Use of the circular non-coding RNA circKCNK2 as a marker for predicting bone metastasis of renal cancer or evaluating prognosis of renal cancer

By using the circular non-coding RNA circKCNK2 as a biomarker, the diagnostic challenges of predicting and prognosing bone metastasis in renal cell carcinoma have been addressed, enabling early detection and effective treatment, and improving the survival time and quality of life for renal cell carcinoma patients.

CN118086506BActive Publication Date: 2026-02-06RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410375929.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-29
Publication Date
2026-02-06
Estimated Expiration
2044-03-29

AI Technical Summary

Technical Problem

There is a lack of effective biomarkers in the current technology for the diagnosis and prognosis of patients with renal cell carcinoma, especially for the prediction and evaluation of bone metastasis.

Method used

Using the circular non-coding RNA circKCNK2 as a biomarker, we can predict bone metastasis and evaluate the prognosis of renal cell carcinoma by detecting its expression level. We provide a specific high-expression sequence and corresponding detection primers for preparing a kit for detection.

Benefits of technology

Early detection of renal cell carcinoma patients with high expression of circKCNK2 can improve treatment outcomes, prolong survival time, and enhance patients' quality of life through surgery, radiotherapy, targeted therapy, and other methods, while reducing the risk of bone metastasis-related pain and pathological fractures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118086506B_ABST
    Figure CN118086506B_ABST
Patent Text Reader

Abstract

The application provides the use of a circular non-coding RNA circKCNK2 as a biomarker for predicting bone metastasis of kidney cancer or evaluating the prognosis of kidney cancer. The application also provides a kit for predicting the progression of bone metastasis of renal cell carcinoma or evaluating the prognosis of kidney cancer, which contains primers for detecting the circular non-coding RNA circKCNK2 and detecting the internal reference beta-actin, the upstream primer sequence for detecting the circKCNK2 is shown as SEQ ID NO. 7, the downstream primer sequence for detecting the circKCNK2 is shown as SEQ ID NO. 8, the upstream primer sequence for detecting the beta-actin is shown as SEQ ID NO. 9, and the downstream primer sequence for detecting the beta-actin is shown as SEQ ID NO. 10. The application can understand the bone metastasis event and long-term prognosis of a patient by detecting the expression level of circKCNK2 in the kidney cancer tissue of the patient. It is found in the kidney cancer population that the patients with high expression of circKCNK2 are more likely to have bone metastasis-related PFS events than the patients with low expression of circKCNK2, and the survival is poor.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering, and relates to a biomarker, in particular, the use of circular non-coding RNA circKCNK2 as a marker for predicting bone metastasis of renal cancer or evaluating prognosis of renal cancer. BACKGROUND

[0002] Renal cell carcinoma (RCC), also known as kidney cancer, is one of the common malignant tumors of the urinary system. About 30% of patients with kidney cancer are found to have metastasis at the initial diagnosis, which is called metastatic RCC (mRCC). The mRCC has high malignancy, rapid progression and poor prognosis. The most common metastatic organs are lung, bone, adrenal gland, etc. Among them, bone metastasis accounts for 20-30% of all kidney cancer metastatic organs, ranking second, and most of them are in the form of osteolytic bone destruction. Once kidney cancer patients develop bone metastasis, they may show clinical symptoms such as pain, swelling, spinal cord compression, pathological fracture, hypercalcemia, etc., which are difficult to cure and have poor prognosis. Bone metastasis of tumors can be divided into osteogenic and osteolytic. Osteogenic bone metastasis is closely related to the bone formation function of osteoblasts. Tumor cells produce FGF, BMP and PDFG, etc. to induce osteoblasts to synthesize, which is the main way of prostate cancer bone metastasis. Osteolytic bone metastasis, as the main way of kidney cancer bone metastasis, has poor prognosis. The median survival time after bone metastasis is only 12-28 months. It is mainly manifested as the destruction of normal bone structure, accompanied by bone pain, pathological fracture and compression symptoms, which greatly reduces the quality of life of patients. The process of osteolytic bone metastasis is closely related to the bone resorption process of osteoclasts.

