A method for constructing a zebrafish model of secondary hemophagocytic syndrome and application thereof
By administering CpG ODN 2007 and lipopolysaccharide to zebrafish, a secondary hemophagocytic lymphohistiocytosis (HLH) model was constructed, solving the problems of long experimental cycles and large drug dosages in mouse models, and achieving rapid, low-cost, multi-dimensional evaluation.
Patent Information
- Application Number
- CN202410512657.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-26
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2044-04-26
AI Technical Summary
Existing mouse HLH models suffer from drug insensitivity, resulting in long experimental cycles, large drug dosages, and high costs for experimental animals, thus hindering high-throughput applications.
A zebrafish model of secondary hemophagocytic syndrome was constructed by administering CpG ODN 2007 to zebrafish every other day, along with lipopolysaccharide daily, with optimized dosing frequency and dosage.
It shortened the modeling time, reduced the dosage, and provided multi-dimensional evaluation indicators, including the number of whole blood cells, the expression level of inflammatory factors, and the area of organ inflammation lesions, which is of great significance for the research of HLH rare disease.
Smart Images

Figure CN118266439B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal model construction technology, and in particular to a method for constructing and applying a zebrafish secondary hemophagocytic syndrome model. Background Technology
[0002] Hemophagocytic lymphohistiocytosis (HLH) is a fatal disease caused by various pathogenic factors. The main pathological mechanism is hypercytokineemia resulting from an ineffective immune response caused by abnormal activation of macrophages and CTL cells. Based on the primary disease, HLH is divided into primary hemophagocytic lymphohistiocytosis (FHL) with genetic defects and secondary hemophagocytic lymphohistiocytosis caused by infections, tumors, rheumatism, etc., such as rheumatoid arthritis-associated hemophagocytic lymphohistiocytosis and lymphoma-associated hemophagocytic lymphohistiocytosis. Due to the immune deficiency in HLH, pathogens are difficult to eliminate, leading to excessive T cell activation and cytokine storms that damage organs. The disease progresses rapidly and has a very high mortality rate. Basic treatment involves using hormones, cyclosporine, and etoposide to inhibit or kill T cells to achieve disease remission. Therefore, the screening of drugs that can inhibit or kill T cells remains an important area of research in secondary hemophagocytic lymphohistiocytosis.
[0003] Existing technologies often use mouse HLH models, but mice are not sensitive to drugs and require long-term administration, resulting in long experimental cycles, large drug dosages, and high costs for experimental animals, which prevents high-throughput applications.
[0004] In view of this, the present invention is hereby proposed. Summary of the Invention
[0005] One of the objectives of this invention is to provide a method for constructing a zebrafish secondary hemophagocytic lymphohistiocytosis (HLH) model, in order to solve the technical problems of existing mouse HLH models, which require long-term drug administration due to the insensitivity of mice to drugs, resulting in long experimental cycles, large drug dosages, and high costs of experimental animals.
[0006] The second objective of this invention is to provide an application of the zebrafish secondary hemophagocytic syndrome model constructed by the above method in evaluating secondary hemophagocytic syndrome.
[0007] A third objective of this invention is to provide a method for evaluating secondary hemophagocytic syndrome.
[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:
[0009] In a first aspect, the present invention provides a method for constructing a zebrafish secondary hemophagocytic syndrome model, comprising administering CpG ODN 2007 to zebrafish every other day; and simultaneously administering lipopolysaccharide to zebrafish daily; wherein the administration period is at least 7 days.
[0010] Furthermore, the CpG ODN 2007 is administered at least four times;
[0011] Preferably, the lipopolysaccharide is administered at least 7 times.
[0012] Furthermore, the injection dose of CpG ODN 2007 is 1 to 1.5 μl of CpG ODN 2007 at a concentration of 1 μg / μl per 0.5g zebrafish body weight, preferably 1 μl per 0.5g zebrafish body weight;
[0013] The injection dosage of the lipopolysaccharide is 4-6 μl of lipopolysaccharide at a concentration of 1.5 μg / μl per 0.5g zebrafish body weight, preferably 5 μl per 0.5g zebrafish body weight.
[0014] Furthermore, this also includes ≥6 hours of culture after the last administration.
[0015] Furthermore, the zebrafish selected are zebrafish that are over 3 months old and have normal development.
[0016] Furthermore, the method of administration is intraperitoneal injection.
