Preparation method and application of a photocatalytic signal amplification electrochemical biosensor for detection of fumonisin b1
By introducing photocatalysis technology into an electrochemical biosensor, and utilizing a composite material of graphdiyne oxide-methylene blue-gold nanorods and cadmium selenide quantum dots, combined with DNA self-assembly technology, a high-sensitivity and high-selectivity detection of fumonisin B1 was achieved, overcoming the shortcomings of existing sensors in terms of detection accuracy and sensitivity.
Patent Information
- Application Number
- CN202410036536.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-10
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2044-01-10
AI Technical Summary
Existing electrochemical biosensors lack sufficient sensitivity and selectivity when detecting fumonisin B1, making it difficult to distinguish between current changes caused by low concentrations of the target substance and background noise, thus limiting the accuracy and sensitivity of the detection.
Using graphdiyne oxide-methylene blue-gold nanorods as the substrate material, a DNA tetrahedral nanostructure was prepared by combining single-stranded DNA self-assembly. The signal change of methylene blue photocatalysis was amplified by connecting cadmium selenide quantum dots, thus constructing a photocatalytic signal amplification electrochemical biosensor.
It achieves highly sensitive and selective detection of fumonisin B1, with a detection range spanning five orders of magnitude and a detection limit as low as 0.45 fg mL⁻¹, significantly improving the accuracy and sensitivity of the detection.
Smart Images

Figure CN117849143B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biosensor technology, specifically relating to a method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection and its application. Background Technology
[0002] Fumonisins, produced by Fusarium moniliforme, are among the most common mycotoxins found in cereals. Currently, 11 types of fumonisins have been identified, including fumonisin A1, A2, B1, and B2, with fumonisin B1 (FB1) accounting for 70% of the total and exhibiting the strongest toxicity. Fumonisins possess phytotoxicity, interfering with normal physiological metabolism in plants, causing programmed cell death, and leading to reduced crop yields. Furthermore, fumonisins are heat-stable, water-soluble toxins that readily contaminate grain crops, causing grain loss and reducing the nutritional and economic value of crops. Therefore, research into highly sensitive and accurate detection technologies for FB1 is of great significance to agricultural production.
[0003] Among existing FB1 detection methods, liquid chromatography (LC), liquid chromatography-mass spectrometry (LC-MS), and enzyme-linked immunosorbent assay (ELISA) are the national standard methods. LC and LC-MS are characterized by high precision and accurate analysis, but they rely on specialized, sophisticated equipment and are mostly used for precise laboratory analysis. ELISA is a rapid screening method for FB1, capable of quickly screening large batches of samples, but it has a high false positive rate; positive results must be confirmed by LC or LC-MS. Compared to the above methods, electrochemical methods have the advantages of simple operation and high sensitivity, and have been widely used in FB1 detection. However, currently developed electrochemical biosensors generally detect target analytes based on changes in the number of signal molecules or changes in electron transfer capabilities. The current changes caused by low concentrations of target analytes are weak and limited, making it difficult to distinguish background noise, thus limiting the accuracy and sensitivity of the sensors. Summary of the Invention
[0004] This invention aims to synthesize a composite material, graphdiyne oxide-methylene blue-gold nanorods, as a substrate material to generate electrochemical signals; prepare DNA tetrahedral nanostructures by self-assembly of single-stranded DNA, and adjust the tetrahedral size by controlling the number of bases to achieve controllable assembly of probes on the electrode surface; amplify the signal changes induced by the target substance by photocatalyzing methylene blue through cadmium selenide quantum dots (CdSe QDs) attached to the DNA composite structure, thereby constructing a novel electrochemical biosensor and ultimately achieving highly sensitive and selective detection of FB1.
[0005] A method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection includes the following steps:
[0006] (1) Preparation of gold nanorod (Au NRs) solution: Au NRs were prepared by seed-mediated growth method.
[0007] S1. First, deionized water, hexadecyltrimethylammonium bromide (CTAB) aqueous solution, chloroauric acid (HAuCl4) aqueous solution and sodium borohydride (NaBH4) solution are mixed and stirred and then allowed to stand for a period of time under certain temperature conditions to obtain gold seed solution.
[0008] S2. Mix CTAB aqueous solution, HAuCl4 aqueous solution, silver nitrate (AgNO3) aqueous solution, hydrochloric acid (HCl) aqueous solution and ascorbic acid (AA) aqueous solution, then add gold seed solution, let stand for a period of time under certain temperature conditions, centrifuge, wash, and redissolve in deionized water to obtain gold nanorod (Au NRs) solution.
[0009] (2) Preparation of cadmium selenide quantum dot (CdSe QDs) solution:
[0010] S1. First, deionized water is degassed with nitrogen, then selenium powder and sodium borohydride (NaBH4) are added, and the mixture is left to stand for a period of time to obtain a sodium selenide (NaHSe) precursor solution.
[0011] S2. Deionized water is degassed with nitrogen, then CdCl2·2.5H2O is added to the deionized water and stirred under a nitrogen atmosphere. Mercaptohexanoic acid (MPA) is then added to obtain a mixed solution. After adjusting the pH, the solution is stirred under a nitrogen atmosphere for a period of time. After stirring, the sodium selenide precursor solution prepared in step (2) S1 is added. The resulting mixed solution is then purged with nitrogen for a period of time and reacted in a microwave synthesizer. After the reaction, a pale yellow CdSe QDs stock solution is obtained. After centrifugation, washing, drying, and redissolving in deionized water, a CdSe QDs solution is obtained.
[0012] (3) Preparation of graphynylene oxide-methylene blue-gold nanorods (GDYO-MB-Au NRs) composite solution:
[0013] Graphene oxide (GDYO) powder was dispersed in deionized water, followed by the addition of methylene blue (MB) solution. After shaking for a period of time, Au NRs solution prepared in step (1) was added. After further shaking, the solution was centrifuged and reconstituted in deionized water to obtain GDYO-MB-Au NRs composite solution.
[0014] (4) Preparation of DNA tetrahedral nanostructure (TDN) solution:
[0015] Four types of single-stranded DNA solids were taken and labeled S1, S2, S3, and S4, and dissolved in TE buffer to obtain four TE solutions. Subsequently, the four TE solutions were diluted in TM buffer to obtain four TM diluents. Tris(2-carboxyethyl)phosphine (TCEP) was added to the TM diluents to obtain four single-stranded DNA solutions. Finally, the mixture of the four single-stranded DNA solutions in equal proportions was heated and then cooled to obtain a DNA tetrahedral nanostructure solution, labeled TDN solution.