[0003] Studies have shown that circular non-coding RNA (circRNA) plays an important role in regulating the invasion and metastasis of renal cancer. The production of circRNAs is regulated by multiple factors, and the main circularization mechanisms include: 1. Trans-splicing factors such as SR proteins (proteins containing long repeating serine and arginine amino acid residues) catalyze the connection of the 5' donor site downstream of the exon to the 3' donor site, back-splice to form a loop, and cut; 2. The presence of cis-acting elements in circRNA itself, such as repeat elements (such as Alu elements), form reverse complementary sequences on both sides of the circular RNA exon, arrange into a duplex at the splice site, and then form two types of circRNAs with introns and without introns through variable splicing; 3. A series of special RNA binding proteins, including ADAR1, ADAR2 and QKI, can bind to specific motifs in the flanking intron to bring the downstream splice donor site (Splice-donor site, SD) close to the upstream splice acceptor site (Splice-acceptor site, SA) and promote the formation of circRNA.

[0004] CircRNA has a closed loop structure and is not affected by RNA exonuclease, so it is more stable in expression and plays a more important regulatory role in tumors. Nature magazine revealed some years ago that circRNA can affect the expression of genes, such as acting as a molecular "sponge" to relieve the inhibition of miRNA on target genes, binding to functional proteins to participate in the regulation of transcription and translation processes. RNA binding protein (RNA binding protein, RBP) is an important class of proteins in cells, which interact with RNA by recognizing specific RNA binding domains, and are widely involved in RNA splicing, transport, sequence editing and translation control and other post-transcriptional regulation. By designing a biotin-labeled circRNA linker sequence complementary probe, the circRNA is pulled down, and the endogenous proteins bound to it are also pulled down, and the target proteins with high protein enrichment are investigated.

[0005] Abnormal expression of circular non-coding RNA (circRNAs) has become a hot molecule in human cancer research, and many circRNAs are involved in tumor angiogenesis, invasion and metastasis. However, in the field of renal cancer, there is no research report on bone metastasis-related circRNAs at home and abroad. The applicant has obtained preliminary results from the circRNA-related basic experiments, which have shown good prediction performance. This renal cancer-specific circRNA may become a prediction target for bone metastasis and even tumor progression, and ultimately bring treatment opportunities for clinical patients. SUMMARY

[0006] In view of the above technical problems in the prior art, the application provides the use of a circular non-coding RNA circKCNK2 as a marker for predicting renal cancer bone metastasis or evaluating the prognosis of renal cancer, which solves the problem of lack of effective markers for diagnosing and evaluating the prognosis of renal cancer patients in the prior art.

[0007] The application provides the use of a circular non-coding RNA circKCNK2 as a biomarker for predicting renal cancer bone metastasis or evaluating the prognosis of renal cancer, and the sequence of the circular non-coding RNA circKCNK2 is shown as SEQ ID NO. 1.

[0008] Further, patients with high expression of the circular non-coding RNA circKCNK2 are more likely to have bone metastasis-related PFS events (PFS represents the time for maintaining stable condition, and the longer the time, the greater the benefit) than patients with low expression of the circular non-coding RNA circKCNK2, wherein the patient with high expression of the circular non-coding RNA circKCNK2 refers to that △△Ct is less than 7.36, and the patient with low expression of the circular non-coding RNA circKCNK2 refers to that △△Ct is greater than 7.36.

[0009] The application provides the use of a circular non-coding RNA circKCNK2 as a biomarker for predicting renal cancer bone metastasis or evaluating the prognosis of renal cancer in the preparation of a kit for predicting the progression of renal cell carcinoma bone metastasis or evaluating the prognosis of renal cancer, and the sequence of the circular non-coding RNA circKCNK2 is shown as SEQ ID NO. 1.

[0010] The application also provides a kit for predicting the progression of renal cell carcinoma bone metastasis or evaluating the prognosis of renal cancer, which contains primers for detecting a circular non-coding RNA circKCNK2 and an internal reference, and the sequence of the upstream primer for detecting the circular non-coding RNA circKCNK2 is shown as SEQ ID NO. 7, and the sequence of the downstream primer for detecting the circular non-coding RNA circKCNK2 is shown as SEQ ID NO. 8.