[0017] Secondly, the present invention provides an application of the zebrafish secondary hemophagocytic syndrome model constructed by the above method in evaluating drugs for treating secondary hemophagocytic syndrome.
[0018] Thirdly, the present invention provides a method for evaluating drugs for treating secondary hemophagocytic lymphohistiocytosis (HLH), wherein a zebrafish HLH model constructed using the above method is used to evaluate drugs for treating HLH.
[0019] Furthermore, the evaluation indicators include the number of whole blood cells in zebrafish and the expression levels of inflammatory factors;
[0020] Preferably, the inflammatory factors include IFN-γ, IL-1β, and IL-6.
[0021] Furthermore, the evaluation indicators also include observing the presence and size of inflammatory lesions in the liver, spleen, and kidneys.
[0022] This invention provides a method for constructing a zebrafish secondary hemophagocytic lymphohistiocytosis (HLH) model. By using lipopolysaccharide (LPS) and CpG ODN 2007 in combination to administer the drug to zebrafish, the HLH model can be constructed in a short time with small dosage, thus shortening the modeling time. The resulting zebrafish model can achieve multi-dimensional evaluation covering the number of blood cells, the expression level of inflammatory factors, and the inflammatory lesion areas of the liver, spleen, and kidneys, which is of great significance for the research of rare diseases such as HLH. Attached Figure Description
[0023] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0024] Figure 1 The whole blood cell count of the zebrafish model provided in Embodiment 1, Comparative Example 1 and Comparative Example 2 of the present invention is shown in the following graphs.
[0025] Figure 2 The complete blood cell count of the zebrafish model provided in Comparative Example 3 of this invention;
[0026] Figure 3 This is a statistical graph showing the expression levels of IFN-γ, IL-1β, and IL-6 in the zebrafish model provided in Comparative Example 1 of this invention.
[0027] Figure 4 This is a statistical graph showing the expression levels of IFN-γ, IL-1β, and IL-6 in the zebrafish model provided in Comparative Example 2 of this invention.
[0028] Figure 5 The expression levels of IFN-γ, IL-1β and IL-6 in the zebrafish model provided in Comparative Example 3 of this invention are statistically significant.
[0029] Figure 6 The expression levels of IFN-γ, IL-1β, and IL-6 in the zebrafish model provided in Embodiment 1 of the present invention are statistically significant.
[0030] Figure 7 This is a microscopic image of the spleen of a zebrafish model stained with Giemsa Wright, as provided in Example 1 of this invention.
[0031] Figure 8 The images show the spleens of zebrafish models stained with Giemsa Wright staining, as shown in Comparative Examples 1 and 2 of this invention, under a microscope.
[0032] Figure 9The image shows the liver, spleen, and kidney of the zebrafish model stained with hematoxylin and eosin (HE) under a microscope, as shown in Embodiment 1 of the present invention.
[0033] Figure 10 The image shows the liver, spleen, and kidney of the zebrafish model provided in Comparative Example 1 of this invention, stained with hematoxylin and eosin (HE) and microscopically.
[0034] Figure 11 The image shows the liver, spleen, and kidney of the zebrafish model provided in Comparative Example 2 of this invention after HE staining under a microscope.
[0035] Figure 12 This is a comparative observation image of the spleen of the zebrafish model provided in Embodiment 1 of the present invention. Detailed Implementation
[0036] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.
[0037] Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.
[0038] In one aspect, the present invention provides a method for constructing a zebrafish secondary hemophagocytic syndrome model, comprising administering CpG ODN 2007 to zebrafish every other day; and administering lipopolysaccharide to zebrafish daily.
[0039] By using lipopolysaccharide and CpG ODN 2007 to administer a combined drug to zebrafish, a model of secondary hemophagocytic lymphohistiocytosis (HLH) was successfully established. This method is quick and requires small amounts of medication, thus shortening the modeling time. The resulting zebrafish model can provide multi-dimensional evaluation of the total number of blood cells, the expression level of inflammatory factors, and the inflammatory lesions in the liver, spleen, and kidneys, which is of great significance for the study of HLH, a rare disease.
[0040] In some specific embodiments, the CpG ODN 2007 is administered at least four times;
[0041] The phrase "at least 4 times" refers to the administration of CpG ODN 2007 four or more times. Specifically, four administrations of CpG ODN 2007 include administrations on days 1, 3, 5, and 7; five administrations include administrations on days 1, 3, 5, 7, and 9; and so on. The administration frequency can be adjusted according to the specific application requirements of the zebrafish secondary hemophagocytic lymphohistiocytosis (HLH) model.
