A slightly acidic response type biomimetic nanovesicle and a preparation method and application thereof
By preparing the acid-responsive biomimetic nanovesicle Apa-PPNP@mPD-1, the problems of low bioavailability and high toxicity in the combined treatment of hepatocellular carcinoma with monoclonal antibodies and small molecule inhibitors were solved. This enabled targeted drug delivery and immune regulation of tumor tissue, improving treatment efficacy and patient compliance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
- Filing Date
- 2024-01-17
- Publication Date
- 2026-07-24
AI Technical Summary
In existing technologies, the combined use of monoclonal antibodies and small molecule inhibitors to treat hepatocellular carcinoma suffers from problems such as low bioavailability, easy development of drug resistance and toxic side effects, high treatment costs, and impact on patient compliance and treatment efficacy.
The microacid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 are composed of biological cell membranes and drug-loaded nanoparticles with a particle size of 60-70 nm. The surface is coated with PD-1 protein and the internal load is apatinib, a small molecule inhibitor of anti-angiogenesis. It can disintegrate and release the drug in a microacid environment, achieving synergistic delivery of small molecules and macromolecules.
It improves drug bioavailability, reduces toxic side effects, significantly enhances anti-tumor efficacy, reduces treatment costs, and achieves targeted drug delivery and immune regulation of tumor tissues.
Smart Images

Figure CN118045086B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a microacid-responsive biomimetic nanovesicle and its preparation method, as well as its application in the preparation of systemic tumor therapy drugs. Background Technology
[0002] Liver cancer is the fourth leading cause of cancer-related deaths worldwide, with hepatocellular carcinoma (HCC) accounting for approximately 90% of primary liver cancers. Early-stage HCC can be treated with radical surgery or ablation, while patients with advanced or aggressive HCC must receive systemic therapy, including targeted therapy based on tyrosine kinase inhibitors (TKIs) and immunotherapy using immune checkpoint inhibitors (ICIs). However, due to the interconnected immune evasion networks within the solid tumor microenvironment of liver cancer, current single-agent systemic tumor therapy strategies have limited efficacy, making multi-agent combination therapies a trend in the treatment of advanced HCC.
[0003] Currently, the combination therapy of the PD-L1 inhibitor atezolizumab and the angiogenesis inhibitor bevacizumab has replaced the classic sorafenib monotherapy as the first-line treatment for advanced hepatocellular carcinoma. However, both inhibitors are monoclonal antibodies (mAbs), and due to the inherent properties of monoclonal antibodies, the clinical application of this combination therapy still faces challenges. First, the high molecular weight of monoclonal antibodies makes them difficult to clear from the body, increasing the potential risk of immune responses. The long half-life of monoclonal antibodies also means they remain in the body for a longer period, increasing the time and likelihood of immune responses. Furthermore, problems may arise during the design and production of monoclonal antibodies, such as inappropriate target selection or excessively high affinity. These issues may lead to interactions with other normal cells or tissues in the body, triggering immune-related adverse events. This results in high inclusion criteria for patients eligible to use monoclonal antibodies, limiting the number of patients who can benefit. Second, the complexity of monoclonal antibody production leads to high treatment costs, exacerbating the economic burden on patients. Therefore, recent clinical studies have increasingly favored the use of equally effective but more economical small-molecule inhibitors, such as the small-molecule anti-tumor angiogenesis inhibitor apatinib. However, due to apatinib's poor solubility, it can only be administered orally in high doses, and long-term use can lead to severe drug resistance and toxic side effects, reducing patient compliance. On the other hand, when small-molecule inhibitors are used in combination with monoclonal antibodies, their inherently different physicochemical properties result in different pharmacokinetic profiles, thus weakening the bioavailability and efficacy of combined administration. Therefore, developing a single nanomedicine for multi-drug delivery is of great significance for reducing drug toxicity, improving drug bioavailability, and enhancing the anti-tumor efficacy of combination therapy. Summary of the Invention
[0004] The purpose of this invention is to leverage the advantages of nanotechnology to improve the shortcomings of existing technologies and provide a method for preparing and applying a slightly acid-responsive biomimetic nanovesicles that simultaneously deliver intravenously the anti-angiogenic small molecule inhibitor apatinib and PD-1 protein, thereby addressing the drawbacks of low bioavailability, easy drug resistance, and significant side effects when small molecule inhibitors are used in combination with large molecule antibodies.