[0011] The kit also contains an internal reference, and the internal reference is β-actin, the sequence of the upstream primer for detecting the β-actin is shown as SEQ ID NO. 9, and the sequence of the downstream primer for detecting the β-actin is shown as SEQ ID NO. 10.

[0012] Further, in the kit, the circular non-coding RNA circKCNK2 is used as a biomarker for predicting renal cancer bone metastasis or evaluating the prognosis of renal cancer, and the sequence of the circular non-coding RNA circKCNK2 is shown as SEQ ID NO. 1.

[0013] Compared with the prior art, the technical effect of the present application is positive and obvious. The present application can understand the bone metastasis event and long-term prognosis of the patient by detecting the expression level of circKCNK2 in the renal cancer tissue of the patient. It is found in the present application that the patients with high expression of circKCNK2 (△△Ct less than 7.36) are more likely to have bone metastasis related PFS events and have shorter survival time than patients with low expression of circKCNK2. To some extent, the renal cancer patients with high expression of circKCNK2 can be found as early as possible, and the treatment such as surgery, radiotherapy and targeted therapy can be performed in advance, so that the survival time can be improved. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 It is shown that circKCNK2 is a newly found circRNA specifically highly expressed in renal cancer tumor tissue. Among them, a: circRNA array detects the high expression of circRNA in renal cancer bone metastasis samples; b-f: transwell invasion and migration experiments after transfection of si-circKCNK2 / si-NC or oe-circKCNK2 / vector in 786-O and CAKI-1 cells, respectively; g-j: in vivo level detection of the progression level of sh-circKCNK2 / sh-NC renal cancer mice inoculated in situ, and the body weight change is recorded, and the tumor sample is identified by HE staining.

[0015] Figure 2 It is shown that the expression of circKCNK2 is closely related to the progression of renal cancer bone metastasis. Among them, a-b: inoculate renal cancer cells (sh-circKCNK2 / sh-NC) in the tibia of mice; c: micro-CT parameter detection of the effect of sh-circKCNK2 / sh-NC renal cancer on bone quality; d-g: determine the bone destruction effect of circKCNK2 according to the pathological detection (HE & TRAP staining) of bone metastasis samples.

[0016] Figure 3 It is shown that circKCNK2 is positively correlated with bone metastasis related factor IL-11. Among them, a: qRT-PCR detects the cytokines whose expression is significantly changed after overexpression of circKCNK2 and knockdown of circKCNK2; b: design ELISA experiment to detect the correlation between IL-11 expression and circKCNK2; c: WB experiment to determine the correlation between IL-11 expression and circKCNK2.

[0017] Figure 4 It is shown that circKCNK2 can cause renal cancer bone metastasis progression by regulating IL-11 expression. Among them, a: CT shows the bone destruction of different experimental groups; b-c: micro-CT shows the specific parameter performance level of bone destruction of different experimental groups.

[0018] Figure 5 The correlation of circKCNK2 level with clinical events is shown, a-b: ISH experiment comparing the transcription level of circKCNK2 in different kidney metastases; c: detecting the expression level of circKCNK2 in renal cancer patients by qRT-PCR; Kaplan-Meier analysis and comparison of progression-free survival of patients with high and low expression levels of circKCNK2 in renal cancer. DETAILED DESCRIPTION

[0019] Example 1 Increased expression of circKCNK2 is associated with progression and bone metastasis of RCC

[0020] In order to find the circRNAs involved in the progression of bone metastasis of renal cancer, we used the differential expression analysis of Arraystar Human Circular RNA Microarray to compare the differentially expressed circRNAs in renal cancer primary tumors and bone metastasis samples.

[0021] By setting the search conditions: absolute value of Log2FC > 2, and P < 0.01, the top 3 circRNAs were further screened, which were circKCNK2 (SEQ ID NO. 1), circFANCA (SEQ ID NO. 2) and circPLCL2 (see SEQ ID NO. 3).

[0022] The migration and invasion function experiments were performed on human renal cancer cells 786-O and Caki-1 cells using target circKCNK2 siRNA (see SEQ ID NO. 4), circFANCA siRNA (see SEQ ID NO. 5) and circPLCL2 siRNA (see SEQ ID NO. 6).

