A V3 neutralizing antibody isolated from a SHIV-challenged rhesus macaque

Abstract

The present application relates to a kind of V3 neutralizing antibody isolated from SHIV attack rhesus monkey in vivo, it is related to biomedical field.It is specifically related to the monoclonal antibody gene obtained from the specific memory B cell in the rhesus monkey attacked by SHIV, candidate monoclonal antibody is expressed in eukaryotic cell, and the antibody with higher broad-spectrum neutralizing activity is screened by function analysis.The present application is further related to the use of the above-mentioned monkey-derived monoclonal broad-spectrum neutralizing antibody for AIDS vaccine design and HIV-1 infected person treatment and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedicine, and relates to an anti-HIV-1 V3 neutralizing antibody isolated from a SHIV-infected rhesus monkey. Specifically, it relates to a monoclonal antibody gene obtained from specific memory B cells in a SHIV-infected rhesus monkey and a eukaryotic expressed monoclonal antibody. The present application further relates to the use of the above-mentioned monkey-derived monoclonal broad-spectrum neutralizing antibody in AIDS vaccine design and treatment of HIV-1 infected individuals. BACKGROUND

[0002] Human immunodeficiency virus (HIV) infection poses a great threat to global health, and has so far claimed the lives of more than 40 million people, but the epidemic is still spreading worldwide. There is still no effective vaccine to prevent this infectious disease, one of the main reasons being the extremely high level of genetic variation of the virus, which requires an effective vaccine to induce a cross-reactive immune response with sufficient protection. Studies have shown that about 20% of HIV-1 infected individuals will detect cross-neutralizing activity in their serum 2 to 4 years after infection. The antibodies present in the serum of these individuals can neutralize multiple HIV-1 strains by recognizing conserved regions of the HIV-1 envelope glycoprotein (Env) and are called broadly neutralizing antibodies (bnAb). The main recognition epitopes of broadly neutralizing antibodies (bnAb) are the V1V2 region at the top of Env, the CD4 binding site (CD4bs), the glycosylated V3 region, the silent face of gp120, the gp120-gp41 interface, the fusion peptide (FP) region, and the near-membrane external region on gp41. Developing an AIDS vaccine that can induce potent bnAb will be the key to preventing the disease, and is one of the main focuses of developing a neutralizing antibody-based AIDS vaccine.

[0003] The immunization regimen that has been verified for safety and effectiveness in animal models can only truly enter the human trial stage, so how to prove that the animal model can also produce similar broad-spectrum neutralizing antibodies in the human body is a very important research direction. Genes of monkeys and humans have high genetic similarity, and are important animal models for AIDS vaccine research. In order to evaluate the protective effect and ability of bnAbs induced by vaccination, a chimeric simian-human immunodeficiency virus (SHIV) between HIV and simian immunodeficiency virus (SIV) was generated by replacing the env gene in the SIV genome with the gene of HIV-1, which can produce similar symptoms of human AIDS infection in animals. There are two main research directions for monkey models at present, one is to immunize monkeys with immunogens and then attack them with SHIV to analyze the protection mechanism of the immunogen; or directly infect monkeys with SHIV to analyze the co-evolution of virus and antibody during long-term infection or test the effectiveness of immunotherapy. Isolating broad-spectrum neutralizing antibodies from monkeys in these two types of research and analyzing their production mechanism are of great significance to elucidate the host immunological mechanisms in the above processes. In recent studies, FP-specific neutralizing antibodies with a maximum neutralization breadth of 59% were isolated from immunized monkeys, and V2-specific neutralizing antibodies with a maximum breadth of 54% were isolated from monkeys infected with SHIV. At the same time, most antibody response studies in SHIV-infected rhesus macaques found that potent neutralizing antibodies usually target the V2 apex or the V3 region. However, there are still few studies on antibodies isolated from rhesus macaques, the mechanism of antibody production is not fully elucidated, and the similarities and differences between the neutralizing epitopes recognized by bnAbs produced in animals and humans still need further analysis. In previous studies, we found that antibodies with multiple specificities (V2, CD4bs, and V3) could be detected in rhesus macaques infected with SHIV 1157ipd3N4 for 5-6 years, and successfully isolated V2-specific broad-spectrum neutralizing antibody J038 (targeting V2 epitopes, neutralization breadth 54%) from G1015R monkey. However, the neutralizing antibodies with other specificities in G1015R plasma have not been characterized, and it is not yet known whether they will work together to increase the more extensive neutralization of viruses by G1015R. SUMMARY