[0042] To ensure the effectiveness of the zebrafish model, lipopolysaccharide (LPS) administration needs to continue until the last administration of CpG ODN 2007. Preferably, the LPS is administered at least seven times.
[0043] In some specific embodiments, the injection dose of CpG ODN 2007 is 1 to 1.5 μl of CpG ODN 2007 at a concentration of 1 μg / μl per 0.5g zebrafish body weight, preferably 1 μl per 0.5g zebrafish body weight;
[0044] The injection dosage of the lipopolysaccharide is 4-6 μl of lipopolysaccharide at a concentration of 1.5 μg / μl per 0.5g zebrafish body weight, preferably 5 μl per 0.5g zebrafish body weight.
[0045] To ensure the modeling effect of the zebrafish secondary hemophagocytic syndrome model, some specific implementations also include culturing for ≥6 hours after the last administration.
[0046] In some specific implementations, the administration method is intraperitoneal injection.
[0047] In some specific implementations, the zebrafish are selected from zebrafish that are 3 months old or older and have normal development.
[0048] In another aspect, the present invention provides the application of the zebrafish secondary hemophagocytic syndrome model constructed by the above-described method in evaluating drugs for treating secondary hemophagocytic syndrome.
[0049] In another aspect, the present invention provides a method for evaluating secondary hemophagocytic syndrome, wherein a zebrafish model of secondary hemophagocytic syndrome constructed using the above method is used to evaluate drugs for treating secondary hemophagocytic syndrome.
[0050] In some specific implementations, the evaluation indicators include the number of zebrafish whole blood cells and the expression levels of inflammatory factors;
[0051] Preferably, the inflammatory factors include IFN-γ, IL-1β, and IL-6.
[0052] In some specific implementations, the evaluation indicators also include observing the presence of inflammatory lesions in the liver, spleen, and kidneys.
[0053] The zebrafish model of secondary hemophagocytic lymphohistiocytosis (PHL) constructed using the above method was used to evaluate drugs for the treatment of PHL. The evaluation indicators covered total blood cell count, expression of inflammatory factors, and organ inflammatory lesions, achieving multi-dimensional evaluation from the perspectives of genes, cells, and tissues.
[0054] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0055] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.
[0056] The following examples use the following reagents:
[0057] 0.9% saline (Solepro IN9000); Lipopolysaccharides (MCE HY-D1056); CpG ODN2007 (MCE HY-150734); One Step qRT-PCR SYBR Green Kit (Novizan Q221); Cell / TissueTotal RNA Isolation Kit V2 (Novizan RC112); RNase-Free DNase Set (Novizan RH104-C1); PBS (Solepro P1020).
[0058] Experimental animals: Adult AB strain wild-type zebrafish, bred by Beco Biotechnology Co., Ltd.
[0059] Example 1
[0060] Twelve adult zebrafish (over 3 months old) were randomly divided into two groups of six each. ① Combined group: On days 1, 3, 5, and 7, each 0.5g of zebrafish body weight was intraperitoneally injected with 1µl of CpGODN 2007 at a concentration of 1µl / µl, and concurrently, 5µl of lipopolysaccharide (LPS) per 0.5g of zebrafish body weight was intraperitoneally injected daily for 7 consecutive days. ② Combined control group: On days 1, 3, 5, and 7, each 0.5g of zebrafish body weight was intraperitoneally injected with 1µl of PBS, and concurrently, 5µl of PBS was intraperitoneally injected daily for 7 consecutive days. The interval between each injection was 24 hours. The behavior of the zebrafish was observed daily after the start of drug administration.
[0061] Comparative Example 1
[0062] Twelve adult zebrafish (over 3 months old) were randomly divided into two groups of six each. ① LPS group: 5 μL of lipopolysaccharide (LPS) at a concentration of 1.5 μg / μL was injected intraperitoneally per 0.5 g of zebrafish body weight daily for 7 consecutive days. ② LPS control group: 5 μL of PBS was injected intraperitoneally daily for 7 consecutive days. The interval between each injection was 24 hours. The behavior of the zebrafish was observed daily after the start of drug administration.
[0063] Comparative Example 2
[0064] Twelve adult zebrafish (over 3 months old) were randomly divided into two groups of six each. ① ODN 2007 group: 0.5g of zebrafish body weight was intraperitoneally injected with 1µl of CpG ODN 2007 per µl on days 1, 3, 5, and 7. ② ODN 2007 control group: 0.5g of zebrafish body weight was intraperitoneally injected with 1µl of PBS per µl on days 1, 3, 5, and 7. The interval between each injection was 48 hours. The behavior of the zebrafish was observed daily after the start of drug administration.