[0016] (5) Preparation of DNA complex solution: Take five single-stranded DNA solids, denoted as aptamer (Apt), single-stranded A, single-stranded B, single-stranded C, and single-stranded D, and dissolve them in TE buffer to obtain Apt solution, single-stranded A solution, single-stranded B solution, single-stranded C solution, and single-stranded D solution; then dilute them with TM buffer to obtain Apt dilution, single-stranded A dilution, single-stranded B dilution, single-stranded C dilution, and single-stranded D dilution; finally, mix the five dilutions in equal proportions and then heat them to react, and the DNA complex solution can be obtained after the reaction.
[0017] (6) Synthesis of CdSe QDs-DNA complex solution: CdSe QDs are synthesized by amide reaction with DNA containing amino groups.
[0018] Phosphate-buffered saline (PBS) containing N-(3-dimethylaminopropyl)-N-ethylcarbodiimide salt (EDC) and N-hydroxysuccinimide (NHS) was added to the CdSe QDs solution obtained in step (2) and reacted at room temperature for a period of time (activating carboxyl groups); then, the DNA complex structure solution obtained in step (5) was added and allowed to stand for a period of time. After standing, the precipitate was centrifuged and reconstituted with TM buffer to obtain the CdSe QDs-DNA complex structure solution.
[0019] (7) Pretreatment of glassy carbon electrode: First, the glassy carbon electrode is polished on chamois with alumina, and then ultrasonically treated in ethanol and ultrapure water respectively to obtain the pretreated glassy carbon electrode.
[0020] (8) The GDYO-MB-Au NRs composite solution prepared in step (3) was dropped onto the pretreated glassy carbon electrode surface for the first incubation; then the TDN solution prepared in step (4) was dropped on for the second incubation and washed with PBS buffer; then mercaptohexanol (MCH) was dropped on the electrode surface and blocked at room temperature for a period of time to block the non-specific active sites on the gold electrode surface; then the CdSe QDs-DNA composite structure solution was dropped on the electrode surface for the third incubation, and the electrochemical biosensor was obtained after incubation.
[0021] Further, in step (1) S1, the amounts of deionized water, hexadecyltrimethylammonium bromide aqueous solution, chloroauric acid aqueous solution, and sodium borohydride solution are in the following ratio: 4.5 mL: 5 mL: 500 μL: 610 μL, wherein the concentration of hexadecyltrimethylammonium bromide aqueous solution is 0.2 M, the concentration of chloroauric acid aqueous solution is 5 mM, and the concentration of sodium borohydride solution (stored in an ice-water bath) is 10 mM; the stirring time is 2-5 min, the temperature condition is 30 °C, and the standing time is 2 h.
[0022] Further, in step (1) S2, the volume ratio of CTAB aqueous solution, HAuCl4 aqueous solution, silver nitrate aqueous solution, hydrochloric acid aqueous solution, ascorbic acid aqueous solution, and gold seed solution is 24 mL: 4.8 mL: 50 μL: 32 μL: 2.8 mL: 48 μL, wherein the concentration of CTAB aqueous solution is 0.2 M, the concentration of HAuCl4 aqueous solution is 5 mM, the concentration of silver nitrate aqueous solution is 0.1 M, the concentration of hydrochloric acid (HCl) aqueous solution is 1.2 M, and the concentration of ascorbic acid aqueous solution is 10 mM; the temperature condition is 30 °C, the standing time is 20 h; and the concentration of Au NRs solution is 0.4 μM.
[0023] Furthermore, in step (2) S1, the ratio of deionized water, selenium powder, and NaBH4 is 5 mL: 7.9 mg: 7.6 mg; the degassing treatment time is 20-30 min, and the standing time is 2 h.
[0024] Further, in step (2) S2, the ratio of deionized water, CdCl2·2.5H2O, mercaptohexanoic acid and NaHSe precursor solution is 50mL:45.7mg:44μL:5mL; the degassing time is 20-30min; the stirring time of adding CdCl2·2.5H2O in a nitrogen atmosphere is 5min; the stirring time is continued in a nitrogen atmosphere for a period of 30min; and the resulting mixed solution is further purged with nitrogen for a period of 15min.
[0025] The pH was adjusted to 11 using sodium hydroxide; the reaction time in the microwave synthesizer was 4 hours; the centrifugation speed was 12000 rpm and the centrifugation time was 10 minutes; and the washing was performed three times with isopropanol.
[0026] The concentration of the CdSe QDs solution was 0.1 mg / mL. -1 .
[0027] Further, in step (3), the ratio of the amounts of GDYO powder, deionized water, MB solution and Au NRs solution is 4 mg: 1 mL: 1 mL: 2 mL, wherein the concentration of MB solution is 100 μM and the concentration of Au NRs solution is 0.4 nM.
[0028] The oscillation time was 1 hour, the centrifugation speed was 1000 rpm, and the time was 5-15 minutes.
[0029] The concentration of the GDYO-MB-Au NRs composite solution is 1 mg / mL. -1 .
[0030] Furthermore, in step (4), the concentration of the four TE solutions is 100 μM; the concentration of the four TM diluents is 6 μM; and the final concentration of TCEP in the four TM diluents is 3 mM.
[0031] The sequences from the 5' to the 3' ends of S1, S2, S3, and S4 are as follows:
[0032] S1, SH-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC;
[0033] S2, SH-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC;
[0034] S3, SH-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT;
[0035] S4, ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTAAGATTGCACGGACTA;
[0036] The heating reaction is carried out at 95°C for 2 minutes; the cooling reaction is carried out at 4°C for 10 minutes; the heating and cooling reactions are performed in a PCR instrument; the concentration of TDN is 0.5-2.0 μM.
[0037] Further, in step (5), the heating reaction temperature is 37°C and the time is 30 min; the sequences from the 5' to the 3' ends of Apt, single-chain A, single-chain B, single-chain C, and single-chain D are as follows:
[0038] Apt: ATA CCA GCT TAT TCA ATT AAT CGC ATT ACC TTA TAC CAG CTT ATT CAATTACGT CTG CAC ATA CCAGCT TAT TCA ATT AGA TAG TAA GTG CAA TCT;
[0039] Single-chain A, NH-AATTGAATAAGCTGG;
[0040] Single-chain B, NH-CAGACGTAATTGAAT;
[0041] Single-chain C, NH-GTATAAGGTAATGCG;
[0042] Single-chain D, NH-TGAATAAGCTGGTAT;
[0043] The concentration of the DNA complex solution is 2 μM.
[0044] Further, in step (6), the volume ratio of phosphate buffer, CdSe QDs solution, and DNA complex solution is 200 μL: 1 mL: 300 μL, wherein the pH of the phosphate buffer is 7.4, the concentration is 10 mM, and the final concentrations of N-(3-dimethylaminopropyl)-N-ethylcarbodiimide salt and N-hydroxysuccinimide in the phosphate buffer are 10 mM and 5 mM, respectively; the concentration of the CdSe QDs solution is 0.1 mg / mL. -1 The concentration of the DNA complex solution was 2 μM.
