equal variance, and Welch one-way ANOVA was used when data met normal distribution but not equal variance, and Kruskal-Wallis test was used when data did not meet normal distribution. *p < 0.05, **p < 0.01, ***p < 0.001 were considered statistically significant.

[0380] 2 Results

[0381] 2.1 Correlation analysis between expression level of E4BP4 and clinical characteristics in MM

[0382] 2.1.1 Expression level of E4BP4 in normal samples and MM patients

[0383] Firstly, we analyzed the expression level of E4BP4 in multiple myeloma cell lines and other solid tumor and other hematological tumor cell lines by CCLE cell line dataset, and the results showed that the expression level of E4BP4 in multiple myeloma cell lines was significantly higher than that in other solid tumor and other hematological tumor cell lines( Figure 1 ). And by analyzing the MM transcriptome datasets of Oncomine database and GSE5900, GSE6477 and GSE39683, the results showed that the expression of E4BP4 in MM patients was significantly higher than that in normal samples( Figure 2 ). 2.1.2 Expression level of E4BP4 in normal mononuclear cells and MM patients, cell lines

[0384] We further detected the expression level of E4BP4 protein in 15 multiple myeloma patients and 9 healthy donors mononuclear cells, and the expression level of E4BP4 protein in U266, RPMI8226 cell lines and healthy donors by Western blot, and the results showed that the expression level of E4BP4 in MM patients and U266, RPMI8226 cell lines was significantly higher than that in healthy donor mononuclear cells( Figure 3 ). These results suggested that E4BP4 might be involved in the occurrence and development of multiple myeloma.

[0385] 2.1.3 The impact of E4BP4 expression on the clinical prognosis of MM patients

[0386] To further investigate the impact of E4BP4 expression levels on the clinical course of MM, we plotted Kaplan-Meier curves for overall survival (OS) and progression-free survival (PFS) in MM patients using the GSE136400 dataset. The results showed that, regardless of OS or PFS, higher E4BP4 expression was associated with a worse prognosis in MM patients. Meanwhile, time-dependent ROC curves showed AUCs of 0.655, 0.648, and 0.604 at 1, 3, and 5 years, respectively, suggesting that E4BP4 has good diagnostic predictive power over these three years. Figure 4 To further validate the reliability of E4BP4 as an independent risk factor for predicting MM prognosis and survival, we selected another independent MM dataset, TCGA-MMRF-coMMpass, as the validation set to perform prognostic analysis of E4BP4 and MM. Consistent with the results from the training set analysis, the KM prognostic survival curve showed that MM patients with high E4BP4 expression had worse prognostic survival outcomes. The time-dependent ROC curves showed AUCs of 0.557, 0.636, and 0.677 at 1, 3, and 5 years, respectively, indicating good diagnostic predictive efficacy, especially in terms of long-term predictive efficacy at 3 and 5 years. Figure 5 These results indicate that high expression of E4BP4 promotes disease progression in MM patients and can serve as an independent prognostic factor, accurately predicting the prognosis of MM patients.

[0387] 2.1.4 The correlation between E4BP4 expression and clinical factors was verified in 30 collected MM patients.

[0388] Based on bioinformatics analysis of public databases, we collected clinical samples from 30 MM patients. These patients included age, ISS stage, percentage of primitive plasma cells, hemoglobin, albumin, globulins, immunoglobulins and light chain levels, serum calcium, serum creatinine, β2-microglobulin, lactate dehydrogenase, and presence or absence of bone damage—all clinical indicators related to MM (Table 5). Simultaneously, qPCR was used to detect the expression level of E4BP4 mRNA in these 30 MM patients, and correlation analysis was performed with the included clinical factors. Spearman correlation analysis showed that E4BP4 expression was positively correlated with the percentage of primitive plasma cells and negatively correlated with hemoglobin levels. Figure 6 Immunohistochemical staining was used to detect the expression level of E4BP4 in stage II and III MM patients. The results showed that the protein expression level of E4BP4 in stage III patients was significantly higher than that in stage II patients. Furthermore, stage III patients with high E4BP4 expression also showed high expression of the anti-apoptotic protein Bcl2. Figure 7).

