Soybean alkali-tolerant gene GmFPS1 and application thereof
By cloning the soybean farnesyl pyrophosphate synthase gene GmFPS1 and its promoter, transgenic crops were constructed, solving the problem of the long time required for identifying soybean alkali tolerance and enabling the rapid breeding and improved growth performance of alkali-tolerant soybean varieties.
Patent Information
- Application Number
- CN202211695747.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-28
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2042-12-28
AI Technical Summary
Existing technologies make it difficult to quickly identify alkali-tolerant genes in soybeans, and breeding alkali-tolerant soybean varieties is time-consuming and costly, making it difficult to meet the growing demand for food.
By cloning the soybean farnesyl pyrophosphate synthase gene GmFPS1 and its promoter, transgenic crops were constructed. Gene function was verified using a root chimera system and Arabidopsis thaliana model plants to improve the tolerance of soybean to alkaline stress.
This study improved the tolerance of soybeans to alkali stress, obtained new alkali-tolerant transgenic plant varieties through genetic engineering, and enhanced the growth performance of soybeans in saline-alkali land.
Smart Images

Figure CN118256527B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering and relates to the soybean alkali-tolerant gene GmFPS1 and its applications. Background Technology
[0002] Soybean [Glycine max (L.) Merr.] is a major source of plant protein and edible vegetable oil. However, due to population growth and increasing consumer demand, my country's soybean production falls far short of meeting the growing demand. Currently, land resources, especially arable land, are becoming increasingly scarce. The national and local governments have planned and implemented numerous saline-alkali land remediation projects, significantly improving the situation of saline-alkali land in my country. However, given the large area of saline-alkali land, the severe salinization, and the high cost of remediation, it is crucial to cultivate new salt-tolerant soybean varieties through molecular breeding.
[0003] A review of relevant literature reveals that yeast systems are increasingly being used for preliminary verification of gene function due to their shorter experimental cycle. Arabidopsis thaliana, a model plant with mature gene transformation technology, is frequently used in research related to plant stress and abiotic stress. Obtaining homozygous transgenic soybean lines is labor-intensive, time-consuming, and technically challenging, making it difficult to quickly identify alkali-tolerant soybean varieties. Studies have reported that the method of obtaining rooted chimeras by infecting soybean stems with Agrobacterium tumefaciens K599 has a near 100% infection efficiency, significantly improving experimental accuracy. Furthermore, the rooted chimera system requires less time, allowing for rapid preliminary identification of alkali-tolerant functions in soybean genes and offering high operability.
[0004] Farnesyl pyrophosphate synthase plays a role in the mevalonate metabolic pathway and is an important substance for the synthesis of isoprene-like substances such as chlorophyll, abscisic acid, sterols, and cytokinins. Previous literature has reported that transferring the peppermint FPS gene into tobacco can improve the transgenic tobacco's resistance to red spot disease; transferring the yeast FPS gene into tobacco can increase the content of carotenoids and sterols in transgenic tobacco. In 2010, Closa et al. found that knocking out a single FPS gene in Arabidopsis thaliana resulted in growth similar to the wild type without significant differences. However, simultaneously knocking out the two farnesyl pyrophosphate synthase genes, FPS1 and FPS2, in Arabidopsis thaliana had a significant impact on its growth and development, leading to lethality in the embryonic stage. However, the alkali tolerance function of the soybean FPS1 gene has not yet been reported. Summary of the Invention
[0005] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing the soybean alkali-tolerant gene GmFPS1 and its applications.
[0006] The objective of this invention can be achieved through the following technical solutions:
[0007] The soybean farnesyl pyrophosphate synthase gene GmFPS1, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0008] The protein encoded by the soybean farnesyl pyrophosphate synthase gene GmFPS1 has the amino acid sequence SEQ ID NO.2.
[0009] The promoter of the soybean farnesyl pyrophosphate synthase gene GmFPS1, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0010] An expression vector containing the soybean farnesyl pyrophosphate synthase gene GmFPS1.
[0011] The application of the soybean farnesyl pyrophosphate synthase gene GmFPS1 in the construction of alkali-tolerant transgenic crops.
[0012] The application of the promoter of the soybean farnesyl pyrophosphate synthase gene GmFPS1 in the construction of alkali-tolerant transgenic crops.