[0004] The application provides a novel monkey-derived anti-HIV-1 monoclonal broad-spectrum neutralizing antibody JT18 which specifically targets Env V3 epitopes, and has similar neutralizing properties and recognizes epitopes as human-derived broad-spectrum neutralizing antibodies. 1157ipd3N4 Memory B cells specifically binding to viral envelope trimer protein in peripheral blood lymphocytes (PBMC) at the 350th week after infection of G1015R rhesus macaques with SHIV BRIEF DESCRIPTION OF DRAWINGS

[0005] Figure 1 A schematic diagram of the time points for infection and blood sampling of G1015R rhesus macaques and sorting of single cells from PBMC samples.

[0006] Figure 2 A specific memory B cell sorting strategy capable of binding to trimer antigen protein. In the gating sorting strategy, CD3 - CD14 - CD16- IgD - CD27 + CD20 + BG505 UFO-AF647 + gp120-BV421 + The cells are used for antibody gene amplification.

[0007] Figure 3 The gene sequence characteristics of the JT18 antibody (Figure A) and the amino acid alignment results of the gene of the antibody lineage that is homologous to it (Figure B).

[0008] Figure 4 This document outlines the construction strategy and binding ability assays for linear antibody expression fragments. Figure A shows a schematic diagram of the linear antibody expression vector construction process. Figure B shows the IgG secretion level detected by enzyme-linked immunosorbent assay (ELISA) in the antibody supernatant transfected with HEK293T cells. Figure C shows the reaction between the expressed supernatant antibody and SHIV. 1157ipd3N4 The ability to bind to specific antigens.

[0009] Figure 5 This document outlines the construction of eukaryotic expression plasmids for antibodies and the expression and purification of the antibodies. Figure A is a schematic diagram of the construction process for the eukaryotic expression plasmids, and Figure B shows the results of nucleic acid identification gelation and SDS-PAGE identification of the purified proteins during the construction process.

[0010] Figure 6 The binding affinity of the JT18 antibody was detected. Figure A shows the binding affinity using autologous SHIV. 1157ipd3N4 The binding ability of the JT18 antibody to the gp120 monomeric protein and the heterologous strain BG505 UFO trimer envelope protein was evaluated by ELISA. Figure B shows the competitive inhibition of the JT18 antibody binding by biotinylated N6 (recognizing CD4bs) and 447-52D antibody (recognizing V3). Figure C shows the binding effect of the JT18 antibody to BG505 UFO trimer and V3 peptide by biomembrane layer interference (BLI).

[0011] Figure 7 This study assessed the neutralizing capacity of the JT18 antibody. The neutralizing activity of the JT18 antibody against 17 HIV-1 Tier 2 strains, 3 Tier 1 strains, and homologous pseudoviruses was evaluated using a pseudovirus neutralization assay. A pseudovirus prepared from the envelope protein of rat leukemia virus (MLV) served as a negative control. The strength of the neutralizing activity was expressed as an IC50 value. 50 Values ​​are expressed in μg / ml. Detailed Implementation

[0012] The application will be further described in detail with reference to the accompanying drawings. The experimental methods used in the following embodiments are conventional methods unless otherwise specified; and the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified. All embodiments related to the isolation of JT18 antibody, gene construction, expression and functional verification are described in detail:

[0013] 1. Single cell flow sorting and antibody gene amplification;

[0014] 2. Construction of antibody expression linear fragments and preliminary screening of ELISA binding ability;

[0015] 3. Construction of antibody eukaryotic expression plasmid;

[0016] 4. Expression and purification of antibody protein;

[0017] 5. Antibody binding ability detection-ELISA competitive binding experiment and BLI experiment;

[0018] 6. Antibody function evaluation-neutralization experiment;

[0019] The specific implementation is as follows:

[0020] Example 1: Single cell flow sorting and antibody gene amplification

[0021] PBMC samples were obtained from SHIV 1157ipd3N4 infected Chinese rhesus monkeys G1015R for 350 weeks, and the stored SHIV infected rhesus monkey PBMC (~1×10 7 ) was immediately placed in a 37°C water bath. Then the recovered PBMC cells were transferred to a 15 ml sterile centrifuge tube, 5 ml RPMI culture medium containing 10% FBS was added, and centrifuged at 800 rpm at room temperature for 5 min. The supernatant was discarded, 1 ml 5% FBS-PBS was added to resuspend the cells, which were transferred to a sterile EP tube, centrifuged at 335 ×g for 10 min at room temperature, and a multi-fluorescent antibody mixture containing DEAD-Amcyan, CD16-PE CF594, CD14-PE Cy7, CD3-Percp Cy5.5, CD20-BB515, IgD-PE, CD27-APC Cy7, BG505-UFO AF647, HIV-1 A244gp120-BV421 antibodies was prepared. The cell suspension was incubated with the prepared antibody mixture for 45 min on a shaking bed, then 2 ml 5% FBS-PBS was added for washing, and after centrifugation, the supernatant was discarded and resuspended with 5% FBS-PBS, filtered and then placed into a flow cytometer for sorting. Then the sorted DEAD - CD16- CD14 - CD3 - CD20 + IgD - CD27 + BG505-UFO AF647 + HIV-1 A244gp120-BV421 + Single live cells were directly sorted into 96-well PCR plates containing RT lysis solution (RNase OUT 0.5 μl, 100 mM DTT 1.25 μl, 5x First-strand Buffer 5 μl, Igpeal 0.0625 μl) and stored at -80°C.

[0022] Single live cells preserved in cell lysis solution were obtained by flow sorting, followed by reverse transcription and nested PCR to amplify the antibody genes. Briefly, cDNA templates were obtained by reverse transcription PCR (reaction conditions: 42°C for 10 min, 25°C for 10 min for primer binding, 50°C for 60 min for extension, 94°C for 5 min for inactivation) with 150 ng / μl Random Hexamers (Qiagen), 4 μM high-purity dNTP (TransGen Biotech), and 200 U Superscript III (Invitrogen) added to the RT lysis buffer. The cDNA templates were then subjected to two rounds of nested PCR amplification using the full set of primers, and to minimize the error rate during PCR, the first round of amplification was performed using high-fidelity Taq DNA polymerase (Invitrogen). The reaction program was: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 62°C (Heavy) / 64°C (Kappa / Lambda) for 30 s, and extension at 68°C for 1 min, for a total of 35 cycles of denaturation, annealing, and extension, followed by an additional 10 min of extension at 68°C and storage at 4°C. The second round of amplification was performed using KOD polymerase (TOYOBO) with the following reaction conditions: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 55°C (CMV, LC) / 60°C (HC, LC) for 30 s, and extension at 68°C for 1 min 30 s, for a total of 35 cycles of denaturation, annealing, and extension, followed by an additional 5 min of extension at 68°C. The variable region of the rhesus monkey antibody was amplified by two rounds of amplification. The PCR products were identified by agarose gel electrophoresis, and the products from positive wells were sequenced. The clear sequences were uploaded to the international ImMunoGenetics information system (IMGT) V-quest web server (www.IMGT.org) to analyze the antibody repertoire of the amplified IgG heavy chain and light chain variable region sequences.

[0023] Example 2: Construction of antibody expression linear fragments and preliminary screening of ELISA binding ability

[0024] To complete high-throughput antibody screening, we first carried out preliminary screening by constructing a linear expression antibody means. The plasmids pHV00024, pRhIgG_HC_A1, pRhIg_KC_H5, pRhIg_LC_C9 used to obtain CMV promoter fragments and antibody constant region fragment genes were subjected to PCR with the corresponding primer sets as follows: CMV-P_F (AGTAATCAATTACGGGGTCATTAGTTCATAG), CMV-P_R (CATGGTGCTAGCCAGCTTGGGTC), RhIGC_HF2 (GGAGCACCTCCGAGAGCACAGC), RhIGC_LFV6 (CCACACTAGTGTGTCTGATCAGTG), BGH R1235 (TCCCCAGCATGCCTGCTATTGTC), the PCR components were accurately added to 50 μl PCR tubes, mixed well, the reaction conditions were 94°C pre-denaturation for 2 min, 94°C denaturation for 15 s, 55°C (CMV, LC) / 60°C (HC, LC) annealing for 30 s, 68°C extension for 1 min 30 s, denaturation, annealing and extension for 35 cycles, 68°C re-extension for 5 min, 4°C storage. The PCR results were identified by agarose gel electrophoresis and the PCR product fragments were obtained by gel recovery. The CMV promoter, constant heavy region, constant kappa region, and constant lambda region fragment genes were obtained, respectively. Then the CMV fragment, antibody variable region gene, and antibody constant region were loaded by overlap PCR, the reaction conditions were 94°C pre-denaturation for 2 min, 94°C denaturation for 15 s, 62°C / 64°C annealing for 30 s, 68°C extension for 2 min 30 s, denaturation, annealing and extension for 35 cycles, 68°C re-extension for 5 min, 4°C storage. The three fragments were successfully connected together by agarose gel electrophoresis identification, and the product was purified by a PCR product column purification kit to obtain linear expression of antibody heavy chain and light chain.