[0045] The synthesis conditions were: 30 min for carboxyl activation and 12 h for standing.
[0046] The concentration of the CdSe QDs-DNA complex solution was 2 μM.
[0047] Furthermore, in step (7), the processing condition is ultrasound for 30 seconds.
[0048] Further, in step (8), the amount of GDYO-MB-Au NRs composite solution added is 6 μL; the temperature of the first incubation is 37℃, and the incubation time is 1 h; the concentration of the TDN solution is 0.5-2 μM; the time of the second incubation is 12 h, and the incubation temperature is 4℃; the concentration of MCH is 1 mM; the amount added is 6 μL; and the sealing time at room temperature is 40 min.
[0049] The volume of the CdSe QDs-DNA complex solution was 6 μL; the concentration of the CdSe QDs-DNA complex solution was 2 μM; the temperature of the third incubation was 37 °C, and the incubation time was 20-100 min.
[0050] This invention also relates to the use of an electrochemical biosensor for fumonisin B1 based on signal amplification from photodegradation of methylene blue, the steps of which are as follows:
[0051] (1) First, prepare FB1 solutions of different concentrations; then take multiple electrochemical biosensors constructed in the above steps, modify their surfaces with FB1 solutions of different concentrations, incubate at room temperature for a period of time, and after rinsing with PBS, irradiate the electrochemical biosensors under white light to obtain electrochemical biosensors that have completed recognition and detection; one concentration of FB1 solution corresponds to one electrochemical biosensor, and there is a one-to-one correspondence between concentration and electrochemical biosensor;
[0052] (2) Using a three-electrode system, with the electrochemical biosensor identified and detected in step (1) as the working electrode, Pt as the counter electrode, and Ag / AgCl as the reference electrode, electrochemical detection was performed to obtain the current of the electrochemical biosensor; among which, FB1Apt specifically recognizes FB1. When FB1 is present, the CdSe QDs-DNA complex structure is stripped from the electrode interface, and the photodegradation effect of CdSeQDs on MB is reduced. At this time, the electrochemical signal generated by MB increases. Each concentration of FB1 solution corresponds to a current value of MB, denoted as I. MB ;
[0053] According to I MB A standard curve was constructed using the logarithm of FB1 concentration;
[0054] (3) Detection of FB1 in the sample to be tested: First, obtain the sample liquid to be tested, modify a certain volume of the sample liquid to be tested on the sensor surface, incubate according to the incubation conditions in step (1), and continue to operate according to step (2). The corresponding current value is obtained by electrochemical detection, and the current value is substituted into the standard curve constructed in step (2) to realize the detection of FB1 in the unknown sample.
[0055] Further, in step (1), the concentration of the FB1 solution is 0.5 fg / mL. -1 -10 pg mL -1 The amount of modification used was 6 μL; the incubation period at room temperature was 40 min, and the irradiation time under white light was 8 min.
[0056] Furthermore, in step (3), the amount of sample solution used for modification is 6 μL; the incubation period at room temperature is 40 min.
[0057] The beneficial effects of this invention are:
[0058] (1) Compared with traditional electrochemical biosensors, the introduction of photocatalysis technology into electrochemical biosensors can change the chemical properties of signal molecules, thereby reducing the background signal and increasing the intensity of the sensor signal change.
[0059] (2) The electrochemical biosensor constructed in this invention is used for the detection of FB1. It has high sensitivity and good selectivity, with a detection range spanning five orders of magnitude and a detection limit as low as 0.45 fg / mL. -1 Significant results have been achieved. Attached Figure Description
[0060] Figure 1 Flowchart of the electrochemical biosensor construction process.
[0061] Figure 2 (A) is a TEM image of GDYO; (B) is a TEM image of Au NRs; (C) is a TEM image of GDYO-MB-Au NRs; (D) is a potential diagram of Au NRs, GDYO, GDYO-MB, and GDYO-MB-Au NRs.
[0062] Figure 3 (A) shows the photocatalytic degradation performance of MB by different materials; (B) shows the sensor signal amplification and feasibility verification.
[0063] Figure 4 (A) represents the concentration optimization of Au NRs; (B) represents the concentration optimization of TDN; (C) represents the incubation time optimization of Apt; and (D) represents the incubation time optimization of FB1.
[0064] Figure 5 (A) is a graph showing the relationship between the electrochemical biosensor of the present invention and the concentration of FB1; (B) is a graph showing the linear relationship between the electrochemical biosensor of the present invention and the concentration of FB1. Detailed Implementation
[0065] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The embodiments are based on the technical solution of the present invention and provide detailed implementation steps and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.
[0066] The reagents mentioned in this invention—four types of single-stranded DNA solids (S1, S2, S3, S4) and five single-stranded DNA solids (Apt, single-stranded A, single-stranded B, single-stranded C, single-stranded D)—were all purchased from Shanghai Bioengineering Co., Ltd., and are conventional reagents; therefore, this invention does not belong to the category of sequence listing inventions and does not involve sequence listing.
[0067] The solutions used in this invention are: DNA self-assembly solutions consisting of TM buffer (20 mM Tris, 50 mM MgCl2, pH = 8.0) and TE buffer (10 mM Tris, 1 mM EDTA, pH = 8.0); and electrode rinsing solution consisting of 0.1 M PBS (pH = 7.4). All solutions were prepared using ultrapure water.
[0068] (1) Investigation into the synthesis of GDYO-MB-Au NRs composite solution
[0069] ① The morphology of the materials was studied by measuring the TEM of GDYO, Au NRs, and GDYO-MB-Au NRs.
[0070] The specific method is as follows: Set up three experimental groups, namely GDYO, Au NRs, and GDYO-MB-Au NRs, which are respectively labeled as group a, group b, and group c.
[0071] The procedure for group a was as follows: 4 mg of GDYO powder was dispersed in 1 mL of deionized water, and a TEM image was taken. It can be observed that GDYO has a sheet-like structure.
[0072] The procedure in group b was as follows: the synthesized Au NRs solution was used to take TEM images, and it can be observed that the Au NRs are rod-shaped structures;
[0073] The procedure for group c was as follows: 4 mg of GDYO powder was dispersed in 1 mL of deionized water, 1 mL of 100 μM MB solution was added, and the mixture was shaken for 1 h; then 2 mL of 0.4 nM Au NRs solution was added, and the mixture was shaken for another 1 h; finally, the above solution was centrifuged once at 1000 rpm, and deionized water was added. TEM images showed that Au NRs were attached to the surface of GDYO.