[0013] Beneficial effects:
[0014] The open reading frame (ORFPS1) of the plant alkali tolerance-related protein gene provided by this invention is 1029 bp in length and encodes a protein composed of 342 amino acids. The encoded protein contains an isoprene synthase domain that is highly homologous to other farnesyl pyrophosphate synthase proteins and is located in the peroxisome and vacuolar membrane.
[0015] This invention investigated the genetic transformation of the plant alkali tolerance-related protein-encoding gene GmFPS1 into transgenic Arabidopsis thaliana and Agrobacterium rhizogenes-mediated soybean chimeras and their tolerance to alkali stress. The resulting transgenic Arabidopsis thaliana and Agrobacterium rhizogenes-mediated soybean chimeras exhibited improved tolerance to alkali stress. qRT-PCR results also showed that the expression level of soybean GmFPS1 was significantly upregulated in response to alkali stress induction. Therefore, it is evident that transferring the plant alkali tolerance-related protein-encoding gene GmFPS1 into crops through genetic engineering can yield new transgenic plant varieties tolerant to alkali stress. Attached Figure Description
[0016] Figure 1 Schematic diagram of the cis-acting element in the GmFPS1 promoter region.
[0017] Figure 2 Subcellular localization of GmFPS1.
[0018] Figure 3 Relative expression of GmFPS1 in soybean roots and leaves in response to NaHCO3 stress.
[0019] Figure 4 GmFPS1 promoter activity assay. (A) GmFPS1 promoter activity in tobacco leaves was detected by transient expression of luciferase (LUC) 48 h after treatment with 0 or 100 mM NaHCO3. These images were taken using a live plant imaging system. Ba r = 3 cm. (B) Expression levels of the LUC reporter gene driven by the GmFPS1 promoter. Error bars represent the standard deviation of three biological replicates (each biological replicate includes two technical replicates). (n = 3 × 2 = 6). ** indicates a significant difference at the 0.01 level between GmFPS1 overexpressing plants and unexpressed plants in student's t-test.
[0020] Figure 5 Effects of GmFPS1 overexpression on the tolerance of G19 yeast strain to NaHCO3 stress
[0021] pYES2 represents empty yeast, and pYES2-GmFPS1 represents yeast overexpressing GmFPS1.
[0022] Figure 6 Phenotypic characteristics of different Arabidopsis thaliana strains
[0023] A: Phenotypic results of Arabidopsis thaliana lines treated with 0 mM and 3 mM NaHCO3. Seeds were grown vertically on 1 / 2 MS agar plates supplemented with 0 or 3 mM NaHCO3 for 14 days. Bar = 1.5 cm. B: Root length of Arabidopsis thaliana lines after treatment with 0 mM and 3 mM NaHCO3. Error bars represent the standard deviation of three biological replicates (each biological replicate includes 6 technical replicates). According to Duncan's multiple interval test, the same letter above the column indicates no significant difference at the 0.05 level under the same conditions according to Duncan's multiple comparison analysis.
[0024] Figure 7 Alkali tolerance analysis of transgenic soybean chimeric plants
[0025] A: GFP fluorescence signal of soybean chimeric plants. Scale bar = 1 cm. (B) Phenotype of transgenic soybean chimeric plants under different concentrations of NaHCO3 treatment. 35S:GFP and 35S:GmFPS1-GFP represent the phenotypes of transgenic rooting chimeric plants containing the empty pBinGFP4 vector and the pBinGFP4-35S:GmFPS1-GFP vector, respectively, after 5 days of NaHCO3 treatment; scale bar = 2 cm. (CF) Relative electrical conductivity (LREC) of leaves (C), relative water content (LRWC) of leaves (D), aboveground fresh weight (E), and SPAD value of chlorophyll content (F) of soybean composite plants after 5 days under 0 mM and 90 mM NaHCO3 conditions. Error bars represent the standard deviation of three biological replicates (each biological replicate includes 3 technical replicates). ** indicates a significant difference between GmFPS1 overexpressing plants and empty vector plants at the 0.01 level under student's t-test. Detailed Implementation
[0026] Example 1: Cloning and Identification of Soybean GmFPS1 and its Encoding Gene