[0023] circKCNK2 siRNA (see SEQ ID NO. 4): uacaaccauaguggcggcaugccgccacuaugguugua.

[0024] circFANCA siRNA (see SEQ ID NO. 5): caucugaccucaaaugauccuaggaucauuugaggucagaug. circPLCL2 siRNA (see SEQ ID NO. 6): uugagcuagggcccuugcucaugagcaagggcccuagcucaa.

[0025] (t is u in the sequence table).

[0026] According to the promotion of the invasion and migration ability of kidney cancer exhibited by circKCNK2, an overexpression plasmid is further designed and transfected into kidney cancer cells, and it is further verified in the migration and invasion experiments that the overexpression of circKCNK2 can promote migration and invasion.

[0027] The overexpression circKCNK2 or control 786-O cells expressing luciferase are inoculated into nude mice in the form of orthotopic xenotransplantation, and the tumor progression is observed at the designated time points (2 weeks, 4 weeks and 6 weeks) using bioluminescence imaging, and the body weight and tumor volume of the mice are measured. Correspondingly, the Kaplan-Meier survival curves of the overexpression circkcnk2 group and the control group mice are plotted. In the RNA in situ hybridization experiment, it is found that the expression of circKCNK2 is increased in bone metastasis compared with metastasis in other parts, and the quantification results are given. The RNA sample extracted from the human kidney cancer tumor tissue sample is subjected to qRT-PCR to detect the circKCNK2 level, and the Kaplan-Meier survival analysis is performed, which is divided into a circKCNK2 low expression group and a circKCNK2 high expression group, and the analysis shows that the high expression of circKCNK2 is significantly related to poor prognosis.

[0028] In vitro cell migration and invasion experiment (Transwell assay)

[0029] 1) Coating basement membrane: 20 μl of Matrigel gel diluted 1:8 with 50 mg / L Matrigel gel is uniformly coated on the upper chamber surface of the Transwell chamber bottom membrane, and the gel is incubated at 37°C for 30 minutes to solidify (no need for this step for detecting invasion ability).

[0030] 2) Preparation of cell suspension: Before preparing the cell suspension, the cells can be starved for 24 h to further remove the influence of serum; the cells are digested, and after stopping the digestion, the culture solution is centrifuged and discarded, and the cells are mixed with serum-free medium after being washed with PBS for 2 times, and the cell density is counted by a cell technology instrument.

[0031] 3) Cell inoculation: 200 ul of cell suspension is added to each well of the chamber (8 μm pore size), and the number of cells is 1×10 5 4) After incubation at 37°C for 24 hours, the chamber is removed to remove the supernatant.

[0032] 5) The matrix gel and cells in the upper chamber are wiped off with a cotton swab, and the chamber is placed in 4% paraformaldehyde for fixation for 30 min and then washed with PBS.

[0033] 5) The matrix gel and cells in the upper chamber are wiped off with a cotton swab, and the chamber is placed in 4% paraformaldehyde for fixation for 30 min and then washed with PBS.

[0034] 6) Crystal violet staining: immerse the chamber in a solution containing 0.1% crystal violet for 15-30 minutes. Remove the chamber and immerse in PBS for 3 times, and use a cotton swab to wipe off the inside of the cells that have not migrated.

[0035] 7) Counting: Count the number of cells stained with crystal violet under a microscope, and take 5 high-power fields, and take a photo.

[0036] We found that: the differential analysis of 3 circRNAs highly expressed in renal cancer bone metastases( Figure 1 a), only knockdown of circKCNK2 can inhibit the invasion and metastasis phenotype of renal cancer in the Transwell experiment( Figure 1 b-c), while overexpression of circKCNK2 in renal cancer cells can promote the invasion and metastasis phenotype of renal cancer( Figure 1 e-f). In the in vivo model, overexpression of circKCNK2 significantly promotes the progression of renal cancer cells, tumor weight and volume (such as Figure 1 g-i). *P<0.05.