[0025] The heavy and light chains of the antibody can then be co-transfected into HEK293T cells for small scale expression. Fragment expression is performed in 293T cells using Effectene transfection reagent. Typically a 12 well plate is used and the cell number is between 70-80% optimal. Briefly, EP tubes are prepared with 17.5 μΐ EC buffer / tube. To the EC buffer tubes, 17.5 μΐ of heavy chain and the corresponding 17.5 μΐ of light chain fragment are added and mixed. To each antibody tube, 2.5 μΐ of Enhancer is added and mixed and pre-mixed at room temperature for 5 min. To each antibody tube, 10 μΐ of Effectene is added and mixed and incubated at room temperature for 15 min. 2% FBS complete media is prepared and the cell supernatant is removed from the well plate and 1 ml of media is mixed with the transfection mixture and slowly added to the well plate for transfection. The well plate is incubated in a 37°C incubator for 72 h and the supernatant is collected.

[0026] The culture supernatant is filtered through a 0.22 um filter to remove cell debris and concentrated to 250 μΐ using a 30 kD ultrafiltration tube. The concentrated supernatant is used for ELISA detection. For antibody binding capacity detection, SHIV 1157ipd3N4 gp120 and goat anti-monkey Ig (H+L) secondary antibody are diluted to 2.5 ng / μΐ and added to the reaction wells of a polystyrene plate at 100 μΐ / well and incubated at 4°C overnight. The next day, the solution in the wells is removed and washed 3 times with 200 μΐ / well PBST. Then 3% BSA (bovine serum albumin, prepared fresh) blocking solution is prepared in PBS and 200 μΐ of the blocking solution is added to each reaction well of the polystyrene plate and incubated at 37°C for 2 h. The wells are washed 3 times with PBST and 100 μΐ of secreted antibody supernatant is added to the coated wells and incubated at 37°C for 1 h. The wells are then washed 3 times with PBST and 100 μΐ of HRP goat anti-human IgG Fc secondary antibody diluted in 1% BSA in PBS is added to each well. The wells are incubated at 37°C for 1 h. After washing 3 times with PBST, 100 μΐ of TMB substrate solution is added and incubated at room temperature for 10-30 min. Finally, 50 μΐ of 2M sulfuric acid is added to stop the color development reaction. The absorbance OD value at 450 nm wavelength is detected on an ELX800 microplate reader. A value greater than 2.1 times the negative value is considered positive.