[0065] Comparative Example 3
[0066] Forty-eight adult zebrafish (over 3 months old) were selected and randomly divided into eight groups of six each.
[0067] Experimental group 1: Intraperitoneal injection of 5ul of lipopolysaccharide (LPS) at a concentration of 1.5ug / ul and 1ul of CpG ODN2007 at a concentration of 1ug / ul.
[0068] Control group 1: Injected with 6ul of PBS.
[0069] Experimental group 2: On day 1, 5ul of lipopolysaccharide (LPS) at a concentration of 1.5ug / ul was injected intraperitoneally, and on day 2, 1ul of CpG ODN 2007 at a concentration of 1ug / ul was injected intraperitoneally.
[0070] Control group 2: 5ul of PBS was injected intraperitoneally on day 1 and 1ul of PBS was injected intraperitoneally on day 2.
[0071] Experimental group 3: On days 1 and 3, 1 μg / μl of CpG ODN 2007 was injected intraperitoneally, and 5 μl of lipopolysaccharide (LPS) was injected intraperitoneally daily at a rate of 1.5 μg / μl for 3 consecutive days.
[0072] Control group 3: PBS 6ul was injected intraperitoneally on days 1 and 3, and PBS 5ul was injected intraperitoneally on day 2.
[0073] Experimental group 4: On days 1, 3 and 5, 1 μg / μl of CpG ODN 2007 was injected intraperitoneally, and 5 μl of lipopolysaccharide (LPS) was injected intraperitoneally daily at a rate of 1.5 μg / μl for 5 consecutive days.
[0074] Control group 4: PBS 6ul was injected intraperitoneally on days 1, 3, and 5, and PBS 5ul was injected intraperitoneally on days 2 and 4.
[0075] Evaluation test of zebrafish secondary hemophagocytic syndrome model
[0076] The models constructed in Example 1 and Comparative Examples 1-3 were selected, and blood samples were collected from zebrafish 6 hours after the last drug administration. Whole-cell counts and expression detection of relevant inflammatory factor genes were performed to observe inflammatory lesions in the liver, spleen, and kidneys.
[0077] 1) Blood cell count is specifically performed by counting the total number of blood cells under a microscope using a modified Boehringer's Law hemocytometer.
[0078] The same amount of blood was collected from each fish, diluted 1000 times, and whole blood counts were performed under a microscope using a modified Bovine Bauer hemocytometer. All data were analyzed using SPSS 27.0 statistical software. One-way ANOVA was used for comparisons between groups. Specific results are shown below. Figures 1-2 As shown.
[0079] It can be seen that in Example 1, the number of whole blood cells in zebrafish in the LPS and CpG ODN 2007 combined group was significantly lower than that in the combined control group (P<0.05). In Comparative Example 1, the number of whole blood cells in zebrafish in the LPS group showed a decreasing trend compared with the LPS control group, but there was no significant difference. In Comparative Example 2, the number of whole blood cells in zebrafish in the ODN 2007 group was extremely significantly lower than that in the ODN 2007 control group (P<0.001). In Comparative Example 3, the number of whole blood cells in experimental groups 2 to 4 was significantly lower than that in their corresponding control groups 2 to 4.
[0080] 2) Detect the gene expression of relevant inflammatory factors using qPCR on blood samples.
[0081] RNA was extracted from blood samples using the Cell / Tissue Total RNA Isolation Kit V2 (Novazia RC112) and used as a template for qPCR amplification according to the system shown in Table 1. The expression levels of IFN-γ, IL-1β and IL-6 were detected, and the specific reaction conditions are shown in Table 2.
[0082] Table 1 Amplification System
[0083] reagents Volume (μl) 2×One Step SYBR Green Mix 10 One Step SYBR Green Enzyme Mix 1 Primer F 0.4 Primer R 0.4 Template + Water 8.2
[0084] Primer IFNγ-F1: CCATCTTCCTGCGAATCCTG (SEQ ID NO:1);
[0085] Primer IFNγ-R1: GCTTCATCCACGCTGTCATTC (SEQ ID NO:2);
[0086] Primer IL1B-F1: CATCATCGCCCTGAACAGAAT (SEQ ID NO:3);
[0087] Primer IL1B-R1: TGTAAGACGGCACTGAATCCAC (SEQ ID NO:4);
[0088] Primer Z-IL6-F: GCACGGAAAGATGTCTAACG (SEQ ID NO:5);
[0089] Primer Z-IL6-R: CAGTCGTTTGGTGCTGTGTT (SEQ ID NO:6).
