Molecular markers linked to pepper pericarp thickness and their applications

By using the InDel variant marker on chromosome 4 of the pepper genome, the accuracy and efficiency issues of pepper pericarp thickness breeding were resolved, achieving efficient and accurate pericarp thickness identification and improving the breeding process and selection efficiency.

CN117887886BActive Publication Date: 2026-06-30HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2024-01-12
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for breeding pepper pericarp thickness makes traditional breeding time-consuming, labor-intensive, and susceptible to environmental influences, resulting in poor accuracy.

Method used

A molecular marker for the InDel variation at nucleotide 30027941 on chromosome 4 of the pepper genome was developed. Through PCR amplification and agarose gel electrophoresis, a highly efficient and accurate identification of pepper pericarp thickness was achieved.

Benefits of technology

It enables accurate prediction of fruit peel thickness during the chili seedling stage, improves breeding efficiency, reduces the workload of later phenotypic identification, and quickly screens superior target plants with an accuracy rate of 95.2%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117887886B_ABST
    Figure CN117887886B_ABST
Patent Text Reader

Abstract

This application discloses a molecular marker linked to pepper pericarp thickness and its application. The molecular marker comprises a nucleotide sequence formed by an InDel mutation at nucleotide position 30027941 on chromosome 4 of the pepper genome. This molecular marker effectively addresses the shortcomings of conventional breeding methods, including the need for destructive sampling to determine pericarp thickness at fruit maturity, the significant variability in measurement results due to the influence of planting and management factors on pericarp thickness, and the inability to effectively distinguish between heterozygous and homozygous states at the target locus. This molecular marker effectively solves these problems, allowing for accurate and efficient prediction of pericarp thickness during the pepper seedling stage. This reduces the planting scale of breeding materials, lessens the workload of later phenotypic identification, facilitates rapid screening for superior target plants, accelerates the breeding process, and significantly improves breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of chili pepper breeding technology, specifically to molecular markers linked to chili pepper pericarp thickness and their applications. Background Technology

[0002] Chili peppers are important vegetables and condiments. Peel thickness is a crucial trait of chili peppers, and the market offers a wide variety of varieties with different peel thicknesses. Thick-skinned and thin-skinned chili peppers each have their own characteristics, advantages, and disadvantages. Thick peels are beneficial for storage and transportation; thick-skinned chili peppers have a lower rate of decay after being left at room temperature for several days. Peel thickness is significantly negatively correlated with fruit water loss rate, but significantly positively correlated with the retention of vitamin C after storage. Soluble sugar content is also significantly positively correlated with peel thickness; generally, thick-skinned chili peppers have a higher soluble sugar content. Thin-skinned chili peppers are easier to cook and have a better taste. Therefore, breeding chili pepper varieties with different peel thicknesses is of great practical significance.

[0003] Traditional chili pepper breeding methods suffer from problems such as being time-consuming and labor-intensive, having poor accuracy, and being susceptible to environmental factors. In contrast, molecular breeding technology based on molecular marker-assisted selection (MAS) utilizes the close linkage between molecular markers and genes controlling target traits. By detecting molecular markers, the presence of genes controlling target traits can be detected, thereby achieving the purpose of selecting for the target trait. It has advantages such as early identification, speed, high accuracy, and being unaffected by environmental factors.

[0004] Current research on chili peppers focuses on fruit size, peel color, and fruit shape, with very little research on genes related to peel thickness. There are no molecular markers that can be used for breeding based on peel thickness. Summary of the Invention

[0005] This application has discovered a molecular marker linked to pepper pericarp thickness. This molecular marker provides technical support for the cloning of genes controlling pepper pericarp thickness and for pepper breeding, and has significant value.

[0006] Therefore, the embodiments of this application provide at least the following technical solutions:

[0007] Firstly, this embodiment provides a molecular marker linked to the thickness of the pepper pericarp. The molecular marker includes a nucleotide sequence formed by an InDel mutation at nucleotide position 30027941 on chromosome 4 of the pepper genome.

[0008] In some embodiments of the first aspect, the insertion sequence of the InDel is as shown in SEQ ID NO.1.

[0009] In some embodiments of the first aspect, when the nucleotide at position 30027941 of chromosome 4 of the pepper genome contains an insertion fragment as shown in SEQ ID NO.1, the corresponding pepper fruit exhibits a thick pericarp type; when the nucleotide at position 30027941 of chromosome 4 of the pepper genome does not contain an insertion fragment as shown in SEQ ID NO.1, the corresponding pepper fruit exhibits a thin pericarp type.