[0027] The experimental material was soybean (Glycine max (L.) Merr.) local variety M8206, provided by the Germplasm Resources Research Laboratory of the National Soybean Improvement Center, Nanjing Agricultural University. In this study, five soybean farnesyl pyrophosphate synthase genes were identified from multiple soybean tissues through Arabidopsis thaliana homology comparison. The farnesyl pyrophosphate synthase gene that was predominantly expressed in all tissues was selected and named GmFPS1. Primers were designed to further clone the full-length cDNA sequence of the GmFPS1 gene. The specific method is as follows: Soybean root tips were taken, ground in liquid nitrogen, and total RNA was extracted using the RNAprep Pure Plant Kit (Tiangen Biotech, China). 5 μg of total RNA was reverse transcribed using the PrimeScript™ RT Master Mixkit (TaKaRa, Japan) according to the kit instructions. The resulting cDNA fragment was used as a template for PCR, and primers for amplifying the GmFP S1 open reading frame (F1: ATGGCAGATCTCAAGTCTACATTCTT) and R1: CTACTTCTGCCTTTTGTAAATTTTAGC were used. The 50 μl PCR reaction mixture consisted of: 2 μl cDNA (0.05 μg), 2 μl each of forward and reverse primers (10 μM), 5 μl 10× PCR buffer, 1 μl dNTP (10 mM), and 2 U Taq DNA polymerase, diluted to 50 μl with ultrapure water. The reaction was performed on a Bio-RAD PTC200 PCR instrument with the following program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 50 s, 58℃ annealing for 50 s, 72℃ extension for 1 min, for a total of 35 cycles; followed by a 72℃ extension for 10 min, and storage at 4℃. The PCR products were recovered, sequenced, and analyzed. The results showed that the open reading frame of this gene contains the nucleotide sequence of SEQ ID NO.1 in the sequence listing, with a full length of 1029 bp, encoding the 342 amino acids shown in SEQ ID NO.2.
[0028] Example 2: Prediction of Cis-Action Elements of the GmFPS1 Promoter
[0029] The soybean FPS gene (including a 2000 bp upstream promoter region) has the nucleotide sequence of SEQ ID NO.1 in the sequence listing. Cis-elements in the promoter region were predicted using the Plant CARE online database and software (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). Numerous cis-elements were found in the GmFPS1 promoter region, including abiotic stress response elements, light-response elements, and hormone-response elements. Figure 1Abiotic stress response elements include MYB elements, MYB elements, and MBS elements, which are MYB transcription factor recognition sites that respond to low temperature, salt, and drought stress.
[0030] Example 3: Subcellular localization of GmFPS1 protein
[0031] To determine the subcellular localization of the GmFPS1 protein, based on the GmFPS1 gene CDS sequence and the multiple cloning site information of the co-expression vector pBinGFP4, two restriction endonuclease sites, Kpn I and Sma I, were selected. Primers for cloning the GmFPS1 gene were designed using a one-step cloning method. Specifically, GmFPS1-GFP-F: 5'-atttacgaacgatagggtaccATGGCA GATCTCAAGTCTACATTCTT-3', and GmFPS1-GFP-R: 5'-catggatccgtcgaccccgggCTTCTGCCTTTT GTAAATTTTAGCC-3'. The GmFPS1 gene was then inserted into the expression vector pBinGFP4 via restriction endonuclease digestion and a one-step cloning kit (Vazyme, Nanjing, China). Subcellular co-localization was performed using fluorescent protein labeling of the peroxisome-labeled vector mCherry-PTS1 and the vacuolar membrane-labeled vector mCherry-PIP2A.
[0032] Tobacco seeds were sown on a substrate (nutrient soil:vermiculite = 1:1) and grown for 4-5 weeks at 25℃, 70% relative humidity, and a photoperiod of 14h / 10h. The pBinGFP4 vector, recombinant vector pBinGFP4-GmFPS1, and labeling vector were transformed into Agrobacterium EHA105 strain and then into tobacco epidermal cells. Fluorescence was detected using a laser scanning microscope (Zeiss LSM780 META, Germany) 2-3 days after Agrobacterium infection. The fluorescence signal of 35S:GmFPS1-GFP was essentially consistent with the fluorescence signals of the peroxisome-labeled mCherry-PTS1 and the vacuolar membrane-labeled vector mCherry-PIP2A. Therefore, we believe that GmFPS1 is mainly located on peroxisomes and vacuolar membranes. Figure 2 ).