[0389] Table 5. Baseline clinical characteristics of 30 MM patients

[0390]

[0391] 2.1.5 Analysis of the correlation between E4BP4 and immune cells in the MM microenvironment

[0392] We further analyzed the immune infiltration according to the expression level of E4BP4 in the GSE136400 dataset, and the results showed that E4BP4 expression was significantly correlated with CD8+ T cells, i.e., the higher the E4BP4 expression, the fewer the number of CD8+ T cells( Figure 8 ). At the same time, we used immunohistochemical staining for verification, and the results showed that in the MM patients with high expression of E4BP4 in stage III, there was a decrease in CD8 expression( Figure 9 ). This indicates that high expression of E4BP4 may reduce the number of CD8+ T cells in the MM microenvironment, causing T cell dysfunction and thus promoting MM progression.

[0393] 2.2 Biological effects of E4BP4 on regulating autophagy and apoptosis of MM cells

[0394] 2.2.1 Effect of E4BP4 on MM cell apoptosis

[0395] According to the results of immunohistochemistry of MM patient clinical samples, we speculate that E4BP4 may have a regulatory effect on MM cell apoptosis. Next, we studied the specific mode of E4BP4 regulating MM cell apoptosis. We first constructed lentiviral vectors for knocking down and overexpressing E4BP4, and infected U266 cells to make them stably express. Further Western blot verification of the knocking down and overexpression efficiency( Figure 10 ), and the expression of apoptosis-related proteins Bcl2 and Bax was also detected, and the results showed that after knocking down E4BP4, the expression of anti-apoptotic protein Bcl2 decreased, and the expression of pro-apoptotic protein Bax increased, and after overexpression, the opposite trend was observed, which suggests that E4BP4 may inhibit the occurrence of MM cell apoptosis( Figure 11 ). Further CCK-8 detection of the effect of knocking down and overexpressing E4BP4 on MM cell proliferation showed that compared with the control group, the proliferation ability of U266 cells decreased after knocking down E4BP4, while overexpression of E4BP4 promoted the proliferation of U266 cells, which was consistent with the results of protein detection( Figure 12 ). Then we continued to use flow cytometry to detect the apoptosis rate of U266 cells after knocking down and overexpressing E4BP4, and the results also found that knocking down E4BP4 led to an increase in the apoptosis rate of U266 cells, while overexpression of E4BP4 had the opposite effect( Figure 13). In addition, we also found that knockdown of E4BP4 in U266 cells produced more apoptosis-related Tunel fluorescence compared with the control group, while overexpression of E4BP4 produced a decrease in apoptosis-related Tunel fluorescence Figure 14 ). Finally, we also used transmission electron microscopy, the "gold standard" for detecting the apoptosis phenotype, to more intuitively and accurately observe the effects on apoptosis from a morphological perspective. The results showed that compared with the control group, knockdown of E4BP4 produced perinuclear space expansion and more nuclear fragments, which are the main morphological features associated with cell apoptosis, while overexpression of E4BP4 did not observe these morphological changes Figure 15 ). In summary, these results all indicate that high expression of E4BP4 inhibits MM cell apoptosis.