[0037] Example 2 CircKCNK2 promotes the progression of renal cancer bone metastasis

[0038] In this part, using lentivirus infection technology to construct circKCNK2 knockdown expression and control group of renal cancer cell line 786-O (sh-circKCNK2 / sh-NC 786-O) for mouse kidney orthotopic inoculation, and through CT and micro-CT, the changes of bone structure are analyzed in depth, and the changes of BV / TV, Tb.Th, BS / BV and Tb.Sp in sh-NC and sh-circKCNK2 groups of mice tibia are identified. Representative HE staining of sh-NC and sh-circKCNK2 groups for tumor size analysis (scale = 50 μm). Representative TRAP staining of sh-NC and sh-circKCNK2 groups for measuring relative osteolytic lesion area of sh-NC and sh-circKCNK2 groups (scale = 50 μm).

[0039] 1) Choose the paraffin section that needs to be dyed under the microscope, pay attention to the group of sections that need to be dyed should be in the same section. Then put the selected section on the 62℃ section drying machine for 1 hour or so to prevent the tissue from falling off during the subsequent dyeing process.

[0040] 2) After the section is baked, clamp the section on the spring for tissue gradient rehydration.

[0041] 3) Soak the rehydrated section in 4% paraformaldehyde solution for 10 minutes. Then put it into 1xPBS for 2 minutes, repeat soaking for 3 times.

[0042] 4) Put the slices into the PBS-Triton-X-100 solution for 6 minutes. Then put them into the PBS-Tween-20 solution for 2 minutes, repeat 3 times.

[0043] 5) After drawing an oil circle around the tissue of the slice with a histological pen, carefully add the TRAP staining solution prepared in the last step to the tissue with a pipette, and the volume can be immersed in the tissue. After adding the staining solution to all the slices and placing them in the wet box, carefully transfer them to the 37℃ oven for 1 hour. After staining, soak the slices in ultrapure water for 2 minutes to terminate the staining, repeat 3 times. Then soak the slices in methyl green staining solution for methyl green counterstaining, and stain for 1 minute.

[0044] 6) After counterstaining, soak the slices in 1xPBS to remove the floating color. Note that the soaking time in this step should be short (about 1 second), otherwise the tissue color will become yellowish. Then dry the slices (for about 5 minutes) and use neutral resin for mounting. The drying time of the slices should not be too short, otherwise there will be water droplets when mounting, affecting subsequent photography.

[0045] 7) Take photos under a microscope (Leica, DM4000b), and use Osteo Measure Analysis System software (Osteometrics, Atlanta, GA, USA) for statistical analysis of TRAP staining results

[0046] We found that: using the 786-O cell line, after knocking down circKCNK2, CT scan showed that the degree of damage to the mouse tibia, i.e. the degree of progression of bone metastasis foci was significantly reduced Figure 2 a-b). Correspondingly, the micro-CT evaluation parameters BV / TV, Tb.Th, BS / BV, Tb.Sp all reflect the inhibition of the knockdown of circKCNK2 on renal cancer bone metastasis Figure 2 c). Collect bone tissue samples from each group of mice, and receive pathological staining, HE staining reveals that the degree of renal cancer damage to bone quality is reduced after knocking down circKCNK2 Figure 2 d and Figure 2 e), and inhibited the relative activity of osteoclasts in bone marrow Figure 2 f and Figure 2 g). The above results show that the present application successfully verifies that circKCNK2 at a high level significantly promotes the progression of renal cancer bone metastasis. *P<0.05.

[0047] Example 3 circKCNK2 level is positively correlated with bone metastasis related factor IL-11

[0048] qRT-PCR analysis was performed to detect the involved cytokines in 786-O cells with silenced or overexpressed circKCNK2. Among them, IL-11 was determined as a candidate gene positively correlated with the expression of circKCNK2. Further, ELISA analysis of IL-11 secretion regulated by si-circKCNK2 or overexpression of circKCNK2 in 786-O and Caki-1 cells was performed. At the same time, the osteolytic markers in RAW264.7 cells were evaluated by western blot after collecting the si-circKCNK2 cell conditioned medium co-cultured with RAW264.7 cells.