[0033] Example 4: NaHCO3 stress treatment and GmFPS1 gene expression analysis
[0034] Uniform, healthy, alkali-tolerant soybean seeds (M8206) were selected, washed with 75% ethanol for 30 seconds, and then rinsed three times with ultrapure water. Soybean seeds were germinated in the soil at 28 / 24℃ with a photoperiod of 14 / 10h (light / dark). Fourteen days after germination, soybean seedlings were subjected to alkali (NaHCO3) stress. Soybean plants were randomly divided into a control group and a treatment group. The control group was cultured in 1 / 2 Hoagland nutrient solution containing 0 mM NaHCO3 (pH = 5.8), while the treatment group received 90 mM NaHCO3 (pH = 8.5). Three biological replications were performed, with six plants measured in each replicate. At 0h, 4h, 8h, 12h, 24h, and 48h after alkali (NaHCO3) treatment, newly unfolded leaves and 2cm root tips were collected from six soybean plants in each group, and RNA was extracted using the RNAprep Pure Plant Kit (Tiangen Biotech, China). cDNA was synthesized using the PrimeScript™ RT Master Mix kit (TaKaRa, Japan). Gene-specific primers were designed using Primer Premier 5 software (http: / / www.premierbiosoft.com / primerdesign / ) and synthesized at GenScript (Nanjing, China). The primers were: qRT-GmFPS1-F: 5'-CTCCGATGATGCTCGCCATT-3', qRT-GmFPS1-R: 5'-GCACTAGCAAGGAAAATTTCGTCA-3'. The soybean GmUKN1 gene was used as an internal control gene. The primers were: qRT-GmUKN1-F: 5'-TGGTGCTGCCGCTATTTACTG-3', qRT-GmUKN1-R: 5'-GGTGGAAGGAACTGCTAACAATC-3'. qRT-PCR was performed using the SYBR Premix ExTaq™ II Mix (TaKaRa, Japan) on a Roche 480 real-time detection system (Roche Diagnostics, Swiss). Each experiment was repeated 3 times. After the reaction was complete, 2... -△△CT The relative expression level of the GmFPS1 gene was calculated using analytical methods. Under NaHCO3 stress, the mRNA level of GmFPS1 was upregulated, reaching a peak in soybean roots treated for 12 h and soybean leaves treated for 24 h. Figure 3 ).
[0035] Example 5: Transient expression determination of GmFPS1 promoter-LUC activity in tobacco leaves
[0036] Use primers F2: 5'-AAGGAGGTGGAAGGAAGCATT-3', R2: 5'-GGCGAGCATCATCGGAGAAC-3'
[0037] The 2kb promoter sequence of the GmFPS1 gene (SEQ ID NO.3) was cloned, ligated into the vector pGreenII0800-LUC, transformed into GV3101, and injected into tobacco leaves. LUC activity was observed using a live plant imaging system (Berthod LB 985, Germany). Transient expression analysis of the promoter -luc in tobacco leaves revealed that the activity of the GmFPS1 promoter was significantly stronger than the control under alkaline stress, indicating that the GmFPS1 promoter responds to alkaline stress (…). Figure 4 ).
[0038] Example 6: Effect of GmFPS1 gene overexpression on NaHCO3 tolerance in yeast cells
[0039] Based on the CDS sequence of the GmFPS1 gene and the MCS information of the co-expression vector pYES2, two restriction endonuclease sites, Kpn I and BamHI, were selected. Primers for amplification of the GmFPS1 gene in Meng 8206 were designed using the one-step cloning method. The one-step cloning primers were F3: 5'-gggaatattaagcttggtaccATGGCAGATCTCAAGTCTACATTCTT-3' and R3: 5'-gcggc cgttactagtggatccCTACTTCTGCCTTTTGTAAATTTTAGC-3'. The GmFPS1 gene was then inserted into the MCS of the co-expression vector pYES2 by restriction endonuclease digestion and one-step cloning primer ligation. The G19 strain containing pYES2:Gm FPS1 with correct sequencing and the empty vector strain were cultured in YPD liquid medium. When the OD600 concentration of the bacterial culture reached 0.6-0.8, the bacteria were harvested, centrifuged, and resuspended until the OD600 value was equal to 0.6. The bacterial culture was spotted onto YPD solid medium containing 0, 5, 10, and 20 mM NaHCO3 using a 10-fold serial dilution plate method. The YPD medium containing yeast transformants had a dilution gradient of 10-fold. -1 10 -2 10 -3 10 -4 and 10 -5 Phenotypic results were observed and recorded after 4 days of culture. Under normal culture conditions, there was no difference in growth between the empty vector yeast strain and the yeast strain overexpressing GmFPS1. However, under 5 and 10 mM NaHCO3 stress treatments, the yeast strain overexpressing GmFPS1 showed significant growth. -4 10 -5The growth of the yeast strain overexpressing GmFPS1 was better under dilution gradients than that of the empty vector yeast strain; under 20 mM NaHCO3 stress treatment, the yeast strain overexpressing GmFPS1 grew at 10... -3 The growth at the diluted concentration was better than that of the yeast empty vector strain, indicating that overexpression of GmFPS1 can indeed improve the tolerance of yeast strains to NaHCO3 stress treatment. Figure 5 ).