[0396] 2.2.2 The effect of E4BP4 on MM cell autophagy

[0397] To study the biological function of E4BP4 in MM, we further performed GSEA enrichment analysis on the differentially expressed genes of the high and low expression groups of E4BP4 in the GSE136400 MM patient public data set, and found that high expression of E4BP4 was associated with the activation of multiple cancer-related pathways, such as the PI3K / AKT / mTOR signaling pathway, the TGF-β signaling pathway, the NOTCH signaling pathway, etc. Among them, we found that E4BP4 was significantly related to the mTOR signaling pathway Figure 16 ). Since mTOR is considered to be the core protein that regulates the upstream of autophagy, and autophagy sometimes cooperates with apoptosis to promote cell death. Therefore, we further selected the mTOR signaling pathway to explore the regulation mode of E4BP4 on autophagy. We used Western blot to detect the expression of autophagy-related proteins LC3, Beclin1, P62, and mTOR total protein and phosphorylated mTOR protein in U266 cells with knockdown and overexpression of E4BP4. The results showed that after knockdown of E4BP4, autophagy-related proteins LC3 and Beclin1 expression increased, P62 expression decreased, and phosphorylated mTOR expression increased, while mTOR total protein did not change significantly, while the opposite results were obtained when detecting the above indicators after overexpression of E4BP4 Figure 17 ), which suggests that high expression of E4BP4 can inhibit MM cell autophagy. We further used qPCR to detect the mRNA expression of autophagy-related genes Beclin1, P62, ATG5, and ATG7 in U266 cells overexpressing E4BP4, and the results showed that overexpression of E4BP4 up-regulated the expression of Beclin1 and ATG5, while P62 expression decreased, which is consistent with the results obtained by Western blot detection of autophagy-related proteins after overexpression of E4BP4 Figure 18). In addition, we detected the autophagy intensity of U266 cells after knockdown and overexpression of E4BP4 by endogenous LC3 immunofluorescence staining, and the results showed that more LC3 fluorescent spots were produced after knockdown of E4BP4, while the LC3 fluorescent spots were reduced to a certain extent after overexpression of E4BP4 Figure 19 ). Finally, we also observed by transmission electron microscopy that more autophagosomes and primary lysosomes were produced in U266 cells after knockdown of E4BP4 Figure 20 ). In summary, these data indicate that high expression of E4BP4 inhibits the occurrence of autophagy in MM cells.

[0398] 2.2.3 High expression of E4BP4 inhibits MM cell apoptosis by inhibiting autophagy

[0399] To determine whether E4BP4 inhibits MM cell apoptosis by regulating autophagy, we further treated U266 cells with knockdown of E4BP4 with autophagy inhibitor 3-MA for 24 hours, and detected the expression changes of autophagy-related proteins LC3, Beclinl, P62 and apoptosis-related proteins Bcl2, Bax by Western blot, as shown in Figure 21 , the addition of 3-MA reversed the increase of LC3 and Beclinl and the decrease of P62 caused by knockdown of E4BP4, and also reversed the increase of Bax and the decrease of Bcl2 caused by knockdown of E4BP4, indicating that high expression of E4BP4 inhibits MM cell apoptosis by inhibiting autophagy. We also added autophagy activator RAPA to U266 cells overexpressing E4BP4 for 24 hours, and this result was further verified by Western blot Figure 22 ). These results indicate that high expression of E4BP4 inhibits MM cell apoptosis by inhibiting autophagy, and knockdown of E4BP4 can promote MM cell apoptosis by inducing autophagy.

[0400] 2.3 Molecular mechanism of E4BP4 inhibiting MM cell autophagy and apoptosis through HDAC3

[0401] 2.3.1 HDAC3 is a potential target gene of E4BP4 transcriptional regulation

[0402] We further explored the molecular mechanism of E4BP4 in inhibiting autophagy and apoptosis of MM cells. The histone deacetylase family (HDACs) plays an important regulatory role in multiple myeloma, and current studies have shown that it is related to the regulation of tumor cell autophagy. We first explored whether E4BP4 and the histone deacetylase family molecules have a regulatory relationship. We analyzed the expression correlation of E4BP4 and HDAC family molecules at the transcriptome level through the MM patient data set of GSE136400, and the results showed that E4BP4 was significantly positively correlated with HDAC1, HDAC3, and HDAC8 ( Figure 23 ), and through literature research, we found that HDAC3 has been found to promote MM cell proliferation and inhibit apoptosis, so we further selected HDAC3 as a candidate target gene of E4BP4 for research. We used RT-qPCR to detect the mRNA expression of HDAC3 in 30 collected MM patients, and analyzed the correlation with the expression level of E4BP4, and the results showed that the expression level of E4BP4 and HDAC3 was also significantly positively correlated in the collected MM patient clinical cohort ( Figure 24 ). Then, we used RT-qPCR and Western blot to detect the expression changes of HDAC3 mRNA and protein in U266 cell lines with E4BP4 knockdown and overexpression, and found that the expression of HDAC3 increased after overexpression of E4BP4, and the expression of HDAC3 decreased after knockdown of E4BP4 ( Figure 25 ). We further used CoIP and immunofluorescence colocalization analysis to analyze the spatial positioning and mutual binding of the two, and the CoIP results showed that whether using E4BP4 antibody or HDAC3 antibody enrichment, the two were detected to exist binding in the protein complex of U266 cells ( Figure 26 ), and immunofluorescence showed that E4BP4 and HDAC3 co-localized in U266 cells ( Figure 27 ). These results suggest that HDAC3 may be a potential target gene of E4BP4 transcriptional regulation.