[0074] ② The surface charge of the material was studied by measuring the Zeta potential of GDYO, Au NRs, GDYO-MB, and GDYO-MB-Au NRs.
[0075] The procedure for group a was as follows: 4 mg of GDYO powder was dispersed in 1 mL of deionized water, and its potential was measured using a Malvern particle size analyzer. The measured potential was -43.3 mV.
[0076] The operation for group b was as follows: the potential of the synthesized Au NRs was measured by a Malvern particle size analyzer, and the measured potential was 29.2mV;
[0077] The procedure for group c was as follows: 4 mg of GDYO powder was dispersed in 1 mL of deionized water, 1 mL of 100 μM MB solution was added, and the mixture was shaken for 1 h; the above solution was centrifuged once at 1000 rpm, and deionized water was added; the potential was measured using a Malvern particle size analyzer, and the measured potential was -40.4 mV.
[0078] The procedure for group d was as follows: 4 mg of GDYO powder was dispersed in 1 mL of deionized water, 1 mL of 100 μM MB solution was added, and the mixture was shaken for 1 h; then 2 mL of 0.4 nM Au NRs solution was added, and the mixture was shaken for another 1 h; finally, the above solution was centrifuged once at 1000 rpm, and deionized water was added; the potential was measured using a Malvern particle size analyzer, and the measured potential was -34 mV.
[0079] from Figure 2 As shown in Figure (D), due to the special structure of the oxygen functional group, GDYO exhibits a negative charge (-43.3 mV); the zeta potential of AuNRs is 29.2 mV; after loading MB onto GDYO, the zeta potential of GDYO-MB shifts positively due to the positive charge of MB; after further loading Au NRs, the zeta potential of GDYO-MB-Au NRs shifts even more positively, which is due to the electrostatic interaction between the materials. The above results indicate that the synthesis of GDYO-MB-Au NRs was successful.
[0080] (2) Investigation on photocatalytic degradation performance
[0081] The specific experimental procedures were as follows: Four groups of experiments were set up: SWV current was measured under the condition of GDYO-MB / CdSe QDs without photocatalysis; SWV current was measured after a period of photocatalysis by GDYO-MB / CdSe QDs; SWV current was measured under the condition of GDYO-MB-Au NRs / CdSe QDs without photocatalysis; and SWV current was measured after a period of photocatalysis by GDYO-MB-Au NRs / CdSe QDs. These four groups of experiments were designated as group a, group b, group c, and group d, respectively.
[0082] The procedure for group a was as follows: 6 μL of GDYO-MB composite solution was applied to the surface of the glassy carbon electrode and incubated at 37 °C for 1 h; then, 6 μL of CdSe QDs solution was applied to the surface of the electrode and incubated at 37 °C for 1 h; then the current was detected in PBS using a CHI660E electrochemical workstation, at which point the SWV current was relatively large.
[0083] The procedure for group b was as follows: 6 μL of GDYO-MB composite solution was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h; then, 6 μL of CdSe QDs solution was applied to the electrode surface and incubated at 37 °C for 1 h; after rinsing with PBS, the sensing interface was irradiated with white light for 8 min; then, the current was detected in PBS using a CHI660E electrochemical workstation. At this time, the SWV current decreased by 1.12 μA compared with group a, indicating that CdSe QDs have a photodegradation effect on MB.
[0084] The procedure for group c was as follows: 6 μL of GDYO-MB-Au NRs composite solution was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h; 6 μL of CdSe QDs solution was applied to the electrode surface and incubated at 37 °C for 1 h; then, the current was detected in PBS using a CHI660E electrochemical workstation. The SWV current was enhanced compared to group a, indicating that the loading of Au NRs improved the conductivity of the sensing interface.
[0085] The procedure for group d was as follows: 6 μL of GDYO-MB-Au NRs composite solution was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h; 6 μL of CdSe QDs solution was applied to the electrode surface and incubated at 37 °C for 1 h; after rinsing with PBS, the sensing interface was irradiated with white light for 8 min; then, the current was detected in PBS using a CHI660E electrochemical workstation. At this time, the SWV current decreased by 1.33 μA compared to group c, indicating that the loading of Au NRs improved the photodegradation effect of CdSe QDs on MB.
[0086] (3) Feasibility study of FB1 detection
[0087] The specific experimental procedure was as follows: four groups of experiments were set up, namely, testing the SWV current under conditions without the target compound FB1 and without photocatalysis; 100 fg mL -1 The SWV current was measured under the condition of no photocatalysis with target FB1; the SWV current was measured after a period of photocatalysis without target FB1; 100 fg mL -1 The target compound FB1 was photocatalyzed for a period of time, and the SWV current was measured. These four groups of experiments are denoted as group a, group b, group c, and group d, respectively.
[0088] The procedure for group a was as follows: A 6 μL solution of GDYO-MB-Au NRs composite was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h. Then, a 6 μL solution of 1.5 μM TDN was applied to the electrode surface and incubated at 4 °C for 12 h. Subsequently, 6 μL of 1 mM MCH was dropped onto the electrode surface to block the Au active sites, and the blockade was carried out at room temperature for 40 min. Then, 6 μL of 2 μM CdSe QDs-DNA composite solution was added to the electrode interface and incubated at 37 °C for 30 min. The current at the sensor interface was detected using SWV detection on a CHI660E electrochemical workstation to generate an electrochemical signal.
[0089] The procedure for group b was as follows: 6 μL of GDYO-MB-Au NRs composite solution was applied to the glassy carbon electrode surface and incubated at 37 °C for 1 h. Then, 6 μL of 1.5 μM TDN solution was applied to the electrode surface and incubated at 4 °C for 12 h. Subsequently, 6 μL of 1 mM MCH was dropped onto the electrode surface to block the Au active sites, and the block was maintained at room temperature for 40 min. Then, 6 μL of 2 μM CdSe QDs-DNA composite solution was added to the electrode interface and incubated at 37 °C for 30 min. Finally, 6 μL of 100 fg / mL... -1 The target compound FB1 was incubated at room temperature for 40 min. The current at the sensor interface was detected by SWV on a CHI660E electrochemical workstation. Due to the stripping of Apt, the electrochemical signal increased by 0.416 μA compared to group a, proving that the sensor can be used for FB1 detection.
[0090] Group c involved modifying the glassy carbon electrode surface with 6 μL of GDYO-MB-Au NRs composite solution and incubating at 37 °C for 1 h. Then, 6 μL of 1.5 μM TDN solution was added to the electrode surface and incubated at 4 °C for 12 h. Subsequently, 6 μL of 1 mM MCH was dropped onto the electrode surface to block the Au active sites, and the blockade was carried out at room temperature for 40 min. Then, 6 μL of 2 μM CdSe QDs-DNA composite solution was added to the electrode interface and incubated at 37 °C for 30 min. After rinsing with PBS, the sensing interface was irradiated under white light for 8 min. The current at the sensor interface was detected using SWV on a CHI660E electrochemical workstation. Due to MB degradation, the electrochemical signal was lower than that in group a.