[0005] The technical solution adopted in this invention is:
[0006] A slightly acid-responsive biomimetic nanovesicle, Apa-PPNP@mPD-1, is composed of a mixture of biological cell membranes and drug-loaded nanoparticles with a particle size of 60-70 nm. The surface of the biological cell membrane is transfected with programmed death receptor 1 (PD-1), and the drug-loaded nanoparticles include polyethylene glycol-poly(β-amino ester) amphiphilic block copolymers and internally loaded with anti-angiogenic small molecule inhibitors.
[0007] The drug-loaded nanoparticles are microacid-responsive nanoparticles formed by microemulsion method of polyethylene glycol-poly(β-amino ester) amphiphilic block copolymer and anti-angiogenic small molecule inhibitor; the microacid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 also include a biological cell membrane coated on the outer layer of the drug-loaded nanoparticles by ice bath ultrasound, the biological cell membrane is derived from the biological cell membrane of engineered 293FT cell line, and the surface of the biological cell membrane expresses PD-1 protein.
[0008] The anti-angiogenic small molecule inhibitor is apatinib. The mass ratio of the polyethylene glycol-poly(β-amino ester) amphiphilic block copolymer to the anti-angiogenic small molecule inhibitor is 10:1.
[0009] The mass ratio of total protein in the biological cell membrane to drug-loaded nanoparticles is 1.5:1.
[0010] The method for preparing the biological cell membrane includes:
[0011] Step 1. Insert the gene sequence encoding the PD-1 protein as shown in Example 1 into the pCDH-CMV-Puro empty vector plasmid to obtain the recombinant plasmid;
[0012] Step 2. Lentiviral packaging of recombinant plasmids was performed using 293FT cells. The concentrated viral solution was used to infect 293FT cells, and polybrene was added to enhance infection efficiency. Cells were screened using the resistance drug Puro to obtain stable cell lines. The successfully constructed stable cell lines were expanded and cultured, and cells were collected. PD-1 cell membranes were extracted using a cell membrane and cell protein extraction kit, and total protein was quantified using the BCA protein quantification method.
[0013] A method for preparing acid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1, characterized by being constructed by the following method:
[0014] (1) Prepare the biological cell membrane;
[0015] (2) Preparation of poly(ethylene) glycol-poly(β-amino ester) amphiphilic block copolymer: mPEG-OH 2000 was used as a raw material and reacted with allyl chloride to obtain an intermediate product. Then, 4,4-trimethylenedipiperidine and 1,4-butanediol dipropylene ester were added to the intermediate product, and a Michael addition reaction was carried out to obtain polyethylene glycol-poly(β-amino ester) amphiphilic block copolymer: PEG-PAEs, with a molecular weight of 11025 Da.
[0016] (3) PEG-PAEs were dissolved in anhydrous dichloromethane and apatinib was dissolved in DMSO; the two were mixed at a mass ratio of PEG-PAEs to apatinib of 10:1 and dispersed in DEPC water. The purified acid-responsive drug-loaded nanoparticles, Apa-PPNP, were obtained by ultrasonic emulsification, rotary evaporation and dialysis.
[0017] (4) The biological cell membrane is broken by ultrasound. Apa-PPNP and the biological cell membrane are ultrasonicated in an ice bath at a mass ratio of 1:1.5 for 1 to 2 minutes. Finally, the product is collected and obtained by ultrafiltration and washing to obtain Apa-PPNP@mPD-1 nanovesicles. The mass of the biological cell membrane is based on the total protein content.
[0018] The poly(ethylene) glycol-poly(β-aminoester) amphiphilic block copolymer contains hydrophilic segments of polyethylene glycol (PEG) and acid-responsive segments of poly(β-aminoesters) (PAEs). It is hydrophobic in a neutral environment, thus forming a nanoparticle system to load drugs inside. In the microacidic environment of tumors, it can undergo protonation, changing from hydrophobic to hydrophilic, causing the nanoparticles to break down and release the loaded drugs.