[0027] Example 3: Construction of antibody eukaryotic expression plasmid

[0028] The linear antibody expression fragment of Overlap PCR was introduced with Hind III and Nhe I enzyme cutting sites at both ends of the fragment by PCR. The two fragments containing sticky ends were obtained by double enzyme cutting of the linear fragment and the vector pcDNA3.1+ with Hind III and Nhe I and gel recovery, followed by T4 ligase system connection and transformation to obtain the correctly sequenced antibody expression plasmid for subsequent protein mass expression. In detail, the pcDNA3.1(+) plasmid was used as the expression vector. The Overlap PCR product antibody fragment was used as the template to introduce Nhe I / Hind III enzyme cutting sites at both ends by PCR. The sticky ends produced by Nhe I / Hind III double enzyme cutting were used to construct the antibody variable region fragment into the eukaryotic expression vector pcDNA3.1(+) to obtain the monoclonal antibody expression plasmid. The primers used were Common Nhe I-F (5'-CCACTGCTTACTGGCTTATCG-3'), Heavy-Hind III-R (5'-CCCAAGCTTTCATTTACCCGGAGACAGG-3'), and Lambda-Hind III-R (5'-CCCAAGCTTCTATGAACATTCTGCAGGGGC-3'). The reaction conditions were 94℃ pre-denaturation for 2 min, 94℃ denaturation for 15 s, 62℃ annealing for 30 s, 68℃ extension for 2 min, 35 cycles of denaturation, annealing and extension, 68℃ extension for 5 min, and 4℃ storage. The product was identified by agarose gel electrophoresis, and the PCR product column was purified, and the final elution volume was 50 μl. After treating the PCR product and the pcDNA3.1(+) vector with Nhe I / Hind III restriction endonuclease, the enzyme cutting products were obtained by gel recovery, followed by T4 DNA ligase to connect the PCR fragment and the vector into a complete plasmid, and the reaction conditions were 25℃, constant temperature connection for 30 min. Then, 10 μl of the ligation product was slowly added to the resuscitated DH5α competent cells, mixed, and then ice bathed for 30 min. The competent cells were heat shocked at 42℃ for 90 s, and ice bathed again for 2-3 min. 500 μl of LB liquid medium without antibiotics was slowly added to the heat shocked cells, and cultured in a shaker at 37℃ and 180 rpm / min for 45-60 min. After resuscitation, the cells were centrifuged at 3000 rpm and room temperature for 5 min, the supernatant was discarded, 100-200 μl of the supernatant was used to resuspend the bacterial liquid, and the LB solid medium containing ampicillin was plated and evenly coated until there was a blockage, and then incubated in a 37℃ constant temperature incubator overnight.The monoclonal colonies were picked into 5 mL LB liquid medium containing ampicillin in a small test tube, and cultured at 37 °C, 220 rpm / min in a shaker overnight, then plasmid extraction and subsequent identification were carried out. According to the operation instruction of plasmid extraction kit, the plasmid was extracted. 1 μl of the plasmid was directly used for agarose gel electrophoresis detection, and at the same time, the plasmid was digested with NheI / Hind III and identified by sequencing.

[0029] Example 4: Expression and purification of antibody protein

[0030] The suspended cells Expi293F were suspended and cultured at >80% relative humidity and 37 °C, 8% CO2 shaker, 120 rpm. When the cell density reached 1-3 x 10 6 cells / ml, the cells could be subcultured. Before transfection, the cells were counted to ensure that the cell density was 3-5 x 10 6 cells / mL. 7.5 x 10 7 cells were taken into 25.5 mL of expression medium (2.9 x 10 6 cells / mL). 30 μg of plasmid (heavy chain: light chain = 1:2) was added to 1.5 ml of Opti-MEM, and 81 μL of transfection reagent ExpiFectamine™ 293 transfection kit was added to 1.5 ml of Opti-MEM, and incubated at room temperature for 5 min. The transfection reagent mixture was added to the plasmid mixture, mixed gently, and incubated at room temperature for 20 min. The transfection system was slowly added to the cells, and shaken while adding. After 18-22 h (20 h) of transfection incubation, Enhancer 1 (150 μL) and Enhancer 2 (1.5 mL) were added. Usually, after 72 h of transfection, when the survival rate was <60%, the supernatant protein was harvested.

[0031] The harvested cell supernatant was centrifuged at 4°C 3500 rpm for 30 min to remove cells, and the supernatant was filtered through a 0.22 pm filter. The Protein A / G column material was added to the column, and 5 ml of binding buffer was added to equilibrate the column material, followed by 5 ml of binding buffer to resuspend the column material, which was centrifuged at 4°C 800 rpm for 10 min. The centrifuged column material was allowed to stand for 15 min, and the supernatant was discarded. The filtered supernatant and column material were mixed, and the mixture was incubated at 4°C overnight on a shaker. The mixture was applied to the column, and the flow-through was collected twice. The column was then washed with 15 ml of binding buffer, and the eluate was collected. The column was then washed with 5 ml of elution buffer, and the pre-eluate was collected. The eluate was collected using a 30 kD ultrafiltration tube, and the eluate was concentrated by centrifugation. The eluate was adjusted to physiological pH by adding 100 pL of neutralization buffer per 1 mL of eluate. The column was washed with 12 mL of elution buffer for regeneration. Finally, the column was washed with 5 mL of water containing 0.02% sodium azide and stored upright at 4°C. The eluate was concentrated using a 30 kD ultrafiltration tube using a centrifuge at 4°C 3500 rpm until the protein solution was about 500 pL. The eluate was replaced with PBS filter membrane 3-4 times, and the centrifugation conditions were 3500 rpm for 20 min. Finally, the eluate was ultrafiltrated to about 500 pL, mixed, and aliquoted into 1.5 mL centrifuge tubes. The protein concentration was measured using a nano. The antibody protein at 1 mg / mL was prepared for protein sample preparation using 4x loading buffer and subjected to denaturing gel electrophoresis. The gel was then stained with Coomassie Brilliant Blue staining solution and decolorized with a decolorizing solution to determine the molecular weight of the protein, and the gel was stored at -80°C.