[0010] In some embodiments of the first aspect, the molecular marker has a nucleotide sequence as shown in SEQ ID NO:2 and / or SEQ ID NO:3.

[0011] Secondly, the embodiments disclose a primer pair. The primer pair includes InHD4-F as shown in SEQ ID NO:4 and InHD4-R as shown in SEQ ID NO:5.

[0012] Thirdly, the embodiments disclose a nucleic acid molecule. The nucleic acid molecule has a nucleotide sequence comprising an InDel mutation at nucleotide position 30027941 of chromosome 4 of the pepper genome.

[0013] In some embodiments of the third aspect, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO:2 and / or SEQ ID NO:3.

[0014] Fourthly, the embodiments disclose a kit for identifying the thickness trait of chili pepper pericarps. The kit includes the primer pair described in the second aspect.

[0015] Fifthly, an embodiment discloses a method for identifying the thickness trait of chili pepper pericarps. The method includes: performing PCR amplification using the DNA of the chili pepper to be tested as a template; detecting the amplification product by agarose gel electrophoresis; and identifying the chili pepper pericarp thickness trait based on the bands detected by the electrophoresis.

[0016] Sixthly, the embodiments disclose the application of the molecular markers described in the first aspect, the primer pairs described in the second aspect, the nucleic acid molecules described in the third aspect, the kits described in the fourth aspect, or the methods described in the fifth aspect in pepper breeding. Attached Figure Description

[0017] Figure 1 The figure shows the phenotypic characteristics of pericarp thickness of chili peppers JZ and JL at the green ripening stage, as provided in the example. In the figure, ♂ and ♀ represent the male parent JL and the female parent JZ, respectively, and the scale bar is 1 cm.

[0018] Figure 2The results of BSR analysis of the pepper F2 population provided in the example are shown. The peaks on chromosomes 4, 6, and 12 represent the regions where genes controlling pericarp thickness are located, and this marker is located on chromosome 4.

[0019] Figure 3 The band patterns for amplifying different types of peppers using the InHD4 marker provided in this example are shown. Lane M represents the marker, lane P1 represents the male parent JL (thick pericarp), lane P2 represents the female parent JZ (thin pericarp), and lane N represents the negative control amplified using water as a template. The other lanes represent individual plants from the BC4F2 population of JZ and JL, numbered 55-3, 55-4, 54-6, 54-11, 84-2, 84-3, 84-5, 84-6, 84-7, 55-12, 83-6, 83-7, 55-15, 84-12, 55-17, 83-9, 54-12, 55-20, 55-21, 54-7, and 184-10, respectively. The BC4F2 population of JZ and JL is obtained by backcrossing the F1 generation of JZ and JL with the recurrent parents JL and JZ for 4 generations, followed by 1 generation of self-crossing. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not described in detail herein are all conventional reagents and are commercially available.

[0021] In the following experimental procedures, unless otherwise specified, all operations shall be performed in accordance with the methods provided in Molecular Cloning: A Laboratory Manual (3rd Edition, translated by Huang Peitang et al., Beijing: Science Press, 2002).

[0022] With the development of gene sequencing technology and the publication of the chili pepper genome sequence, molecular biology research on chili peppers has progressed rapidly, and molecular breeding techniques are receiving increasing attention in chili pepper research. Developing linkage markers is an important method for studying the controlling genes of agronomic traits and for their localization and cloning, and it is also the foundation for marker-assisted selection breeding.

[0023] The applicant has invented a molecular marker that can be used to identify the thickness of chili pepper pericarps. This marker can effectively distinguish pericarp thickness in certain chili pepper resources, and can be combined with conventional breeding methods to cultivate new chili pepper varieties that meet market demands. At the same time, this invention also lays the foundation for cloning chili pepper pericarp thickness genes and further elucidating the molecular mechanism of pericarp thickness formation.