[0403] 2.3.2 E4BP4 promotes the transcription of HDAC3 by binding to its promoter

[0404] Since transcription factors can bind to the promoter region of downstream target genes to regulate their expression levels. We further explored whether E4BP4 promotes the transcription of HDAC3 by binding to its promoter. We first found that E4BP4 and HDAC3 promoters have mutual binding through the hTFtarget database prediction ( Figure 28). Further through potential binding site analysis, two putative E4BP4 binding motifs were identified in the HDAC3 promoter, we found that the potential binding site 1 was located in the region of -165 ~ -153 of the HDAC3 promoter, and the other potential binding site 2 was located between -345 ~ -333, then we designed primers respectively upstream and downstream of the two potential binding sites, and further verified the interaction between E4BP4 protein and potential binding site 1 by ChIP-qPCR experiment Figure 29 ). These results suggest that E4BP4 promotes the transcription of HDAC3 by binding to the HDAC3 promoter, and binding site 1 may be the key site for E4BP4 to transcriptionally regulate the HDAC3 promoter.

[0405] 2.3.3 E4BP4 reduces the levels of H3K9Ac and H3K27ac of Beclin1 promoter by up-regulating HDAC3

[0406] We further explored the mechanism of the subsequent effect of E4BP4 up-regulating HDAC3. We used Western blot to detect the expression changes of E4BP4 and HDAC3 proteins in the cytoplasm and nucleus of U266 cells with E4BP4 knockdown and overexpression, the results showed that after knocking down E4BP4, the expression of E4BP4 mainly decreased in the nucleus, and at the same time the expression of HDAC3 in the nucleus also decreased, we also detected the expression levels of H3K9Ac and H3K27Ac, two histone acetylation sites, and found that the expression levels of these two histone acetylation sites in the nucleus were up-regulated after knocking down E4BP4, while these results were reversed in the cytoplasm and nucleus of U266 cells with E4BP4 overexpression( Figure 30 ), which indicates that the regulation of E4BP4 on HDAC3 mainly occurs in the nucleus and causes the decrease of H3K9Ac and H3K27Ac, two histone acetylation sites, in the nucleus. In addition, studies have shown that HDAC3 can be recruited to the Beclin1 promoter, thereby affecting the transcription of Beclin1 and inhibiting the level of autophagy. Therefore, we speculate whether E4BP4 can cause the down-regulation of H3K9Ac and H3K27Ac of Beclin1 promoter by up-regulating HDAC3, thereby inhibiting the expression of Beclin1. We used Cistrome Data Browser database to perform visual analysis of ChIP-seq data of histone acetylation of U266 and MM.1S cells, the results showed that there was significant enrichment of H3K9Ac and H3K27Ac in the Beclin1 promoter region( Figure 31), we further used ChIP-qPCR to detect the histone acetylation sites on Beclinl promoter, and found that both H3K9Ac and H3K27Ac were down-regulated in U266 cells overexpressing E4BP4 Figure 32 Therefore, these results further suggest that E4BP4 promotes the transcription of HDAC3 and inhibits the expression of Beclinl by down-regulating the levels of H3K9Ac and H3K27Ac on Beclinl promoter region, which might inhibit autophagy in MM cells.