[0040] Example 7: Obtaining and Phenotypic Identification of Transgenic Arabidopsis Strains
[0041] Based on the CDS sequence of the GmFPS1 gene and the MCS information of the plant expression vector pLY1, two restriction endonuclease sites, Asc I and PacI, were selected for the experiment. Primers were designed using a one-step cloning method to amplify and clone the GmFPS1 gene of the alkali-tolerant variety Meng 8206. The one-step cloning primers were F4: 5'-tctagaggatctcgaggcgcgccATGGCAGATCTCAAGTCTACATTCTT-3', and R4: 5'-attcgagctcactagttaattaaCTACTTCTGCCTTTTGTAAATTTTAGC-3'. The GmFPS1 gene was then inserted into the MCS of the plant expression vector pTF101.1 using restriction endonuclease digestion and one-step cloning primer ligation. The pTF101.1-GmFPS1 vector was then introduced into Agrobacterium rhizogenes EHA101 and transformed into Arabidopsis thaliana Col-0 WT plants using the flower dip method. The T0 generation Arabidopsis seeds harvested earlier were sterilized by rinsing three times with filtered sterilized 0.9% sodium hypochlorite and 75% ethanol, followed by three washes with sterilized ultrapure water. They were then vernalized at 4°C for 2-3 days. The seeds were then evenly sown on sterilized vermiculite nutrient soil (vermiculite: nutrient soil = 1.5:1) for cultivation. After three weeks, 70 mg / L glufosinate was sprayed for selection, with spraying once a week. The Arabidopsis seeds that continued to grow normally without wilting or yellowing were transferred to new vermiculite nutrient soil for propagation to obtain T1 generation Arabidopsis seeds. The received T1 generation Arabidopsis seeds were also sterilized and sown on 1 / 2 MS medium containing 20 mg / L glufosinate. After about one week of growth, it was observed that the transgenic Arabidopsis grew normally on the glufosinate-containing medium, producing greener cotyledons; while the non-transgenic Arabidopsis did not grow normally, with cotyledons showing wilting and yellowing, and some even failing to germinate. Arabidopsis thaliana plants that grew normally on glufosinate-ammonia plates were transferred to vermiculite nutrient soil (vermiculite: nutrient soil = 1.5:1) for further cultivation. The resulting Arabidopsis seeds were then further cultured on a medium containing glufosinate-ammonia until all Arabidopsis seeds from each line showed normal growth on the glufosinate-ammonia medium, at which point the transgenic Arabidopsis could be preliminarily identified as homozygous. DNA was extracted from leaves of the preliminarily identified homozygous transgenic Arabidopsis plants at the bolting stage for PCR detection. Arabidopsis plants with consistent amplification of the target fragment were selected for propagation to conduct further experiments.
[0042] The overexpressing Arabidopsis thaliana, mutant Arabidopsis thaliana, and wild-type Arabidopsis thaliana were simultaneously propagated and harvested. The harvested seeds were then sterilized by rinsing three times with filtered sterilized 0.9% sodium hypochlorite and 75% ethanol, followed by washing three times with sterilized ultrapure water, and vernalized at 4°C for 2-3 days before use.
[0043] Root length measurement: Transgenic Arabidopsis thaliana, wild-type Arabidopsis thaliana, and mutant Arabidopsis thaliana were sown on 1 / 2 MS medium containing 0 and 3 mM NaHCO3. After two weeks of normal growth, phenotypes were photographed and recorded, and root length data of transgenic Arabidopsis thaliana, wild-type Arabidopsis thaliana, and mutant Arabidopsis thaliana were analyzed using Image-J software between the treatments and the control.