[0019] In this invention, acid-responsive block polymers PEG-PAEs are mixed with apatinib in a specific ratio, and then subjected to ultrasonic emulsification, rotary evaporation, and dialysis to obtain acid-responsive nanoparticles (Apa-PPNP). Cell membranes containing PD-1 are extracted from 293FT cells, blended with Apa-PPNP in a specific ratio, and then subjected to ice-bath ultrasonic treatment to obtain acid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 with a cell membrane coating. These vesicles can disintegrate in the weakly acidic tumor microenvironment, releasing apatinib, inhibiting tumor angiogenesis, and simultaneously blocking the PD-1 / PD-L1 immunosuppressive pathway, thereby enhancing tumor immunotherapy.
[0020] In this invention, the acid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 are used as a delivery platform to achieve the joint delivery of small molecule apatinib and PD-1 macromolecular protein, thereby achieving synergistic effects of the two inhibitors and preparing a drug composition for tumor treatment to exert anti-tumor effects.
[0021] This invention provides a novel dosage form for the combined administration of small-molecule and large-molecule inhibitors, its preparation method, and its applications. An acid-responsive delivery nanosystem for apatinib and PD-1 protein is provided for the treatment of hepatocellular carcinoma. This delivery system comprises: an inhibitor, an acid-responsive material, and a biomimetic cell membrane. The inhibitor is an anti-angiogenic inhibitor represented by small-molecule apatinib and another anti-tumor immune checkpoint inhibitor represented by PD-1 protein; the acid-responsive material includes one or more materials with acid-responsive capabilities, such as poly-β-amino esters; the biomimetic cell membrane is a cell membrane component of a cell line capable of stably expressing immune checkpoint-related proteins. The outer layer of the acid-responsive biomimetic nanovesicles of this invention is composed of a PD-1 biological cell membrane, with apatinib loaded into the hydrophobic core of its acid-responsive nanoparticles. These nanovesicles exhibit good stability, enabling targeted co-delivery of apatinib and PD-1 protein to tumor tissue, and releasing the drug in response to a slightly acidic environment. This achieves significant tumor growth regression and effective inhibition of lung metastasis while avoiding toxic side effects on normal tissues, demonstrating good biocompatibility and promising broad application prospects.
[0022] This invention also relates to the application of the aforementioned acid-responsive biomimetic nanovesicles in the preparation of tumor angiogenesis inhibitory drugs. Apa-PPNP@mPD-1 nanovesicles can effectively bind to the phosphorylation sites of VEGFR2, inhibiting tumor angiogenesis and cutting off the tumor's nutrient supply.
[0023] This invention also relates to the application of the aforementioned acid-responsive biomimetic nanovesicles in the preparation of tumor immune checkpoint inhibitors. Apa-PPNP@mPD-1 nanovesicles can relieve the immunosuppressive function of the PD-1 / PD-L1 biological axis.
[0024] In summary, this invention addresses the drawback of low efficacy in the combination therapy of TKIs and ICIs due to the different pharmacodynamics of macromolecular monoclonal antibodies and small molecule inhibitors. It provides a feasible alternative strategy that can significantly improve anti-tumor efficacy by reshaping the tumor microenvironment through a single nanoplatform, Apa-PPNP@mPD-1.
[0025] The Apa-PPNP@mPD-1 nanovesicles constructed in this invention can be administered by any known delivery method: systemic delivery (intravenous injection), intra-arterial, intratumoral, parenteral, intrapulmonary, local, or regional delivery.
[0026] The beneficial effects of this invention are mainly reflected in:
[0027] I. The Apa-PPNP@mPD-1 microacid-responsive biomimetic nanovesicles constructed in this invention are derived from biological organisms. Compared with other nanomaterials currently available that possess immunogenic killing functions for tumor cells, these nanovesicles have advantages such as good biocompatibility, low toxicity and side effects, and strong specificity. These nanovesicles can deliver a variety of small molecule drugs, while this biomimetic cell membrane strategy preserves the biological activity of protein molecules.