[0024] The example involved crossing thin-skinned pepper JZ (Capsicum annuum, also known as Hangzhou chicken claw pepper, Zhejiang Provincial Crop Germplasm Resource Bank No. ZJ01097) as the female parent and thick-skinned pepper JL (Capsicum annuum, also known as Jilin pointed pepper, National Vegetable Germplasm Resource Bank No. V06C0497) as the male parent to obtain the F1 generation. The F1 generation was then self-crossed to obtain the F2 population. The fruit thickness of the F2 population was scanned, and mixed pools of thin-skinned and thick-skinned peppers were constructed for RNA-Seq sequencing. The sequencing data were aligned to the reference genome CM334 (V1.55, Kim, S. et al. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat Genet). 46,270–278 (2014). https: / / doi.org / 10.1038 / ng.2877. Reads were extracted and sorted, and variant sites were identified. Pooled sequencing depth and gene frequency were filtered. Linear regression fitting was performed on the data using LOESS (locally weighted scatterplot smoothing) curves, and the results showed obvious signal peaks on chromosomes 4, 6, and 12 of the pepper genome. A threshold was set at three times the sum of the median and standard deviation of the power-law fitted values ​​for all sites. Regions exceeding this threshold were considered candidate regions. The candidate region for chromosome 4 was a 23.1 Mb physical region ranging from 26,157,962 bp to 49,255,539 bp. Initial localization located a site controlling pericarp thickness within this candidate region.

[0025] The example further demonstrates fine mapping by constructing a BC4F2 population through backcrossing. An InDe1 variant was discovered at nucleotide 30027941 on chromosome 4. This InDel is an insertion variant, and its sequence is shown in SEQ ID NO.1. This InDel variant is closely linked to the pepper pericarp thickness trait. The fine mapping process specifically includes: using JL as the recurrent parent, artificial pollination was performed for four consecutive generations of backcrossing to construct near-isogenic lines; molecular markers developed based on the initial mapping interval were used to track the target site, resulting in BC1F1, BC2F1, BC3F1, and BC4F1 pepper populations; BC4F1 was then self-crossed to obtain the BC4F2 population; recombinant BC4F2 plants were used to further narrow down the interval of the major QTL regulating pepper pericarp thickness, locking the pepper pericarp thickness gene to a 2.1Mb interval on chromosome 4, and selecting candidate control genes. Simultaneously, an InDel located at nucleotide 30027941 on chromosome 4 of the pepper genome was screened and named InHD4. In this example, the molecular marker was used to identify the pericarp thickness trait of pepper germplasm resources, with an accuracy rate of 95.2%.

[0026] The technical solution provided in this embodiment can accurately and efficiently predict the thickness of the fruit peel during the seedling stage of chili peppers, thereby effectively reducing the planting scale of breeding materials, reducing the workload of later phenotypic identification, quickly screening out superior target plants, accelerating the breeding process, and greatly improving breeding efficiency.

[0027] Based on this, an embodiment provides a molecular marker linked to the thickness of the pepper pericarp, the molecular marker comprising a nucleotide sequence formed by an InDel mutation at nucleotide position 30027941 on chromosome 4 of the pepper genome. In some embodiments, the InDel insertion sequence is shown in SEQ ID NO.1.

[0028] In some embodiments, the molecular marker has a nucleotide sequence as shown in SEQ ID NO:2 or SEQ ID NO:3.

[0029] Based on this, an embodiment provides a primer pair comprising InHD4-F as shown in SEQ ID NO:4 and InHD4-R as shown in SEQ ID NO:5. This primer pair can be used for PCR amplification to obtain a nucleic acid fragment containing the 30027941st site of chromosome 4.

[0030] In fact, the embodiments also provide a nucleic acid molecule having nucleotide sequences as shown in SEQ ID NO:2 and / or SEQ ID NO:3. Specifically, the agarose gel electrophoresis bands of the amplification products obtained by PCR amplification of nucleotide sequences containing nucleotides near nucleotide position 30027941 on chromosome 4 of the pepper genome can accurately identify the pepper pericarp thickness trait.

[0031] Some embodiments provide a kit for identifying the pepper pericarp thickness trait, comprising primer pairs InHD4-F as shown in SEQ ID NO:4 and InHD4-R as shown in SEQ ID NO:5. Using this primer pair, PCR amplification can be performed on nucleotide sequences containing nucleotides near position 30027941 of chromosome 4 of the pepper genome, and the pepper pericarp thickness trait can be accurately identified based on the agarose gel electrophoresis bands of the amplified products.