[0090] Table 2 Reaction conditions
[0091]
[0092] Combination Figures 3-6 Please provide an explanation, in which Figure 3 To compare the expression levels of IFN-γ, IL-1β, and IL-6 in the zebrafish model in Example 1, there were no significant differences in the gene expression of IFN-γ, IL-1β, and IL-6 in the blood of zebrafish in the LPS group compared with the control group. Figure 4 To compare the expression levels of IFN-γ, IL-1β, and IL-6 in the zebrafish model in Example 2, the gene expression of IFN-γ and IL-1β in the blood of zebrafish in the ODN 2007 group was not significantly different from that in the control group, while the gene expression of IL-6 was significantly increased compared with the control group (P<0.05). Figure 5 To compare the expression levels of IFN-γ, IL-1β, and IL-6 in the zebrafish model in Example 3, the IFN-γ gene expression level in experimental group 1 was lower than that in control group 1, the IFN-γ, IL-1β, and IL-6 gene expression levels in experimental group 2 were unchanged compared to control group 2, the IL-6 gene expression level in experimental group 3 was lower than that in control group 3, and the IFN-γ, IL-1β, and IL-6 gene expression levels in experimental group 4 were higher than those in control group 4, but none of these showed significant differences, especially the IL-6 gene expression level. Figure 6The expression levels of IFN-γ, IL-1β, and IL-6 in the zebrafish model in Example 1 were measured. The gene expression of IFN-γ and IL-1β in the blood of zebrafish in the LPS and CpG ODN 2007 combined group was significantly increased compared with the control group (P<0.05); the gene expression of IL-6 showed an increasing trend compared with the control group.
[0093] 3) Spleen samples were taken, smears were prepared using the contact method, and stained with Wright's Giemsa stain to observe the phagocytosis of blood cells. Specific results are as follows: Figures 7-8 As shown.
[0094] Specifically, Figure 7 The image shows a microscopic observation of the spleen of a zebrafish model stained with Giemsa stain (Example 1). A-C represent the combined treatment group, and D represents the combined control group. It was found that the spleen of zebrafish in the LPS and CpG ODN 2007 combined treatment group exhibited phagocytosis of granulocytes, erythrocytes, and platelets, while the combined control group showed only normal erythrocytes and leukocytes. Figure 8 The images show microscopic observations of the spleens of zebrafish models stained with Giemsa stain from Wright's method in Comparative Examples 1 and 2. From top to bottom, the left side represents the LPS group and the ODN2007 group, respectively, while the right side represents the LPS control group and the ODN2007 control group. It was observed that the spleens of zebrafish in the LPS group exhibited possible phagocytosis, while the LPS control group contained only normal red and white blood cells. The spleens of zebrafish in the ODN2007 group showed phagocytosis of granulocytes, while the ODN2007 control group contained only normal red and white blood cells.
[0095] 4) Liver, spleen, and kidney samples were taken for HE staining to evaluate the pathological condition. Specific results are as follows: Figures 9-11 As shown, from left to right, the organs are the liver, spleen, and kidneys.
[0096] Specifically, Figure 9 The images show microscopic observations of the liver, spleen, and kidneys of the zebrafish model stained with hematoxylin and eosin (HE) in Example 1. A represents the combined group, and B represents the combined control group. Compared to the combined control group, the combined LPS and CpG ODN 2007 group showed inflammatory cell infiltration and cell cavitation in the liver, spleen, and kidneys. Kidney epithelial cell cytoplasm sloughed off, forming vacuoles, and the renal tubular cysts disappeared. Simultaneously, the cell nuclei enlarged, forming lesion areas. Figure 10 The images show microscopic observations of the liver, spleen, and kidneys of a zebrafish model stained with hematoxylin and eosin (HE) in Comparative Example 1. A represents the LPS group, and B represents the LPS control group. It was found that the liver and spleen of the zebrafish in the LPS group showed inflammatory cell infiltration and cell vacuolation compared to the LPS control group, while the kidneys showed no significant difference compared to the control group. Figure 11The images show microscopic observations of the liver, spleen, and kidneys of the zebrafish model after HE staining, Comparative Example 2. A represents the ODN 2007 group, and B represents the ODN 2007 control group. It was found that the liver, spleen, and kidneys of the zebrafish in the ODN 2007 group showed inflammatory cell infiltration and cell vacuolation compared to the ODN 2007 control group.