[0091] The procedure for group d was as follows: A 6 μL solution of GDYO-MB-Au NRs was applied to the glassy carbon electrode surface and incubated at 37 °C for 1 h. Then, a 6 μL solution of 1.5 μM TDN was applied to the electrode surface and incubated at 4 °C for 12 h. Subsequently, 6 μL of 1 mM MCH was dropped onto the electrode surface to block the Au active sites, and the block was maintained at room temperature for 40 min. Next, 6 μL of 2 μM CdSe QDs-DNA complex solution was added to the electrode interface and incubated at 37 °C for 30 min. Then, 6 μL of 100 fg mL⁻¹ target analyte FB1 was added and incubated at room temperature for 40 min. After rinsing with PBS, the sensing interface was irradiated under white light for 8 min. The current at the sensor interface was detected using SWV on a CHI660E electrochemical workstation. Due to MB degradation, the electrochemical signal increased by 0.556 μA compared to group c, demonstrating that for the same concentration of target analyte, the introduction of photodegradation increased the signal change of the sensor.
[0092] Based on the results of four sets of controlled experiments... Figure 3 Figure (B) shows that the MB signal is significantly enhanced when there is a target object compared to when there is no target object, and the change in MB signal increases after photodegradation, proving that the sensor can detect FB1 and that photodegradation can amplify the signal.
[0093] (4) Optimization of Au NRs concentration
[0094] 4 mg of GDYO powder was dispersed in 1 mL of deionized water, and 1 mL of 100 μM MB solution was added, followed by shaking for 1 h. Then, 2 mL of 0.1–0.7 nM Au NRs solution was added, and shaking continued for 1 h. Finally, the above solution was centrifuged once at 1000 rpm, and 4 mL of deionized water was added to obtain GDYO-MB-Au NRs composite solutions containing different concentrations of Au NRs. 6 μL of each of these GDYO-MB-Au NRs composite solutions was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h. The current at the sensor interface was detected using SWV detection on a CHI660E electrochemical workstation.
[0095] Figure 4 (A) shows that the MB signal increases with increasing Au NRs concentration from 0.1 nM to 0.4 nM, and decreases with increasing Au NRs concentration from 0.4 nM to 0.7 nM. Therefore, 0.4 nM was selected as the optimal concentration.
[0096] (6) TDN concentration optimization
[0097] 4 mg of GDYO powder was dispersed in 1 mL of deionized water, and 1 mL of 100 μM MB solution was added. The mixture was shaken for 1 h. Then, 2 mL of 0.4 nM Au NRs solution was added, and the mixture was shaken for another 1 h. Finally, the solution was centrifuged once at 1000 rpm, and 4 mL of deionized water was added to obtain a GDYO-MB-Au NRs composite solution. 6 μL of the GDYO-MB-Au NRs composite solution was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h. Then, 6 μL of a 0.5–2 μM TDN solution was applied to the electrode surface and incubated at 4 °C for 12 h. The current at the sensor interface was detected using SWV detection on a CHI660E electrochemical workstation.
[0098] Figure 4 (B) shows that from 0 to 1 μM, the MB signal decreases with increasing TDN concentration and then stabilizes, indicating that TDN reaches saturation at the electrode surface. Therefore, 1.5 μM was selected as the optimal concentration.
[0099] (7) Optimization of incubation time for CdSe QDs-DNA complex solution
[0100] 4 mg of GDYO powder was dispersed in 1 mL of deionized water, and 1 mL of 100 μM MB solution was added. The mixture was shaken for 1 h. Then, 2 mL of 0.4 nM Au NRs solution was added, and the mixture was shaken for another 1 h. Finally, the solution was centrifuged once at 1000 rpm, and 4 mL of deionized water was added to obtain a GDYO-MB-Au NRs composite solution. 6 μL of the GDYO-MB-Au NRs composite solution was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h. Then, 6 μL of 1.5 μM TDN solution was applied to the electrode surface and incubated at 4 °C for 12 h. Subsequently, 6 μL of 1 mM MCH was dropped onto the electrode surface to block the Au active sites, and the block was maintained at room temperature for 40 min. Finally, 6 μL of 2 μM CdSe QDs-DNA composite solution was added to the electrode interface and incubated at 37 °C for 0–100 min. On the CHI660E electrochemical workstation, the current at the SWV sensor interface was selected. Due to the degradation of MB, the electrochemical signal decreased.
[0101] Figure 4 (C) shows that from 0 to 60 min, the MB signal decreased with increasing incubation time of the CdSe QDs-DNA complex solution and then tended to stabilize; therefore, 80 min was selected as the optimal incubation time.
[0102] (8) Optimization of FB1 response time
[0103] 4 mg GDYO powder was dispersed in 1 mL of deionized water, and 1 mL of 100 μM MB solution was added, followed by shaking for 1 h. Then, 2 mL of 0.4 nM Au NRs solution was added, and shaking continued for 1 h. Finally, the above solution was centrifuged once at 1000 rpm, and 4 mL of deionized water was added to obtain a GDYO-MB-Au NRs composite solution. 6 μL of the GDYO-MB-Au NRs composite solution was applied to the surface of a glassy carbon electrode and incubated at 37 °C for 1 h. Then, 6 μL of 1.5 μM TDN solution was applied to the electrode surface and incubated at 4 °C for 12 h. Subsequently, 6 μL of 1 mM MCH was dropped onto the electrode surface to block the Au active sites, and the blockade was performed at room temperature for 10–50 min. 6 μL of 100 fg / mL... -1 The target compound FB1 was incubated at room temperature for 40 min. After rinsing with PBS, the sensing interface was irradiated with white light for 8 min.
[0104] Figure 4 (D) shows that from 0 to 30 min, the MB signal increases with the increase of FB1 incubation time and then tends to stabilize; therefore, 40 min was selected as the optimal reaction time for FB1.
[0105] Example 1:
[0106] (1) Preparation of Au NRs solution:
[0107] S1. First, mix 4.5 mL of deionized water, 5 mL of 0.2 M CTAB aqueous solution, 500 μL of 5 mM HAuCl4 aqueous solution and 610 μL of 10 mM NaBH4 solution under ice-water bath conditions, stir for 2 min, and then let stand at 30 °C for 2 h to obtain gold seed solution.