[0028] II. The Apa-PPNP@mPD-1 microacid-responsive biomimetic nanovesicles constructed in this invention integrate TKIs (small molecules) and ICIs (large molecules) inhibitors. They can disintegrate in the microacidic tumor microenvironment, specifically bind to the phosphorylation site of VEGFR2, inhibit tumor angiogenesis, block the PD-1 / PD-L1 inhibitory axis, regulate the tumor immune microenvironment, and achieve multi-faceted synergistic therapeutic effects on tumors. Attached Figure Description
[0029] Figure 1 The physicochemical parameters of the acid-responsive nanoparticles Apa-PPNP in this invention are shown at different PEG-PAEs and Apa weight ratios; where LC% represents the content of apatinib loaded in PEG-PAEs; EE% represents the efficiency of PEG-PAEs encapsulating apatinib.
[0030] Figure 2 The morphological characterization data of the acid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 of the present invention are shown; (a) the hydration particle size distribution of Apa-PPNP@mPD-1 nanovesicles under different mass ratios measured by DLS; (b) the TEM image of Apa-PPNP@mPD-1 nanovesicles; (c) the surface potential results of Apa-PPNP@mPD-1 nanovesicles measured by DLS.
[0031] Figure 3The acid-responsiveness of Apa-PPNP@mPD-1 of the present invention is shown. (a) DLS-measured hydrated particle size distribution of Apa-PPNP@mPD-1 in PBS solutions at pH 7.4 and pH 6.8. (b) Fluorescence imaging images of Nile red-PPNP@mPD-1 in PBS solutions at pH 7.4 and pH 6.8. Nile red is a lipophilic dye with environmentally sensitive fluorescence. Nile red exhibits strong fluorescence in hydrophobic (lipophilic) environments but weak fluorescence in aqueous media.
[0032] Figure 4 The anti-angiogenic ability of Apa-PPNP of the present invention is demonstrated;
[0033] Figure 5 The image shows the binding ability of Apa-PPNP@mPD-1 of the present invention to the PD-L1 receptor on the surface of Hepa 1-6 cells, and laser confocal images of PD-L1-EGFP (green fluorescence) and DiI-labeled PD-1 nanovesicles (red fluorescence). The yellow parts in the image are the overlapping areas.
[0034] Figure 6 The biocompatibility of the Apa-PPNP@mPD-1 vector of the present invention is demonstrated. Detailed Implementation
[0035] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0036] This embodiment provides a general description of the materials and testing methods used in the experiments of this invention. Although many of the materials and methods of operation used to achieve the objectives of this invention are well known in the art, this invention is still described in as much detail as possible herein.
[0037] like:
[0038] DEPC water is ultrapure water (Grade I water) treated with DEPC (diethyl pyrocarbonate) and sterilized under high temperature and pressure. It is a colorless liquid. DEPC water has been tested and found to be free of impurities such as RNA, DNA, and protein. It can be used to dissolve RNA precipitates, in various reaction systems containing RNA such as reverse transcription and siRNA annealing, and in other reaction systems that require the absence of RNase, DNase, and proteinase.
[0039] mCherry is a red fluorescent protein that is often used for tracing and labeling in the field of biotechnology, such as molecular labeling and localization of cellular components.
[0040] PMSF stands for Phenylmethanesulfonyl fluoride. It has the molecular formula C7H7FO2S, a molecular weight of 174.19, and a purity >99%. Phenylmethanesulfonyl fluoride is an organic compound with the molecular formula C7H7FO2S. It is a serine protease inhibitor and is commonly used in biochemistry to prepare cell lysates.
[0041] Acid-responsive block polymers PEG-PAEs are polymers composed of polyethylene glycol (PEG) and poly(β-amino esters) (PAEs). These polymers can dissociate in slightly acidic environments, thereby altering their physical morphology and chemical properties. Under normal physiological conditions, the PAE segments of PEG-PAEs maintain a compact structure due to their hydrophobicity caused by the presence of tertiary amines. When the environmental pH decreases to the tumor microenvironment pH (approximately 6.8), the tertiary amines of the PAEs undergo matrix protonation, causing the PAEs to transition from hydrophobic to hydrophilic, leading to micelle disintegration. This change can be used to design drug delivery systems for targeted drug release.
[0042] Those skilled in the art will understand that, unless otherwise specified in the context, the materials and methods of operation used in this invention are well known in the art.