[0097] 5) Take a spleen sample and observe the swelling.
[0098] Observations revealed that the spleens of zebrafish in the LPS group showed no enlargement compared to the control group, while 50% of zebrafish in the ODN 2007 group exhibited spleen enlargement compared to the control group; however, the spleens of zebrafish in the combined LPS and CpG ODN 2007 group showed significant enlargement in 100% of cases compared to the combined control group. Specifically, the spleen comparison observation diagram of the zebrafish model in Example 1 is used as an example. Figure 12 As shown, the left side is the combined control group, and the right side is the combined group.
[0099] Therefore, compared with Comparative Examples 1 and 2, the combined intraperitoneal injection of LPS and CpG ODN 2007 in Example 1 stimulated zebrafish and caused clinical manifestations of HLH, including pancytopenia, significantly increased gene expression of IFN-γ, IL-1β, and IL-6 cytokines, resulting in a cytokine storm, hepatosplenomegaly, renal inflammatory cell infiltration, and phagocytosis of blood cells in the spleen. During the administration period, the zebrafish exhibited behaviors such as lying on the bottom, reduced swimming, and reduced feeding. Therefore, the combined injection of LPS and ODN 2007 can successfully construct a zebrafish model of secondary hemophagocytic lymphohistiocytosis, which is of great significance for the research of the rare disease HLH.
[0100] Compared with Comparative Example 3, although the number of whole blood cells in experimental groups 2-4 and Example 1 was significantly reduced, the gene expression of IFN-γ, IL-1β, and IL-6 in each experimental group did not increase significantly, and some even showed a decreasing trend. Therefore, the modeling effect of Example 1 was better than that of the experimental groups in Comparative Example 3.
[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for constructing a zebrafish model of secondary hemophagocytic lymphohistiocytosis syndrome, characterized in that, This includes administering CpG ODN 2007 to zebrafish every other day; simultaneously, administering lipopolysaccharide to zebrafish daily; the administration period is at least 7 days; The CpG ODN 2007 is administered at least 4 times; The lipopolysaccharide is administered at least 7 times; The injection dose of CpG ODN 2007 is 1~1.5μl of CpGODN 2007 at a concentration of 1μg / μl per 0.5g zebrafish body weight; The injection dosage of the lipopolysaccharide is 4-6 μl of lipopolysaccharide at a concentration of 1.5 μg / μl per 0.5g zebrafish body weight.
2. The construction method according to claim 1, characterized in that, The injection dose of CpG ODN 2007 is 1 μl of CpG ODN 2007 at a concentration of 1 μg / μl per 0.5g of zebrafish body weight. The injection dosage of the lipopolysaccharide is 5 μl of lipopolysaccharide at a concentration of 1.5 μg / μl per 0.5g zebrafish body weight.
3. The construction method according to claim 1, characterized in that, This also includes incubation for ≥6 hours after the last administration.
4. The construction method according to claim 1, characterized in that, The zebrafish selected were zebrafish that were over 3 months old and in normal development.
5. The construction method according to claim 1, characterized in that, The method of administration is intraperitoneal injection.
6. The application of the zebrafish secondary hemophagocytic syndrome model constructed by the method of any one of claims 1 to 5 in evaluating drugs for treating secondary hemophagocytic syndrome.
7. A method for evaluating drugs for treating secondary hemophagocytic lymphohistiocytosis, characterized in that, The zebrafish model of secondary hemophagocytic lymphohistiocytosis (HLH) constructed using the method described in any one of claims 1 to 5 was used to evaluate drugs for treating HLH.
8. The method according to claim 7, characterized in that, The evaluation indicators include the number of whole blood cells in zebrafish and the expression levels of inflammatory factors.
9. The method according to claim 8, characterized in that, The inflammatory factors include IFN-γ, IL-1β, and IL-6.
10. The method according to claim 8, characterized in that, The evaluation indicators also include observing whether there are inflammatory lesions in the liver, spleen, and kidneys.
Citation Information
Patent Citations
CpG-oligodeoxynucleotide, immunogenic composition, and use thereof
CN109593765A
Application of preparation capable of regulating macrophage epiinheritance in preparation of medicine for treating hemophagocytic syndrome
CN113786490A