[0044] Without NaHCO3 treatment, there was no significant difference in growth between GmFPS1-overexpressing Arabidopsis and wild-type Arabidopsis, and no significant difference in taproot length. However, under the treatment conditions, GmFPS1-overexpressing Arabidopsis showed better growth than wild-type and mutant Arabidopsis. Root length statistical analysis showed that the taproot length of GmFPS1-overexpressing Arabidopsis was significantly greater than that of wild-type Arabidopsis. This indicates that in the Arabidopsis system, overexpression of GmFPS1 can indeed improve the alkali tolerance of Arabidopsis plants. Figure 6 ).
[0045] Example 8: Obtaining and Phenotypic Identification of Soybean Hairy Root Chimeras with GmFPS1 Gene Overexpression
[0046] Based on the CDS sequence of the GmFPS1 gene and the MCS information of the co-expression vector pBinGFP4, two restriction endonuclease sites, Kpn I and SmaI, were selected. Primers were designed to amplify the GmFPS1 gene from Meng 8206 using a one-step cloning method. The one-step cloning primers were: GmFPS1-GFP-F: 5'-atttacgaacgatagggtaccATGGCAGATCTCAAGTCTACATTCTT-3', and GmFPS1-GFP-R: 5'-catggatccgtcgaccccgggCTTCTGCCTTTTGTAAATTTTAGCC-3'. The GmFPS1 gene was then inserted into the MCS of the co-expression vector pBinGFP4 via restriction endonuclease digestion and one-step cloning primer ligation. The recombinant plasmid was then transformed into Agrobacterium rhizogenes K599. Select plump and round Tianlong No. 1 soybean seeds, add 75% ethanol to wash and disinfect the surface of the soybeans, then rinse three times with ultrapure water to remove excess 75% ethanol. Place the washed soybean seeds in autoclaved sand cooled to room temperature for germination. Culture conditions: 14h light / 10h darkness, temperature 28℃ / 25℃. Prepare 50mL sterile centrifuge tubes, wrap the outside of the tubes with aluminum foil to maintain a light-protected environment, then add 40mL of 1 / 2 Hogland nutrient solution. Transfer plants with cotyledons not yet unfolded after 3 days of growth into the centrifuge tubes for culture. Transfer the previously preserved rooting empty vector bacterial solution and the bacterial solution overexpressing GmFPS1 to YEB liquid medium, and expand the culture at 28℃ and 220rpm. Stop the culture when the OD600 value of the bacterial solution reaches 0.6-0.8, and collect the bacteria by centrifugation at 5000rpm for 10min. Discard the supernatant. After centrifugation, resuspend the bacterial solution at the bottom of the centrifuge tube twice with 10mM MgCl2. For the last resuspending, adjust the OD600 value of the bacterial solution to 0.6 for later use. Seedlings just pulled from the sand need to acclimatize in the centrifuge tube for one day to adapt to the external environment, which is beneficial for their growth. Then, 1 cm from the cotyledon, use the tip of a 1mL syringe to make a wound about 1cm long, penetrating the stem. Inject the bacterial solution into the wound using a 1mL syringe and rub back and forth to promote bacterial infection. Repeat twice. Seedlings need to be cultured in the dark on the first day after infection. Normal culture can be carried out on the second day. From the third day onwards, humidify with a humidifier for 4 hours each in the morning and afternoon, maintaining a nutrient solution volume of 40ml in the centrifuge tube to maintain high transpiration pull. Change the nutrient solution every three days. When the newly grown roots at the wound site reach about 5cm, a small amount of the taproot and aerial roots not at the wound site can be intermittently trimmed. After the taproot and aerial roots are completely removed, the soybean seedlings can be transferred to a 1L beaker and cultured in 1 / 2 Hoagland nutrient solution. After the rooted seedlings have been cultured in the beaker for one week, positive roots with green fluorescence are selected under a fluorescence stereomicroscope, and non-positive roots are cut off.After removing all non-positive roots, the plants were cultured for another week, and then selected plants with uniform growth were used for treatment. The treatment group was cultured in 1 / 2 Hoagland nutrient solution (pH=8.5) with 90mM NaHCO3; the control group was cultured in 1 / 2 Hoagland nutrient solution (pH=5.8). Fifteen seedlings were taken from each treatment, and three biological replicates were set up.
[0047] Phenotypic identification of soybean root chimeras
[0048] (1) Phenotypic differences were recorded. Five days after treatment, the phenotypic differences between the control group and the treatment group were observed and recorded with a camera.