[0049] 1) ELISA to identify the difference in IL-11 protein extracellular secretion level between different groups: identified by ELISA kit. The human IL-11 concentration in the cell culture medium was quantitatively evaluated three times by IL-11 enzyme-linked immunosorbent assay kit (R&D Systems). Appropriate amount of medium was added, IL-11 antibody was added, and incubated at room temperature for 1 hour. After six PBST washes, TMB developing solution was coated on the plate for 15 minutes. Then, 100 μL of stop solution was added to stop the reaction. Then the optical density at wavelengths of 450 nm and 570 nm was measured.

[0050] 2) Western blot to identify the difference in IL-11 protein total expression between different groups: identified by Western blot kit using IL-11 antibody.

[0051] We found that: after overexpression and knockdown of circKCNK2 in 786-O, qRT-PCR results showed that the mRNA of the cell factor that appeared a significant positive correlation change was IL-11 Figure 3 a). IL-11 was verified as a candidate cytokine positively correlated with circKCNK2, and the secretion level in the overexpression / silencing circKCNK2 group was verified in the ELISA experiment, proving the correlation between IL-11 and circKCNK2 at the protein level Figure 3 b). The total protein of the control group and the circKCNK2 silenced group was extracted, and Western blot was performed to detect that the expression of IL-11 was obviously down-regulated after silencing circKCNK2 Figure 3 c). The above results show that the present application successfully verifies that the level of circKCNK2 is positively correlated with the bone metastasis related factor IL-11. *P<0.05.

[0052] Example 4 neutralizes IL-11 can significantly alleviate the bone resorption of rcc bone metastasis with high expression of circKCNK2, and reduce the tumor burden

[0053] Representative images of mouse tibia CT (a) and micro-CT (b). Control and circkcnk2-overexpressing 786-O cells inoculated mice (6 in each group) were treated with IgG, IL-11 neutralizing antibody (anti-IL-11) and denosumab, respectively. (c) Quantitative analysis of bone parameters measured by micro-ct (expressed as BV / TV, Tb.Th, BS / BV and Tb.Sp).

[0054] Micro-CT scanning of mouse bone and statistical analysis: The mouse bone was scanned using an in vivo X-ray tomography instrument (Skyscan 1272, Bruker). The scanning voltage was 60 kV, the filter was 0.25 μm aluminum filter, and the scanning resolution was 9 μm. After the mouse bone scanning was completed, the image reconstruction was performed using Skyscan Recon software (Bruker), and the sample two-dimensional structure was further analyzed using DataViewer software (Bruker), and the sample three-dimensional structure was analyzed using CTVox software (Bruker). The bone damage area was analyzed using Image J software.

[0055] We found that: in the bone metastasis model of renal cancer inoculated in situ in the tibia, CT scanning showed that overexpression of tumor cell circKCNK2 could cause bone metastasis progression by up-regulating IL-11 expression, and the use of IL-11 neutralizing antibody could significantly inhibit tumor growth, and the effect was significantly better than that of denosumab ( Figure 4 a). Similarly, in the quantitative analysis of bone parameters (BV / TV, Tb.Th, BS / BV and Tb.Sp) by Micro-CT scanning, it was revealed that the use of denosumab could significantly inhibit the progression of bone metastasis caused by overexpression of circKCNK2 ( Figure 4 b-c). The data were analyzed by STATA 12.0 and SPSS 23.0, and there was a statistically significant difference when the two-sided P<0.05.

[0056] Example 5 Distribution level of circKCNK2 in patients at different clinical stages and its relationship with prognosis

[0057] In order to further explore the relationship between the expression of circKCNK2 and the clinical and pathological features of renal cancer patients, we analyzed the expression of circKCNK2 in 67 cases of renal cancer tissues.

[0058] In situ hybridization technology detected the RNA expression level of circKCNK2 in lymph node metastasis, lung metastasis, liver metastasis and bone metastasis samples of renal cancer.

[0059] qRT-PCR technique further established and distinguished the high expression and low expression of circKCNK2 in renal cancer tissues of patients with different clinical outcomes and clinicopathological characteristics.