[0032] In fact, the embodiment also provides a method for identifying the thickness trait of chili pepper pericarps, including: performing PCR amplification using the DNA of the chili pepper to be tested as a template; performing agarose gel electrophoresis on the amplification product; and identifying the thickness trait of the chili pepper pericarps based on the electrophoretic bands.

[0033] In some embodiments, if the amplification result contains only a band of approximately 174 bp, the chili pepper material is determined to be a thin-skinned material.

[0034] In some embodiments, if the amplification result contains only a band of approximately 256 bp, the chili pepper material is determined to be a thick pericarp material.

[0035] In some embodiments, if the amplification results contain bands of approximately 174 bp and approximately 256 bp, the pericarp thickness of the chili material is determined to be intermediate.

[0036] The nucleotide sequence of the large band (174 bp) in the amplified target band is shown below:

[0037] ATCACTCCCCAGACCATTCATGCTACTGTTAAGGTTAAGTAACCCTATTCTACTTGGATCCTTTCTATTGTCTATGCTAGCACTGAGTAGGGGGTGATTTTAAGGAAATCCTAGTAGCCTCTGATAAGTTTGGTGG TAATAGTATTAACATGCATAGGGATGATACTTTCTGGA, such as SEQ ID NO: 2

[0038] The nucleotide sequence of the large band (256 bp) in the amplified target band is shown below:

[0039] ATCACTCCCCAGACCATTCATGCTACTGTTAAGGTTAGTAAACCCTATTCTACTTGGATCCTTTCTATTGTCTATGCTAGCACTGA TTTCCATATTAGAAAATGTCTTTGGGATCAATTAATGAGCTTAGCTGATTCTCTTCAC TCCCTTGGTAGTACTTCTTGGATA GTAGGGGGTGATTTTAAGGAAATCCTAGTAGCCTCTGATAAGTTTGGTGGTAATAGTATTAACATGCATAGGGATGATACTTTCTGGA, as shown in SEQ ID NO:3; where the underscore is the InDel insertion sequence, as shown in SEQ ID NO.1.

[0040] In some embodiments, sequencing of the amplification product reveals a thin pericarp phenotype if the product described in SEQ ID NO. 2 is present. In some embodiments, sequencing of the amplification product reveals a thick pericarp phenotype if the product described in SEQ ID NO. 3 is present. In some embodiments, sequencing of the amplification product reveals a medium-thickness pericarp phenotype if the product described in SEQ ID NO. 2 and 3 is present.

[0041] In these embodiments, the pericarp thickness is measured as the pericarp thickness of peppers at the green-ripe stage, for example, the thin pericarp trait thickness is 1.95 ± 0.33 mm. Within the range of ), the thickness of the thick pericarp trait is 3.32±0.26 mm. Within the range of ), the intermediate thickness of the pericarp is between 2.28 and 3.06 mm.

[0042] The examples provide the application of the aforementioned molecular markers, primer pairs, nucleic acid molecules, kits, or methods in pepper breeding.

[0043] The present application will be further described below with reference to more specific embodiments. Of course, the following embodiments should not be construed as limiting the present application.

[0044] In this example, using the molecular markers obtained above, primer pairs were designed to amplify nucleotide sequences near nucleotide position 30027941 on chromosome 4, in order to determine or identify the pepper pericarp thickness trait based on the PCR amplification products.

[0045] In some embodiments, the thickness trait of 21 pepper plants (a population obtained by backcrossing JL and JZ as recurrent parents for 4 generations followed by 1 generation of self-crossing) was identified. The steps included: using extracted pepper genomic DNA at a concentration of 80–150 ng / μL as a template, and performing PCR amplification using InHD4-F as described in SEQ ID NO. 4 and InHD4R as described in SEQ ID NO. 5 as primers. The PCR reaction system, in 10 μL volumes, contained: 1 μL genomic DNA, 5 μL 2×FineTaq PCR SuperMix(+dye) (purchased from Beijing TransGen Biotech Co., Ltd., catalog number AS101), 0.2 μL upstream primer, 0.2 μL downstream primer, and 3.6 μL ddH2O. The amplification primers were synthesized by Wuhan Tianyi Huayu Gene Technology Co., Ltd. The PCR reaction program was as follows: 94.0℃ pre-denaturation for 3 min; 94.0℃ denaturation for 30 s, 55.0℃ annealing for 30 s, 72.0℃ extension for 30 s, for 34 cycles; 72.0℃ extension for 5 min, and storage at 4℃.