[0043] Example 1:
[0044] (a) Construction of the recombinant transfer vector pCDH-CMV-PD-1-mCherry-Puro:
[0045] 1. Construction of the target recombinant gene PD-1-mCherry
[0046] The PD-1-mCherry gene sequence, a fusion protein artificially synthesized as shown in SEQ ID No. 01, is constructed by linking the gene sequence encoding the PD-1 protein with the gene sequence encoding the mCherry red fluorescent protein through a flexible peptide sequence (ggaggttctggtggatctggtggaggttctggttctggatcaggtggt, 48bp).
[0047] The PD-1-mCherry gene sequence SEQ ID No. 02 is as follows:
[0048]
[0049] 2. Construction of the recombinant transfer vector pCDH-CMV-PD1-mCherry-Puro
[0050] PD-1-mCherry was inserted into the empty vector pCDH-CMV-Puro (purchased from System Bioscience) to obtain the recombinant plasmid pCDH-CMV-PD-1-mCherry-Puro. The plasmid structure was determined by gene sequencing.
[0051] (II) Lentiviral packaging and transfection of 293FT cells
[0052] Lentiviral packaging of pCDH-CMV-PD-1-mCherry-Puro was performed using 293FT cells (from ATCC depositary information), as follows:
[0053] 1. Seed 293FT cells in 6-well plates and use them for lentivirus packaging when the growth density reaches 95-99%;
[0054] 2. Preparation of solution A: Mix 960 μL of Opti-MEM culture medium with 4 μL of Lipofectamine 3000 reagent thoroughly;
[0055] 3. Preparation of solution B: 960 μL of Opti-MEM medium was thoroughly mixed with Invitrogen's packaged plasmids: PLP1 (7.5 μg), PLP2 (3 μg), PLP / VSVG (4 μg), target plasmid pCDH-CMV-PD1-mCherry-Pur (10 μg) and 4 μL of P3000 reagent;
[0056] 4. Incubate the prepared solution A and solution B at room temperature for 5 minutes;
[0057] 5. Add solution A to solution B and mix well. Incubate at room temperature for 10-20 minutes, then add the complex to 293FT cells and shake well. Incubate in an incubator for 6 hours, then replace with fresh culture medium.
[0058] 6. Collect the virus solution 24h, 48h, 72h and 96h after transfection, centrifuge (3000-4000rpm, 30min), filter the virus solution with a filter, concentrate it by ultracentrifugation (100000×g, 90min), aliquot and store at -80℃ for later use.
[0059] 7. Infect 293FT cells with a viral solution containing polybrene (5 μg / mL) to enhance infection efficiency. Two days later, screen the cells with the resistance drug Puro (purinomycin) to establish a stable cell line. Finally, the successful construction of the PD-1 stable cell line was verified by laser confocal microscopy and flow cytometry.
[0060] (III) PD-1-mCherry 293FT cell expansion culture
[0061] Stable PD-1 and mCherry 293FT cell lines were expanded using DMEM medium containing 10% FBS at 37°C and 5% CO2. Cells were scraped off with a cell scraper, collected by centrifugation, and the cell membrane was obtained according to the instructions in the cell membrane extraction kit. Cells were resuspended in reagent A containing 1 mM PMSF and placed on ice for 30 minutes. Subsequently, the cell suspension was subjected to three freeze-thaw cycles at liquid nitrogen and room temperature, centrifuged at 5000×g for 10 min, and the supernatant was collected and centrifuged at 40000×g for 1 h to precipitate the mCherry-PD-1 293FT cell membrane (mPD-1). The cell membrane was redispersed in PBS and stored at -80°C for later use. Membrane protein concentration was quantified using a BCA protein quantification kit.
[0062] Example 2:
[0063] Preparation of acid-responsive block polymers PEG-PAEs:
[0064] 1. Synthesis of PEG acrylate (PEG) 5k -A)
[0065] 40 mL of anhydrous dichloromethane, 4.0 g of mPEG-OH 2000 (methoxylated polyethylene glycol (molecular weight 2000)), and 0.12 g of triethylamine were added to a 250 mL three-necked round-bottom flask (equipped with a dropping funnel) and cooled to 0 °C in an ice bath. 0.23 mL of allyl chloride was dissolved in anhydrous dichloromethane and added dropwise to the solution through the dropping funnel. The reaction temperature was maintained at 0 °C, and the mixture was stirred for 2 h, followed by reaction at room temperature for 20 h. The mixture was filtered, and the solution was extracted three times with 1 mol / L HCl solution. Anhydrous NaSO4 was added until the supernatant was clear, and the mixture was allowed to stand overnight. The filtrate was filtered, collected, and concentrated using a rotary evaporator. The concentrate was added dropwise to a hexane solution, and precipitation occurred at -20 °C to obtain the product. The product was placed in a vacuum filter and thoroughly dried to obtain PEG. 5k -A powder.