[0108] S2. Mix 24 mL of 0.2 M CTAB aqueous solution, 4.8 mL of 5 mM HAuCl4 aqueous solution, 50 μL of 0.1 M AgNO3 aqueous solution, 32 μL of 1.2 M HCl aqueous solution, and 2.8 mL of 10 mM AA aqueous solution, then add 48 μL of gold seed solution and let stand at 30 °C for 20 h. The solution color changes from colorless to brick red, indicating that Au NRs are successfully prepared. Finally, centrifuge the Au NRs stock solution at 12000 rpm for 10 min, wash three times with deionized water, and redissolve in deionized water to obtain the Au NRs solution.
[0109] (2) Preparation of CdSe QDs solution:
[0110] S1. First, 5 mL of deionized water was degassed with nitrogen for 20 min, then 7.9 mg of selenium powder was added, followed by 7.6 mg of NaBH4 solid. The mixture was allowed to stand for 2 h to obtain the NaHSe precursor solution.
[0111] S2, 50 mL of deionized water was degassed with nitrogen for 20 min, then 45.7 mg of CdCl2·2.5H2O was added and stirred for 5 min under a nitrogen atmosphere. Subsequently, 44 μL of MPa was added, and the pH of the solution was adjusted to 11 with NaOH. Stirring was continued under a nitrogen atmosphere for 30 min. Then, 5 mL of NaHSe precursor solution was quickly added, and nitrogen was continued to be purged for 15 min. Finally, the solution was transferred to a three-necked flask and reacted in a microwave synthesizer for 4 h to obtain a pale yellow CdSe QDs stock solution. The solution was centrifuged at 12000 rpm for 10 min, washed three times with isopropanol, dried, and reconstituted in deionized water to obtain the CdSe QDs solution.
[0112] (3) Preparation of GDYO-MB-Au NRs composite solution:
[0113] 4 mg of GDYO powder was dispersed in 1 mL of deionized water, followed by the addition of 1 mL of 100 μM MB solution, and the mixture was shaken for 1 h. Then, 2 mL of 0.4 nM Au NRs solution was added, and the mixture was shaken for another 1 h. Finally, the solution was centrifuged once at 1000 rpm and reconstituted with deionized water to obtain 1 mg / mL of the solution. -1 GDYO-MB-Au NRs composite solution.
[0114] (4) Preparation of TDN solution:
[0115] Four single-stranded DNA solids were taken and labeled S1, S2, S3, and S4, and dissolved in TE buffer to obtain four 100 μM TE solutions. Subsequently, the four TE dilution solutions were diluted in TM buffer to obtain four 6 μM TM dilution solutions. Tris(2-carboxyethyl)phosphine was added to the TM dilution solutions. Finally, the four single-stranded DNA solutions were mixed in equal proportions and incubated at 95 °C for 2 min. Then, the temperature was rapidly reduced to 4 °C and incubated for 10 min. After the reaction, a TDN solution with a concentration of 1.5 μM was obtained.
[0116] (5) Preparation of DNA complex structure solution:
[0117] Five single-stranded DNA solids were taken and labeled Apt, single-stranded A, single-stranded B, single-stranded C, and single-stranded D. They were dissolved in TE buffer to obtain five TE solutions. Subsequently, the five 100 μM TE solutions were diluted in TM buffer to obtain five 10 μM TM solutions. Finally, the five single-stranded DNA solutions were mixed in equal proportions and incubated at 37 °C for 30 min. After the reaction, a DNA complex structure solution with a concentration of 2 μM was obtained.
[0118] (6) Synthesis of CdSe QDs-DNA complex solution:
[0119] CdSe QDs were synthesized by an amide reaction with amino-containing DNA. 200 μL of 10 mM phosphate-buffered saline (PBS, pH 7.4) containing N-(3-dimethylaminopropyl)-N-ethylcarbodiimide salt (EDC, 10 mM) and N-hydroxysuccinimide (NHS, 5 mM) was added to 1 mL of 0.1 mg / mL solution. -1 The carboxyl groups were activated in CdSe QDs solution at room temperature for 30 min. Then, 300 μL of 2 μM DNA was added and allowed to stand for 12 h. After centrifugation once at 1000 rpm, the solution was reconstituted with de-TM buffer to obtain a CdSe QDs-DNA complex solution with a concentration of 2 μM.
[0120] (7) Pretreatment of glassy carbon electrode:
[0121] First, the glassy carbon electrode was polished on chamois leather with aluminum oxide, and then ultrasonically treated in ethanol and ultrapure water for 30 seconds respectively.
[0122] (8) Electrochemical biosensors:
[0123] A glassy carbon electrode surface was modified with 6 μL of GDYO-MB-Au NRs composite solution and incubated at 37 °C for 1 h. Then, a 1.5 μM TDN solution was added to the electrode surface and incubated at 4 °C for 12 h. Subsequently, 6 μL of 1 mL MMCCH was dropped onto the electrode surface to block the Au active sites, and the block was maintained at room temperature for 40 min. Then, 6 μL of 2 μM dSe QDs-DNA composite solution was added to the electrode interface and incubated at 37 °C for 30 min. Finally, 6 μL of 100 fg mL... -1 The target compound FB1 was incubated at room temperature for 40 min to obtain an electrochemical biosensor.
[0124] (9) Take multiple electrochemical biosensors constructed in the above steps, and modify their surfaces with a concentration of 0.5 fg / mL. -1 5fg mL -1 10 fg mL -1 50 fg mL-1 100 fg mL -1 500 fg mL -1 1000 fg mL -1 5000 fg / mL -1 ,
[0125] 10000fg mL -1 After incubating with FB1 solution at room temperature for 40 min, rinsing with PBS, and irradiating the sensing interface under white light for 8 min, an electrochemical biosensor with completed recognition and detection was obtained. One concentration of FB1 solution corresponds to one electrochemical biosensor, with a one-to-one correspondence between concentration and electrochemical biosensor.
[0126] (10) Using a three-electrode system (with the electrochemical biosensor that has been identified and detected as the working electrode, Pt as the counter electrode, and Ag / AgCl as the reference electrode), the current at the interface of the electrochemical biosensor was detected by SWV on a CHI660E electrochemical workstation. Since FB1 Apt has specific recognition of FB1, when FB1 is present, the CdSe QDs-DNA complex structure is stripped from the electrode interface, and the photodegradation effect of CdSe QDs on MB is reduced. At this time, the electrochemical signal generated by MB increases. Each concentration of FB1 will correspond to a current value of MB. A standard curve is constructed based on the current value and the logarithm of the FB1 concentration.
[0127] Calculate the concentration C of FB1 in the standard solution. FB1 with I p The linear regression equation is given by equation I. MB =0.94+0.19lgC FB1 This serves as the linear equation for FB1 in actual detection.