[0046] like Figure 3 As shown, the amplified products were detected by 3% agarose gel electrophoresis. Based on the electrophoresis results, two specific bands may appear, with sizes of 174 bp and 256 bp, respectively. The presence of a single 174 bp band (as shown in SEQ ID NO. 2) indicates homozygous recessive phenotype, with a thin-skinned fruit. The presence of only one 256 bp band (as shown in SEQ ID NO. 3) indicates homozygous dominant phenotype, with a thick-skinned fruit. If both bands (174 bp and 256 bp) are present, the pericarp phenotype is intermediate.

[0047] In addition, the pericarp thickness trait of these pepper materials was re-examined, and the accuracy rate of detection using the molecular markers, primers, and kits provided in this application was calculated. The accuracy rate is the percentage of materials whose marker judgment results are consistent with the actual field phenotype. The results are as follows: Figure 3 As shown in Table 1, only the labeling results of material 54-12 are inconsistent with the actual phenotype in the field, which indicates that the molecular markers, primers and kits provided in this application have an accuracy of 95.2% in detecting or identifying the pepper pericarp thickness trait.

[0048] Table 1. Backtest Results

[0049] Single plant number Mark the judgment result Actual phenotype in the field 55-3 MIDDLE MIDDLE 55-4 MIDDLE MIDDLE 54-6 THICK THICK 54-11 THICK THICK 84-2 THIN THIN 84-3 THIN THIN 84-5 THIN THIN 84-6 THIN THIN 84-7 THIN THIN 55-12 MIDDLE MIDDLE 83-6 THIN THIN 83-7 THIN THIN 55-15 MIDDLE MIDDLE 84-12 THIN THIN 55-17 MIDDLE MIDDLE 83-9 THIN THIN 54-12 THIN MIDDLE 55-20 THIN THIN 55-21 THIN THIN 54-7 THICK THICK 184-10 THIN THIN

[0050] Note: THICK indicates a thicker peel, THIN indicates a thinner peel, and MIDDLE indicates a medium peel thickness.

[0051] The above analysis results indicate that molecular marker identification and screening in breeding, based on specific bands or genotypes, allows for selection of pericarp thickness during the seedling stage, improving selection efficiency, reducing the workload of later plant transplanting and screening, and accelerating the breeding process.

[0052] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. A molecular marker linked to the thickness of a chili pepper pericarp, wherein the molecular marker is an InDel variant at nucleotide position 30027941 on chromosome 4 of the chili pepper genome, reference genome CM334 V1.55; the InDel insertion sequence is shown in SEQ ID NO.1; when the insertion sequence is deleted, the nucleotide sequence is shown in SEQ ID NO.2, and when the insertion sequence is inserted, the nucleotide sequence is shown in SEQ ID NO.

3.

2. According to the molecular marker of claim 1, when the nucleotide at position 30027941 of chromosome 4 of the pepper genome contains the insertion fragment as shown in SEQ ID NO.1, the corresponding pepper fruit exhibits a thick pericarp type; when the nucleotide at position 30027941 of chromosome 4 of the pepper genome does not contain the insertion fragment as shown in SEQ ID NO.1, the corresponding pepper fruit exhibits a thin pericarp type.

3. An application of a primer pair for detecting the molecular marker of claim 1 in identifying the thickness trait of pepper pericarp, said primer pair comprising InHD4-F as shown in SEQ ID NO:4 and InHD4-R as shown in SEQ ID NO:

5.

4. The application of a kit for detecting the molecular marker of claim 1 in identifying the thickness trait of pepper pericarp, the kit comprising the primer pair of claim 3.

5. A method for identifying the thickness of chili pepper pericarps, the method comprising: PCR amplification was performed using the DNA of the pepper to be tested as a template and primer pairs, namely InHD4-F as shown in SEQ ID NO:4 and InHD4-R as shown in SEQ ID NO:5; The amplification products were subjected to agarose gel electrophoresis to detect the molecular marker described in claim 1; The thickness of the chili peel can be identified based on the bands detected by electrophoresis.

Citation Information

Patent Citations

  • InDel molecular marker for breeding white pepper variety and application of InDel molecular marker

    CN116732235A

  • COMPOSITIONS AND METHODS FOR ASSAYING MARKERS TIGHTLY LINKED TO RESISTANCE LOCUS Bs2 OF PEPPER

    US20100083399A1