[0066]
[0067] 2. Synthesis of PEG-PAEs:
[0068] 0.1 mol of PEG 5k A, 1.0 mol of 4,4'-trimethylenedipiperidine, and 1.2 mol of 1,4-butanediol diacrylate were dissolved in chloroform, and the latter two solutions were added dropwise to PEG. 5k The resulting mixed solution was reacted in solution A at 50°C with stirring for 48 hours. After cooling to room temperature, it was concentrated using a rotary evaporator and added dropwise to n-hexane under vigorous stirring. The precipitated product was placed in a vacuum filter and thoroughly dried to obtain a pale yellow PEG-PAEs powder.
[0069]
[0070] Example 3:
[0071] Preparation of acid-responsive nanoparticles: Acid-responsive block polymers PEG-PAEs were dissolved in 950 μL of anhydrous dichloromethane. Apatinib was dissolved in dimethyl sulfoxide (DMSO). PEG-PAEs (5 mg) and apatinib (10 mg / mL, 50 μL) were respectively prepared at... Figure 1 The mass ratios shown are 20:1, 10:1, 5:1, and 2.5:1, which are mixed and dispersed in 2.5 mL of DEPC water and ultrasonically emulsified at 60 W for 2 minutes. Rotary evaporation is used to remove organic solvents such as dichloromethane and dimethyl sulfoxide from the emulsion. The evaporated solution is collected and unloaded free apatinib is removed by dialysis (8000–14000 Da molecular weight) to obtain purified Apa-PPNP nanoparticles. The concentration of apatinib in the product is determined using a SpectraMax M5 microplate reader (Molecular Devices, USA). Characterization of nanoparticles formed at different mass ratios is as follows: Figure 1 As shown, the results indicate that PD1 represents the polydispersity index, LC% represents the drug loading efficiency, and EE% represents the encapsulation efficiency. Compared to nanoparticles formed at other ratios, when PEG-PAEs are mixed with apatinib at a mass ratio of 10:1, the resulting nanoparticles are smaller in size, making them suitable as drug-loaded particles for tumor treatment. The nanoparticles also have a smaller polydispersity index, resulting in more uniform particle size. Furthermore, the nanoparticles possess better potential, leading to stable dispersion in solution. Finally, the nanoparticles exhibit higher apatinib loading and encapsulation efficiency.
[0072] Preparation of Apa-PPNP@mPD-1 biomimetic nanovesicles: First, the PD-1 cell membrane prepared in Example 1 was sonicated for 5 minutes to fully disrupt it. Then, the PD-1 cell membrane was combined with Apa-PPNP nanoparticles (the mass of the PD-1 cell membrane was calculated based on the total protein content on the cell membrane)... Figure 2 Different mass ratios (1:2, 1:1, 1:1.5, 2:1) were mixed and ultrasonicated in an ice bath for 1-2 minutes at an ultrasonic power of 20W. Finally, Apa-PPNP@mPD-1 was obtained by ultrafiltration, centrifugation, and washing twice. The particle size distribution of Apa-PPNP@mPD-1 nanovesicles in solution was measured by DLS, and the results are as follows... Figure 2 As shown in Figure a, when the mass ratio of PD-1 cell membrane to Apa-PPNP nanoparticles is less than 1:1, the product exhibits a larger particle size distribution in PBS compared to ddH2O. The poor stability of the product in PBS may be due to the expansion, disintegration, and aggregation of the biomimetic nanovesicles. This can lead to premature release of the drug carried within the nanovesicles during transport, making it difficult to reach the target site and affecting drug loading efficiency. The larger particle size also makes it harder to penetrate tumor tissue. Furthermore, the larger particle size of the biomimetic nanovesicles in PBS may cause deposition within blood vessels during blood transport, potentially irritating the blood vessel wall, causing inflammation, or stimulating thrombus formation. When the mass ratio of PD-1 cell membrane to Apa-PPNP nanoparticles is 1.5:1, the product is more stable in PBS, with a particle size distribution around 170 nm, and the particle size does not change significantly with increasing mass ratio. Therefore, a mass ratio of 1.5:1 for PD-1 cell membrane to Apa-PPNP nanoparticles is the optimal ratio for the experiment. The morphology of the product at this ratio was characterized by TEM, and the results are shown below. Figure 2 As shown in b, the results indicate that the nanovesicles are spherical core-shell structures with uniform particle size, and the particle size range is 60–70 nm under dry conditions; the results are characterized by particle size analysis as follows. Figure 2 As shown in c, the zeta surface potential of Apa-PPNP@mPD-1 nanovesicles in solution measured by DLS is around -20mV.