[0049] (2) Determination of chlorophyll content (SPAD). Five days after treatment, the chlorophyll content of the plant can be determined by a chlorophyll meter. The selected leaf should be the middle leaf of the third leaf from the bottom of the soybean plant. The chlorophyll meter is used to measure the chlorophyll content at three different parts of the selected leaf. The leaf parts should avoid the veins. The average value is recorded as the chlorophyll content of the plant.
[0050] (3) Determination of Relative Leaf Water Content (LRWC). After 5 days of treatment, select the middle leaf from the third leaf from the bottom of the plant, weigh it, and record the fresh weight. Then, place the selected leaf in a sampling bag and fill it with pure water. After the leaf has absorbed water for 2-3 days until it is completely dry and its weight no longer changes, remove the leaf and blot off any remaining moisture with filter paper. Weigh and record the saturated fresh weight of the leaf. After weighing the saturated fresh weight, put the leaf into a kraft paper bag and dry it in an oven at 80℃. After one week, until the leaf weight no longer changes, weigh it and record the dry weight of the leaf. The formula for calculating the relative leaf water content is:
[0051] Relative water content of leaves = (fresh weight - dry weight) / (saturated fresh weight - dry weight) × 100%
[0052] (4) Determination of relative electrical conductivity (REC) of leaves. Five days after treatment, the middle leaf of the third leaf from the bottom of the plant was selected, rinsed with ultrapure water to remove surface dirt, and then placed on filter paper to absorb surface moisture. The leaf was cut into small pieces, avoiding the main vein. 0.1g of fresh sample was weighed, and three replicates were taken for each sample. The leaf pieces were then placed in centrifuge tubes containing 10ml of deionized water, ensuring that the leaf pieces sank to the bottom of the tube. The caps were tightened and the leaves were soaked at room temperature for 12 hours. After 12 hours, the electrical conductivity (R1) of the leaf extract was measured using a conductivity meter. Then, the leaves were heated in boiling water at 100℃ for 30 minutes. After heating, the leaves were cooled to room temperature, and the electrical conductivity (R2) of the leaf extract was measured again using a conductivity meter.
[0053] Relative conductivity (REC) = R1 / R2 × 100%.
[0054] (5) Determination of iron content
[0055] 25-day-old transgenic soybean plantlets were transplanted into 1 / 2 Hoagland fresh solution supplemented with 0 or 90 mM NaHCO3 and cultured for another 5 days. To quantify iron content, leaf samples were collected and freeze-dried overnight. 0.05 g of dry matter was mineralized with 1 mL of 10% HNO3. Ion extraction was then performed using the ETHOS T microwave digestion system (Milestone, Italy), and iron content was determined using an Optima 8000 ICP-OES DV spectrometer (Perkins-Elmer, USA). Three biological replicates were performed. Figure 7 As shown: Under control conditions, there was no significant difference in growth between empty-plant and GmFPS1-overexpressing rooted chimeric plants. However, after treatment with 90 mM NaHCO3, both empty-plant and GmFPS1-overexpressing rooted chimeric plants grew significantly slower than the control group, but the GmFPS1-overexpressing rooted chimeric plants grew significantly better than the empty-plant, which exhibited obvious wilting and yellowing. Then, relevant physiological indicators were measured. Under control conditions, statistical analysis showed no significant differences in aboveground fresh weight, chlorophyll content, relative water content, relative electrical conductivity, and Fe content between empty-plant and GmFPS1-overexpressing rooted chimeric plants. However, under treatment conditions, statistical analysis showed that the aboveground fresh weight, chlorophyll content, leaf relative water content, and iron ion content of GmFPS1-overexpressing rooted chimeric plants were significantly higher than those of empty-plant, while the leaf relative electrical conductivity was significantly higher in empty-plant than in GmFPS1-overexpressing rooted chimeric plants. The differences in these stress-related physiological indicators suggest that overexpression of the GmFPS1 gene can improve the alkali tolerance of soybean plants by maintaining higher chlorophyll content, higher iron ion content, and reducing leaf water loss rate under stress conditions, thereby ensuring that soybean plants maintain a good survival status after being subjected to alkali salt (NaHCO3) stress.
Claims
1. The soybean farnesyl pyrophosphate synthase gene shown in SEQ ID NO. 1 GmFPS1 Application in the construction of alkali-tolerant transgenic soybeans or Arabidopsis thaliana.
2. The soybean farnesyl pyrophosphate synthase gene shown in SEQ ID NO. 3 GmFPS1 The application of the promoter in the construction of alkali-resistant transgenic tobacco.