[0407] 2.4 Knockdown of E4BP4 enhances the anti-myeloma effect of dexamethasone by inducing autophagy

[0408] Dexamethasone has been a cornerstone drug for induction and maintenance therapy in MM patients, but drug resistance often occurs. Therefore, we investigated the effect of dexamethasone sensitivity after knockdown of E4BP4 in U266 cells. We first detected the apoptosis of U266 cells treated with knockdown of E4BP4 combined with dexamethasone by flow cytometry, and the results showed that the apoptosis rate of U266 cells in the group of knockdown of E4BP4 combined with dexamethasone was significantly increased compared with the group of knockdown of E4BP4 alone and the group of dexamethasone alone Figure 33 We also detected the effect of knockdown of HDAC3 combined with dexamethasone on the apoptosis of U266 cells by flow cytometry, as shown in Figure 34 The apoptosis rate of U266 cells in the group of knockdown of HDAC3 combined with dexamethasone was not significantly increased compared with the group of knockdown of HDAC3 alone and the group of dexamethasone alone. Interestingly, the apoptosis rate of U266 cells was significantly increased in the group of simultaneous knockdown of E4BP4 and HDAC3 combined with dexamethasone, which indicated that knockdown of E4BP4 could significantly enhance the sensitivity of U266 cells to dexamethasone. In addition, we verified whether knockdown of E4BP4 promoted the apoptosis of U266 cells by dexamethasone through inducing autophagy, and the results of Western blot detection showed that the expression of LC3, Beclinl and Bax was increased in the group of knockdown of E4BP4 combined with dexamethasone and the group of knockdown of HDAC3 combined with dexamethasone, while the expression of P62 and Bcl2 was significantly decreased Figure 35 Therefore, these results suggest that knockdown of E4BP4 can enhance the anti-myeloma effect of dexamethasone by inducing autophagy.

[0409] 3 DISCUSSION

[0410] E4BP4 is a mammalian basic leucine zipper transcription factor. In combination with the findings of this study, E4BP4 is significantly associated with CD8+ T cells in the MM microenvironment, and high expression of E4BP4 can lead to a decrease in the number of CD8+ T cells.

[0411] In this study, we found that E4BP4, as a transcription factor, can bind to the promoter of HDAC3 in the nucleus of MM cells, promote its transcription, and ChIP-qPCR experiments showed that the motif located at -165 to -153 bp of the promoter is the key site for E4BP4 to regulate HDAC3. After E4BP4 up-regulates HDAC3, it may inhibit the occurrence of autophagy and apoptosis in MM cells. Mechanistically, E4BP4 promotes the transcription of HDAC3 and further reduces the levels of H3K9Ac and H3K27Ac in the Beclin1 promoter region, which may be the reason for E4BP4 to inhibit the autophagy level of MM cells. However, the specific mechanism of HDAC3 regulating autophagy in MM cells and E4BP4-dependent HDAC3 regulating MM cell autophagy still need to be further studied.

[0412] Dexamethasone is a commonly used drug for the treatment of multiple myeloma, but with the passage of time, its clinical application is more and more, and some patients develop drug resistance and recurrence, ultimately reducing its efficacy. Our study confirmed that E4BP4 is involved in the response of MM cells to dexamethasone, and we found that knocking down E4BP4 enhances the pro-apoptotic ability of dexamethasone on MM cells. However, compared with dexamethasone alone or knocking down HDAC3 alone, knocking down HDAC3 combined with dexamethasone did not show further apoptosis of MM cells, but knocking down E4BP4 combined with knocking down HDAC3 maximally increased the pro-apoptotic ability of dexamethasone on MM cells. These results indicate that the combination of knocking down E4BP4 combined with dexamethasone treatment will maximally increase the stress level of MM cells, leading to excessive activation of autophagy, and then further leading to cell death of MM. In terms of clinical treatment strategy, it provides a new theoretical basis for targeted therapy of MM and related hematological diseases at the in vitro level, but whether the treatment strategy of knocking down E4BP4 combined with dexamethasone can induce more autophagy and apoptosis of MM cells still needs to be further verified by animal experiments.

[0413] 4 Conclusion

[0414] 4.1 Reveals that E4BP4 is highly expressed in MM and promotes the progression of the disease.