[0032] Example 5: Detection of the binding ability of the antibody - ELISA competition binding experiment and BLI experiment

[0033] ELISA competition binding assay: for antibody binding ability detection, first dilute the antigen (1157 gp120 and BG505 UFO protein) to 2.5 ng / ul with coating buffer and add 100 ul / well to the reaction wells of polystyrene plates, incubate at 4°C overnight. The next day, discard the solution in the wells, wash 3 times with 200 ul / well PBST. Then use PBS to prepare 3% BSA (bovine serum albumin, prepared fresh) blocking solution, add 200 ul blocking solution to each reaction well of the polystyrene plate, incubate at 37°C for 2 hours. Wash 3 times with PBST, add 100 ul of 1% BSA PBS diluted antibody protein to the coated reaction wells, incubate at 37°C for 1 hour. Then wash 3 times with PBST, add 100 ul of HRP Goat-anti Human IgG Fc secondary antibody diluted with 1% BSA PBS to each reaction well. Incubate at 37°C for 1 hour. After washing 3 times with PBST, add 100 ul of TMB substrate solution and let stand at room temperature for 10-30 minutes. Finally, add 50 ul of 2M sulfuric acid to stop the color development reaction. On the ELX800 microplate reader, detect the absorbance OD value at 450 nm wavelength, which is greater than 2.1 times the negative value, which is positive.

[0034] BLI experiment: BLI method was used to detect the dynamic binding and dissociation between antigen and antibody. Briefly, prepare 20 ug / ml antibody diluent (with PBS buffer system) in advance, and dilute the antigen protein with a 2-fold gradient at a maximum concentration of 800 nM. Add PBS buffer, antibody diluent, buffer, and gradient-diluted antigen protein to the detection blackboard, respectively. Turn on the ForteBio Octet machine 30 minutes in advance and preheat it, and activate the anti-hlgG-Fc capture (AHC) biosensor for detection in advance with the balance buffer for 10 minutes, set the detection program and cycle, and place the prepared detection blackboard and biosensor into the detection machine for analysis. A program includes: running the baseline in the buffer system, the fixed molecule reversibly or irreversibly binding to the sensor surface, in the binding stage, the analyte binds to the sensor surface, in the dissociation stage, the analyte leaves the sensor surface, and finally the analyte or ligand on the sensor surface is removed. After running a program, use OCTET software data analysis HT 9.0 (FORTÉBIO) to determine the binding affinity constant. In order to determine the binding affinity of V3 peptide to JT18, 447-52D and J038 antibodies, SHIV 1157ipd3N4 V3 peptide ( 305 KSISIGPGQAI 317 ) was synthesized, and its binding to the antibody was determined as described above.

[0035] Example 6: Antibody function evaluation - neutralization experiment

[0036] HEK293T cells were grown in T-75 flasks to more than 90%, trypsinized (with 0.25% EDTA) and counted. 3-5 x 10 6 cells were taken to a T-75 cell flask, 12 ml of medium, 37°C incubated overnight (20-24 h), and when the cells grew to 50-80% they could be used for transfection. 16 μg of the backbone gene plasmid pSG3-Δenv and 8 μg of the envelope plasmid were added to 1.5 ml of transfection Buffer. After vortexing, 48 μl of transfection reagent jetPRIME (Polyplus) was added at a ratio of 1:2, and incubated at room temperature for 10 min. Slowly added to the T-75 cell flask, 37°C incubated for 48-72 h. The virus supernatant was collected, 0.45 μm microporous filter was used to filter out cell debris, 1 ml per bottle was divided, and the virus name and date were labeled and stored at -80°C. In order to determine the titer of the virus, the virus to be tested was taken out from -80°C and quickly thawed in a water bath. 100 μl of fresh DMEM medium was added to a 96-well plate, 25 μl of the original virus was added to each well in the first column, and four replicates were set up. 25 μl was taken to the next well, diluted by 1:5 to the 11th column, and 25 μl / well was discarded after mixing well in the 11th column. The 12th column was used as a cell control. Then the TZM-bl cells were trypsinized and passaged, resuspended and prepared into 1 x 10 5 cells / ml cell suspension, and the infection-promoting reagent DEAE was diluted 1:500 (storage concentration 15 mg / ml) and added to the cell dilution. According to the cell volume of 100 μl / well, it was added to the 96-well plate, and incubated at 37°C for 48-72 h. 100 μl of medium was aspirated from the 96-well plate, 100 μl of firefly luciferase substrate (Promega) was added, and it was reacted at room temperature for 2 min in the dark. The gun was repeatedly blown and sucked 5-10 times, 150 μl was aspirated into an opaque black / white plate, and the enzyme label was detected by a microplate reader to calculate the virus titer TCID 50 .