[0073] Example 4:
[0074] Apa-PPNP@mPD-1 was dispersed in 10mM PBS solutions at different pH conditions (pH = 6.8–7.4), and the particle size distribution of Apa-PPNP@mPD-1 nanovesicles at different pH conditions was measured by DLS.
[0075] In addition, the acid-responsive block polymer PEG-PAEs were dissolved in 950 μL of anhydrous dichloromethane. The Nile red fluorescent probe was dissolved in dimethyl sulfoxide (DMSO). PEG-PAEs (5 mg) were mixed with 0.05 wt% Nile red fluorescent probe and dispersed in 2.5 mL of DEPC water. The mixture was then ultrasonically emulsified at 60 W for 2 minutes. Rotary evaporation was used to remove dichloromethane and other organic solvents from the emulsion. The evaporated solution was collected, and unloaded Nile red fluorescent probe was removed by dialysis (8000–14000 Da molecular weight) to obtain purified Nile red-PPNP nanoparticles. The Nile red-PPNP nanoparticles were mixed with PD-1 cell membranes (PD-1 cell membrane mass is based on total protein content) at a mass ratio of 1:1.5 and ultrasonicated on ice for 1–2 minutes at 20 W. Finally, Nile red-PPNP@mPD-1 was obtained by ultrafiltration and centrifugation twice.
[0076] Nile red-PPNP@mPD-1 was also dispersed in 10 mM PBS solutions at different pH conditions to evaluate the microacid response performance of Apa-PPNP@mPD-1. The results are as follows... Figure 2 As shown, under pH 6.8 conditions, the hydrated particle size of the slightly acid-responsive biomimetic nanovesicles increases, and the fluorescence intensity of Nile Red decreases significantly. This indicates that the slightly acidic environment causes the nanovesicles to expand and then depolymerize, releasing the material originally encapsulated within the hydrophobic core into the hydrophilic environment.
[0077] Example 5:
[0078] 50 μL of matrix gel was spread evenly in pre-chilled 96-well plates and polymerized at 37°C for 1 hour. Subsequently, human umbilical vein endothelial cells (HUVECs) were resuspended in culture media containing free Apa (apatinib), PPNP (unloaded blank PEG-PAE nanoparticles), and Apa-PPNP at different pH conditions (pH 7.4 or 6.8), and the resuspension was transferred to the pre-coated 96-well plates for co-incubation. After 6 hours, the tubular structures were observed under a microscope. Results are as follows: Figure 3 As shown, only under pH 6.8 conditions did Apa-PPNP nanoparticles exhibit the same therapeutic effect as free apatinib, namely, significantly inhibiting the formation of HUVEC luminal structures.
[0079] Example 6:
[0080] PD-L1 with an EGFP green fluorescent tag was overexpressed on the surface of liver cancer cells (Hepa 1-6) by transfection plasmid with Lipo 3000. PD-L1 is programmed cell death ligand 1, and the PD-L1 protein can bind to the PD-1 receptor.