[0415] We first identified E4BP4 was highly expressed in MM by bioinformatics analysis of GEO datasets and transcriptome data of Oncomine database, and then performed survival and ROC curve analysis in two large sample cohorts of MM patients GSE136400 and TCGA-MMRF-COMMPASS, which revealed that high expression of E4BP4 could promote the progression of MM disease, and was further verified in our collected 30 MM patient cohort.

[0416] 4.2 We analyzed the biological function of E4BP4 inhibiting autophagy and thereby inhibiting MM cell apoptosis.

[0417] We constructed stable transfection U266 cell lines with knockdown and overexpression of E4BP4, and confirmed that E4BP4 could inhibit MM cell apoptosis by Western blot, CCK-8, flow cytometry, and Tunel staining experiments; further, we used Western blot, endogenous LC3 immunofluorescence staining, and transmission electron microscopy experiments to determine that high expression of E4BP4 could inhibit the autophagy level of MM cells; in addition, we used 3-MA and RAPA drugs in combination with U266 cells with knockdown and overexpression of E4BP4, and analyzed by Western blot that E4BP4 could inhibit MM cell apoptosis by inhibiting autophagy, and that knockdown of E4BP4 could promote MM cell apoptosis by inducing autophagy.

[0418] 4.3 We revealed the potential mechanism of E4BP4 inhibiting autophagy and apoptosis by promoting HDAC3 transcription.

[0419] We determined the positive regulation of E4BP4 on HDAC3 by molecular correlation analysis of MM patient transcriptome datasets, Western blot, and RT-qPCR experiments; then we further confirmed that E4BP4 targeted the HDAC3 promoter region to promote its transcription by Co-IP, immunofluorescence, and ChIP-qPCR experiments; in addition, we demonstrated that overexpression of E4BP4 upregulated the expression of HDAC3, and thereby reduced the levels of Beclin1 promoter H3K9Ac and H3K27Ac, i.e. the potential mechanism of E4BP4 inhibiting autophagy, by Western blot, ChIP-seq data analysis, and ChIP-qPCR experiments.

[0420] 4.4 We explored the clinical significance of knocking down E4BP4 for treating MM, i.e. knocking down E4BP4 promotes the anti-myeloma effect of dexamethasone on MM by inducing autophagy.

[0421] In vitro, we found that knockdown of E4BP4 can significantly activate autophagy level to promote the pro-apoptotic effect of dexamethasone on MM cells by flow cytometry and Western blot.

[0422] In summary, the results of this study show that E4BP4 high expression can inhibit autophagy of multiple myeloma cells by promoting HDAC3 transcription and down-regulating the acetylation level of Beclin1 promoter, and can also inhibit the occurrence of MM cell autophagy by activating the mTOR signaling pathway. Knocking down E4BP4 at the in vitro level can enhance autophagy to exert the anti-myeloma effect of dexamethasone, which provides a biological theoretical basis for targeting E4BP4 drugs combined with dexamethasone as a new treatment strategy for MM and related hematological diseases, and further improves the treatment effect and long-term prognosis of MM patients and related hematological diseases. However, the effectiveness of this combined treatment strategy still needs to be further verified at the animal level.

[0423] Finally, it should be noted that the above examples are only more representative examples of the present application. Obviously, the technical solutions of the present application are not limited to the above examples, but can also have many variations. All variations that can be directly derived or inferred from the content disclosed in the present application by those of ordinary skill in the art should be considered as falling within the scope of protection of the present application.

Claims

1. The application of sh-E4BP4 in the preparation of drugs for multiple myeloma, characterized in that, Specifically, in the preparation of the anti-multiple myeloma drug, sh-E4BP4 and dexamethasone are used together as the anti-multiple myeloma drug; the anti-multiple myeloma drug is an anti-dexamethasone-resistant multiple myeloma drug.

2. The application as described in claim 1, characterized in that, Specifically, in the preparation of the anti-multiple myeloma drug, sh-E4BP4, si-HDAC3, and dexamethasone are used together as the anti-multiple myeloma drug.

Citation Information

Patent Citations

  • Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer

    US20200157633A1