[0037] Take a 96-well plate, add DMEM complete medium 150 μl / well to the first column (cell control CC), add DMEM complete medium 100 μl / well to columns 2-12 (the second column is the virus control VV, and columns 3-12 are sample wells), and add the purified antibody to be tested to the sample wells in gradient dilution with two replicates. Dilute the pseudovirus to 2000 TCID 50 / ml (diluted according to the dilution factor provided) in each well of columns 2-12, so that each well contains 100 TCID 50Pseudovirus. Incubate the 96-well plate in a cell culture incubator (37°C, 5% CO2) for 1 hour. When the incubation time is half an hour, remove the previously prepared TZM-bl cells from the cell culture incubator, for example, a T-75 culture flask, aspirate the culture medium in the flask and add trypsin to immerse the cells for digestion, mix well by blowing, count the cells, and dilute the cells to 10 5 cells / ml with DMEM complete medium. Add 100 μl of 105 cells / ml to each well of the 96-well plate. Place the 96-well plate in a cell culture incubator at 37°C, 5% CO2 for 48 hours. After 48 hours, remove the 96-well plate from the cell culture incubator, use a multichannel pipette to aspirate 200 μl of supernatant from each well, and then add 40 μl of luciferase substrate (Promega) to each well. React for 2 min at room temperature in the dark. After the reaction is complete, use a multichannel pipette to repeatedly aspirate and dispense 3-5 times to fully lyse the cells, and then aspirate 50 μl of liquid from each well and add it to the corresponding 96-well chemiluminescence detection plate. Determine the inhibition of viral replication by measuring the relative light units (RLU) on a VICTOR2™ D luminometer (PerkinElmer). The 50% inhibitory concentration (IC 50 ) is defined as the antibody concentration at which the RLU is reduced by 50% compared to the average RLU of the virus control.

[0038] Commercial antibodies used in the experiment:

[0039] Goat anti-Monkey Ig (H+L) Secondary Antibody (Novus, Cat# NB7212)

[0040] HRP-conjugated rabbit anti-monkey IgG (Bioss, Cat# bs-0335R-HRP)

[0041] HRP-Goat Anti-Human IgG, Fcγ Secondary Antibody (Jackson ImmunoResearch, Cat# 109-035-008)

[0042] LIVE / DEAD® Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation (Life, Cat# L-34965)

[0043] PE-CF594 Mouse Anti-Human CD16 (BD, Cat# 562293)

[0044] PE-Cy™7 Mouse Anti-Human CD14 (BD, Cat# 561385)

[0045] PerCP-Cy™5.5 Mouse Anti-Human CD3 (BD, Cat# 552852)

[0046] BB515 Mouse Anti-Human CD20 (BD, Cat# 564568)

[0047] Goat Anti-Human IgD-PE (Southern Biotech, Cat# 2030-09)

[0048] APC / Cy7 anti-human CD27 Antibody (Biolegend, Cat# 302816)

[0049] PE-CF594-anti-Human IgM (BD, Cat# 562539)

[0050] Instruments used in the experiment:

[0051]

Claims

1. A neutralizing antibody targeting Env V3 epitope isolated from SHIV-challenged rhesus macaques, characterized in that, The amino acid sequence of the heavy chain of the antibody is SEQ ID NO: 3, and the amino acid sequence of the light chain is SEQ ID NO:

4.

2. A gene encoding the neutralizing antibody of claim 1, characterized in that, The nucleic acid sequence encoding the heavy chain of the antibody is SEQ ID NO: 1, and the nucleic acid sequence encoding the light chain of the antibody is SEQ ID NO:

2.

3. The use of a neutralizing antibody according to claim 1, characterized in that Preparation of a drug for treating AIDS caused by HIV-1 infection.

Images