[0081] Then, the liver cancer cells (Hepa 1-6) were co-incubated with Apa-PPNP@mPD-1 nanovesicles labeled with the red fluorescent dye DiI at 4°C for 2 hours, and the fluorescence co-localization effect of the two was observed. The results are as follows: Figure 4 As shown, clear green and red signals are co-localized on Hepa 1-6 cells, demonstrating that nanovesicles can bind to PD-L1 on the cell surface. Furthermore, at pH 6.8, the red signal still co-localizes with the green signal on Hepa 1-6 cells, proving that a slightly acidic environment does not affect the activity of the PD-1 protein.
[0082] Example 7:
[0083] The effect of inhibitor-free (small molecule apatinib) nanovesicles on the proliferation of HUVECs and Hepa1-6 was detected using the CCK8 assay kit. Results are as follows: Figure 5 As shown, nanovesicles without inhibitors (small molecule apatinib) have no significant killing effect on human umbilical vein endothelial cells (HUVEC) and liver cancer cells (Hepa 1-6), indicating that the nanomaterial has good biosafety.
Claims
1. A slightly acid-responsive biomimetic nanovesicle Apa-PPNP@mPD-1, characterized in that, It is composed of a mixture of biological cell membranes and drug-loaded nanoparticles with a particle size of 60-70 nm. The surface of the biological cell membrane is transfected with programmed death receptor 1 (PD-1), and the drug-loaded nanoparticles include polyethylene glycol-poly(β-amino ester) amphiphilic block copolymers and internally loaded anti-angiogenic small molecule inhibitors. The chemical formula of the polyethylene glycol-poly(β-amino ester) amphiphilic block copolymer is: Its molecular weight is 11025 Da; The biological cell membrane is derived from the genetically engineered 293FT cell line, and the surface of the biological cell membrane expresses PD-1 protein. The anti-angiogenic small molecule inhibitor is apatinib.
2. The slightly acid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 as described in claim 1, characterized in that, The mass ratio of the polyethylene glycol-poly(β-amino ester) amphiphilic block copolymer to the anti-angiogenic small molecule inhibitor is 10:
1.
3. The slightly acid-responsive biomimetic nanovesicle Apa-PPNP@mPD-1 as described in claim 1, characterized in that, The mass ratio of total protein in the biological cell membrane to drug-loaded nanoparticles is 1.5:
1.
4. The preparation method of the microacid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 as described in claims 1-3, characterized in that, It is constructed using the following method: (1) Preparation of the biological cell membrane; (2) Preparation of poly(ethylene) glycol-poly(β-amino ester) amphiphilic block copolymer: mPEG-OH 2000 was used as raw material and reacted with allyl chloride to obtain intermediate product. Then, 4,4-trimethylenedipiperidine and 1,4-butanediol dipropylene ester were added to the intermediate product, and the product was subjected to Michael addition reaction to obtain polyethylene glycol-poly(β-amino ester):PEG-PAEs with a molecular weight of 11025 Da. (3) PEG-PAEs were dissolved in anhydrous dichloromethane and apatinib was dissolved in DMSO; the two were mixed at a mass ratio of PEG-PAEs to apatinib of 10:1 and dispersed in DEPC water. The purified acid-responsive drug-loaded nanoparticles, Apa-PPNP, were obtained by ultrasonic emulsification, rotary evaporation and dialysis. (4) The biological cell membrane is broken by ultrasound. Apa-PPNP and the biological cell membrane are ultrasonicated in an ice bath at a mass ratio of 1:1.5 for 1-2 minutes. Finally, the product is collected and obtained by ultrafiltration and washing to obtain Apa-PPNP@mPD-1 nanovesicles. The mass of the biological cell membrane is based on the total protein content.
5. The method as described in claim 4, characterized in that, The mass ratio of total protein in the biological cell membrane to drug-loaded nanoparticles is 1.5:
1.
6. The use of the microacid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 according to any one of claims 1 to 3 in the preparation of tumor therapeutic drugs.
7. The use of the microacid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 according to any one of claims 1 to 3 in the preparation of tumor immune checkpoint inhibitors.
8. The use of the microacid-responsive biomimetic nanovesicles Apa-PPNP@mPD-1 according to any one of claims 1 to 3 in the preparation of tumor angiogenesis inhibitory drugs.
Citation Information
Patent Citations
Genetically engineered cell membrane coating liposome nano-vesicle as well as preparation and application thereof
CN115120572A