[0128] (11) Rice sample testing:
[0129] The rice sample was ground into rice flour, and 3 grams of rice flour was soaked in a methanol-water mixture (60:40, v / v, 30 mL). Extraction was performed by shaking for 30 min, followed by centrifugation at 6000 rpm for 15 min. The supernatant was then dialyzed through a 0.22 μm ultrafiltration membrane to obtain the rice sample extract. 0, 1, and 100 ng / mL of the extract were added respectively. -1 FB1, diluted 10 5 After doubling, perform the test and substitute the values. Figure 5 The detection recovery rate was obtained from the linear regression equation in the table, as shown in Table 1.
[0130] Table 1: Recovery rate of FB1 in rice samples
[0131]
[0132] As can be seen from Table 1, the electrochemical biosensor prepared in this embodiment can sensitively and quantitatively detect FB1 in the sample, without requiring professional training and is easy to operate.
[0133] Note: The above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention. Therefore, although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention. All technical solutions and improvements that do not depart from the spirit and scope of the present invention should be covered within the scope of the claims of the present invention.
Claims
1. A method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection, characterized in that, The steps are as follows: (1) Preparation of gold nanorod solution: S1. First, deionized water, hexadecyltrimethylammonium bromide aqueous solution, chloroauric acid aqueous solution, and sodium borohydride solution are mixed and stirred. After stirring, the mixture is allowed to stand for a period of time under certain temperature conditions to obtain the gold seed solution. S2. Mix CTAB aqueous solution, HAuCl4 aqueous solution, silver nitrate aqueous solution, hydrochloric acid aqueous solution and ascorbic acid aqueous solution, then add gold seed solution, let stand for a period of time under certain temperature conditions, centrifuge, wash, and redissolve in deionized water to obtain gold nanorod solution, denoted as Au NRs solution; (2) Preparation of cadmium selenide quantum dot solution: S1. First, deionized water is degassed with nitrogen, then selenium powder and sodium borohydride are added, and the mixture is left to stand for a period of time to obtain a sodium selenium hydride precursor solution. S2. Deionized water is degassed with nitrogen, then CdCl2•2.5H2O is added to the deionized water and stirred in a nitrogen atmosphere. Mercaptohexanoic acid is then added to obtain a mixture. After adjusting the pH, the mixture is stirred in a nitrogen atmosphere for a period of time. After stirring, the sodium selenide precursor solution prepared in step (2) S1 is added. The resulting mixture is then purged with nitrogen for a period of time and reacted in a microwave synthesizer. After the reaction, a pale yellow CdSe QDs stock solution is obtained. After centrifugation, washing, drying, and resolubilization in deionized water, a cadmium selenide quantum dot solution was obtained, denoted as CdSe QDs solution; (3) Preparation of graphdiyne oxide-methylene blue-gold nanorod composite solution: Graphene oxide powder was dispersed in deionized water, followed by the addition of methylene blue solution. After shaking for a period of time, Au NRs solution prepared in step (1) was added. After shaking continued, the solution was centrifuged and re-dissolved in deionized water to obtain graphynyne oxide-methylene blue-gold nanorod composite solution, denoted as GDYO-MB-Au NRs composite solution. (4) Preparation of DNA tetrahedral nanostructure solution: Four types of single-stranded DNA solids were taken and labeled S1, S2, S3, and S4, and dissolved in TE buffer to obtain four TE solutions. Subsequently, the four TE solutions were diluted in TM buffer to obtain four TM diluents. Tris(2-carboxyethyl)phosphine (TCEP) was added to the TM diluents to obtain four single-stranded DNA solutions. Finally, the mixture of the four single-stranded DNA solutions in equal proportions was heated and then cooled to obtain a DNA tetrahedral nanostructure solution, labeled TDN solution. (5) Preparation of DNA complex structure solution: Five single-stranded DNA solids were taken and labeled as aptamer, single-stranded A, single-stranded B, single-stranded C, and single-stranded D. They were dissolved in TE buffer to obtain Apt solution, single-stranded A solution, single-stranded B solution, single-stranded C solution, and single-stranded D solution, respectively. These solutions were then diluted with TM buffer to obtain Apt dilution, single-stranded A dilution, single-stranded B dilution, single-stranded C dilution, and single-stranded D dilution. Finally, the five dilutions were mixed in equal proportions and heated to obtain a DNA complex solution. (6) Synthesis of CdSe QDs-DNA complex solution: Add the phosphate buffer containing N-(3-dimethylaminopropyl)-N-ethylcarbodiimide salt and N-hydroxysuccinimide to the CdSe QDs solution obtained in step (2) and react at room temperature for a period of time. Subsequently, the DNA complex structure solution obtained in step (5) was added and allowed to stand for a period of time. After standing, the precipitate was centrifuged and reconstituted with TM buffer to obtain the CdSe QDs-DNA complex structure solution. (7) Pretreatment of glassy carbon electrode: First, the glassy carbon electrode is polished on chamois with alumina, and then ultrasonically treated in ethanol and ultrapure water respectively to obtain the pretreated glassy carbon electrode. (8) The GDYO-MB-Au NRs composite solution prepared in step (3) was dropped onto the pretreated glassy carbon electrode surface for the first incubation; then the TDN solution prepared in step (4) was dropped on for the second incubation and washed with PBS buffer; then mercaptohexanol was dropped on the electrode surface and sealed at room temperature for a period of time to seal the non-specific active sites on the gold electrode surface. Subsequently, the CdSe QDs-DNA complex solution was dropped onto the electrode surface for a third incubation, after which the electrochemical biosensor was obtained.
2. The method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection according to claim 1, characterized in that, In step (1), S1, the volume ratio of deionized water, hexadecyltrimethylammonium bromide aqueous solution, chloroauric acid aqueous solution, and sodium borohydride solution is 4.5 mL: 5 mL: 500 μL: 610 μL, wherein the concentration of hexadecyltrimethylammonium bromide aqueous solution is 0.2 M, the concentration of chloroauric acid aqueous solution is 5 mM, and the concentration of sodium borohydride solution is 10 mM; the stirring time is 2-5 min, the temperature condition is 30 ℃, and the standing time is 2 h; in step (1), S2, the volume ratio of CTAB aqueous solution, HAuCl4 aqueous solution, silver nitrate aqueous solution, hydrochloric acid aqueous solution, ascorbic acid aqueous solution, and gold seed solution is 24 mL: 4.8 mL: 50 μL: 32 μL: 2.8 mL: 48 μL, wherein the concentration of CTAB aqueous solution is 0.2 M, the concentration of HAuCl4 aqueous solution is 5 mM, the concentration of silver nitrate aqueous solution is 0.1 M, and the concentration of hydrochloric acid aqueous solution is 1.2 M. M, the concentration of ascorbic acid aqueous solution is 10 mM; the temperature conditions are 30℃, the standing time is 20 h; the concentration of Au NRs solution is 0.4 μM.