[0060] Detection process:

[0061] Trizol reagent extracted total RNA from frozen tissue specimens, and RNA was reverse transcribed into cDNA using a reverse transcription kit. Finally, qRT-PCR was performed on a 7900HT Fast Real-Time PCR instrument, and β-actin was used as an internal reference. Finally, the 2-ΔΔCt algorithm was used to analyze the difference of circKCNK2 between the two groups. The primer sequences used are as follows:

[0062] circKCNK2:

[0063] forward: 5' ccgttaggaaacacctccaa 3'; as shown in SEQ ID NO. 7.

[0064] reverse: 5' ggcagattaggatccagca 3'; as shown in SEQ ID NO. 8.

[0065] β-actin:

[0066] forward: 5' gggacctgactgactacctc 3'; as shown in SEQ ID NO. 8.

[0067] reverse: 5' tcatactcctgcttgctgat 3'; as shown in SEQ ID NO. 10.

[0068] The reaction system is as follows: SYBR Premix Ex Taq 10ul; upstream primer 0.8ul; downstream primer 0.8ul; cDNA template 2ul; ROX Reference Dye II 0.4ul; RNase free water 6ul.

[0069] The following reactions were performed in an ABI 7900 real-time fluorescent quantitative PCR instrument:

[0070] First step: 95℃ for 30 seconds pre-denaturation;

[0071] Second step: PCR reaction, a total of 40 cycles, each cycle by 95℃ for 5 seconds denaturation, 60℃ for 34 seconds extension.

[0072] qRT-PCR results showed that the expression of circKCNK2 in kidney cancer tissues was increased and was associated with lower progression-free survival. The complete sequence of circKCNK2 has a transcription length of 429 bp (see SEQ ID NO. 1).

[0073] Fluorescence in situ hybridization (FISH):

[0074] 1) Fix and dehydrate the kidney tumor tissue sample;

[0075] 2) Add circKCNK2 probe to the hybridization buffer, and perform in situ hybridization using an in situ hybridization kit.

[0076] 3) After staining the nucleus with DAPI, observe under a fluorescence microscope.

[0077] As shown in Figure 5 , in situ hybridization preliminarily showed that circKCNK2 was specifically highly expressed in bone metastases Figure 5 (a), and the staining quantitative results also suggested that the expression of circKCNK2 in bone metastases was significantly higher than that in lymph node, lung, and liver metastases Figure 5 (b). According to the qRT-PCR results, the level of circKCNK2 was obtained, and was further sorted, and the median of the whole data was selected as the dividing point of the high circKCNK2 group (△△Ct less than 7.36) and the low circKCNK2 group (△△Ct greater than 7.36). Kaplan-Meier survival analysis showed that the survival time of patients with high expression of circKCNK2 was shorter than that of patients with low expression of circKCNK2, and the prognosis was poor Figure 5 (c).

[0078] Specifically, △△Ct is a simplified form of the fluorescence quantitative calculation formula, which is used to compare the differences or change ratios between different samples.

Claims

1. Use of a reagent for detecting circular non-coding RNA circKCNK2 in the preparation of a kit for predicting the progression of renal cell carcinoma bone metastasis or evaluating the prognosis of renal cell carcinoma, wherein the sequence of the circular non-coding RNA circKCNK2 is shown as SEQ ID NO. 1, and patients with high expression of the circular non-coding RNA circKCNK2 are more likely to have bone metastasis-related PFS events than patients with low expression of circKCNK2.

2. Use according to claim 1, characterized in that: The patient with high expression of the circular non-coding RNA circKCNK2 refers to △△Ct less than 7.36, and the patient with low expression of the circular non-coding RNA circKCNK2 refers to △△Ct greater than 7.

36.

3. Use according to claim 1, characterized in that: In the kit, the upstream primer sequence for detecting circKCNK2 is shown as SEQ ID NO. 7, and the downstream primer sequence for detecting circKCNK2 is shown as SEQ ID NO.

8.

4. Use according to claim 1, characterized in that: In the kit, the kit further contains a reference, and the reference is β-actin, the upstream primer sequence for detecting β-actin is shown as SEQ ID NO. 9, and the downstream primer sequence for detecting β-actin is shown as SEQ ID NO. 10.