3. The method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection according to claim 1, characterized in that, In step (2) S1, the ratio of deionized water, selenium powder, and NaBH4 is 5 mL: 7.9 mg: 7.6 mg; the degassing time is 20-30 min, and the standing time is 2 h; in step (2) S2, the ratio of deionized water, CdCl2•2.5H2O, mercaptohexanoic acid, and sodium selenide precursor solution is 50 mL: 45.7 mg: 44 μL: 5 mL; the degassing time is 20-30 min, the stirring time of adding CdCl2•2.5H2O in a nitrogen atmosphere is 5 min, the stirring time is continued in a nitrogen atmosphere for 30 min, and the resulting mixed solution is continued to be purged with nitrogen for 15 min. The pH was adjusted to 11 using sodium hydroxide; the reaction time in the microwave synthesizer was 4 h; the centrifugation speed was 12000 rpm, and the centrifugation time was 10 min; washing was performed three times with isopropanol; the concentration of the CdSe QDs solution was 0.1 mg / mL. -1 .
4. The method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection according to claim 1, characterized in that, In step (3), the amounts of graphene oxide powder, deionized water, methylene blue solution, and Au NRs solution are in the following ratio: 4 mg: 1 mL: 1 mL: 2 mL, wherein the concentration of the methylene blue solution is 100 μM and the concentration of the Au NRs solution is 0.4 nM; the shaking time is 1 h, the centrifugation speed is 1000 rpm, and the time is 5-15 min; the concentration of the GDYO-MB-Au NRs composite solution is 1 mg / mL. -1 .
5. The method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection according to claim 1, characterized in that, In step (4), the concentration of the four TE solutions is 100 μM; the concentration of the four TM diluents is 6 μM; and the final concentration of TCEP in the four TM diluents is 3 mM. The sequences from the 5' to the 3' ends of S1, S2, S3, and S4 are as follows: S1, SH-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC; S2, SH-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC; S3, SH-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT; S4, ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTAAG ATTGCACGGACTA; The heating reaction is carried out at 95 °C for 2 min; the cooling reaction is carried out at 4 °C for 10 min; the concentration of TDN is 0.5-2.0 μM.
6. The method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection according to claim 1, characterized in that, In step (5), the heating reaction is carried out at a temperature of 37 °C for 30 min; the sequences from the 5' to the 3' ends of the aptamer, single chain A, single chain B, single chain C, and single chain D are as follows: Aptamer: ATA CCA GCT TAT TCA ATT AAT CGC ATT ACC TTA TAC CAG CTT ATT CAATTA CGT CTG CAC ATA CCA GCT TAT TCA ATT AGA TAG TAA GTG CAA TCT; Single-chain A, NH-AATTGAATAAGCTGG; Single-chain B, NH-CAGACGTAATTGAAT; Single-chain C, NH-GTATAAGGTAATGCG; Single-chain D, NH-TGAATAAGCTGGTAT; The concentration of the DNA complex solution is 2 μM.
7. The method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection according to claim 1, characterized in that, In step (6), the volume ratio of phosphate buffer, CdSe QDs solution, and DNA complex solution is 200 μL: 1 mL: 300 μL. The phosphate buffer has a pH of 7.4 and a concentration of 10 mM. The final concentrations of N-(3-dimethylaminopropyl)-N-ethylcarbodiimide salt and N-hydroxysuccinimide in the phosphate buffer are 10 mM and 5 mM, respectively. The concentration of the CdSe QDs solution is 0.1 mg / mL. -1 The concentration of the DNA complex solution was 2 μM. The reaction was carried out at room temperature for 30 min; the reaction was allowed to stand for 12 h; and the concentration of the CdSe QDs-DNA complex solution was 2 μM.
8. The method for preparing a photocatalytic signal amplification electrochemical biosensor for fumonisin B1 detection according to claim 1, characterized in that, In step (7), the ultrasonic treatment conditions are 30 s; in step (8), the amount of GDYO-MB-Au NRs composite solution added is 6 μL; the temperature of the first incubation is 37 ℃, and the incubation time is 1 h; the concentration of the TDN solution is 0.5-2 μM; the time of the second incubation is 12 h, and the incubation temperature is 4 ℃; the concentration of mercaptohexanol (MCH) is 1 mM; the amount used is 6 μL; and the sealing time at room temperature is 40 min. The volume of the CdSe QDs-DNA complex solution was 6 μL; the concentration of the CdSe QDs-DNA complex solution was 2 μM; the temperature of the third incubation was 37 °C, and the incubation time was 20-100 min.
9. The use of the electrochemical biosensor prepared according to any one of claims 1-8 for the detection of fumonisin B1, characterized in that, The steps are as follows: (1) First, prepare FB1 solutions of different concentrations; then take multiple electrochemical biosensors constructed in the above steps, modify their surfaces with FB1 solutions of different concentrations, incubate at room temperature for a period of time, and after rinsing with PBS, irradiate the electrochemical biosensors under white light to obtain electrochemical biosensors that have completed recognition and detection; one concentration of FB1 solution corresponds to one electrochemical biosensor, and there is a one-to-one correspondence between concentration and electrochemical biosensor; (2) Using a three-electrode system, with the electrochemical biosensor identified and detected in step (1) as the working electrode, Pt as the counter electrode, and Ag / AgCl as the reference electrode, electrochemical detection is performed to obtain the current of the electrochemical biosensor; among which FB1Apt specifically recognizes FB1. When FB1 is present, the CdSe QDs-DNA complex structure is stripped from the electrode interface, and the photodegradation effect of CdSe QDs on MB is reduced. At this time, the electrochemical signal generated by MB increases. Each concentration of FB1 solution corresponds to a current value of MB, denoted as I. MB ; According to I MB A standard curve was constructed using the logarithm of FB1 concentration; (3) Detection of FB1 in the sample to be tested: First, obtain the sample liquid to be tested, modify a certain volume of the sample liquid to be tested on the sensor surface, incubate according to the incubation conditions in step (1), and continue to operate according to step (2). The corresponding current value is obtained by electrochemical detection, and the current value is substituted into the standard curve constructed in step (2) to realize the detection of FB1 in the unknown sample.
10. The use according to claim 9, characterized in that, In step (1), the concentration of the FB1 solution is 0.5 fg / mL. -1 -10 pg mL -1 The amount of modification used is 6 μL; the incubation period at room temperature is 40 min, and the irradiation period under white light is 8 min; in step (3), the amount of modification of the sample solution to be tested is 6 μL; the incubation period at room temperature is 40 min.