Lactic acid bacteria expressing african swine fever virus fusion antigen and use thereof
By constructing lactic acid bacteria expressing ASFV fusion antigen, mucosal and cellular immune responses are activated, solving the problem of insufficient immune response efficacy of existing ASF vaccines and achieving effective prevention and control of ASF while improving biosafety.
Patent Information
- Application Number
- CN202410635171.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-21
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-05-21
AI Technical Summary
Existing ASF vaccines have issues with insufficient efficacy, safety, and stability in inducing immune responses. In particular, inactivated vaccines cannot completely prevent viral infection with neutralizing antibodies, live attenuated vaccines pose a risk of chronic infection, subunit vaccines rely on insufficient neutralizing antibodies, and the vector immune response of DNA and live vector vaccines may neutralize their efficacy.
A lactic acid bacteria expressing African swine fever virus fusion antigen was constructed. By integrating genes encoding OprI protein and proteins selected from PP62, MGF505-3R, EP364R, K145R, and DP96R, the ASFV antigen was expressed and orally delivered by the lactic acid bacteria, activating mucosal and cellular immune responses and enhancing humoral immune responses.
It has achieved effective prevention and control of ASF by activating mucosal and cellular immunity through oral administration of lactic acid bacteria, enhancing humoral immune response, improving the prevention and control effect of ASF, reducing the risk of antibiotic resistance gene transmission, and enhancing biosafety.
Smart Images

Figure CN118389390B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microorganisms, in particular to a lactic acid bacteria expressing African swine fever virus fusion antigen and application thereof. BACKGROUND
[0002] Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.
[0003] African swine fever (ASF) is a severe, porcine infectious, hemorrhagic disease and is considered one of the most severe and devastating viral diseases of domestic pigs. Outbreaks of ASF must be reported to the World Organization for Animal Health (OIE) when they occur. Research has found that outbreaks of ASF have caused severe economic losses worldwide and, because a safe and efficient vaccine has not been developed, ASF has been a serious threat to the development of the global pig industry since its discovery in the 20th century. The clinical manifestations and pathological features of ASF vary greatly, depending on the virulence of the strain and the characteristics of the host. Clinical symptoms of pigs infected with ASFV include high fever, vomiting, diarrhea, anorexia, dyspnea, skin hemorrhage, cyanosis, and abortion in pregnant sows. Acute ASF is caused by high or toxic isolates, with a mortality rate of up to 100%. At autopsy, the most typical lesions are severe hemorrhagic splenomegaly observed at the opening of the abdominal cavity of animals with acute ASF, and hemorrhagic enlargement of multiple lymph nodes throughout the body. Subacute and chronic generally manifest as respiratory symptoms, intermittent fever, chronic skin ulcers, and arthritis, which are caused by low-toxicity strains, with lower mortality. Low-toxicity strains have a longer incubation period, cause chronic disease, and infected pigs continuously shed the virus, making early diagnosis more difficult. Therefore, it is very urgent to develop a safe and effective ASF vaccine. To date, a series of vaccination strategies have been proposed, including inactivated vaccines, attenuated live vaccines, subunit vaccines, DNA vaccines, and live vector vaccines. Inactivated vaccines are prepared by killing viruses, aiming to inhibit cell viral infection by inducing antibody production. However, such vaccines generally lack sufficient efficacy, mainly because the produced neutralizing antibodies cannot completely prevent ASFV infection, and the role of antibodies in the protection mechanism is unclear. In practical applications, even if inactivated vaccines are inoculated, viremia may still persist in pigs. Attenuated live vaccines are prepared by weakening the virulence of viruses through natural selection or genetic engineering techniques. Although such vaccines show the potential to induce protective immune responses, there is a risk of causing chronic infection, such as skin and joint lesions, lymphadenopathy, and pneumonia. In addition, attenuated strains may regain virulence after passage in pigs, and different genetic deletions of different strains may produce different results, which increases the uncertainty of their use. Subunit vaccines generally use virus proteins or synthetic peptides prepared using recombinant technology, which can induce protective immune responses. The main challenge of such vaccines is the reliance on the production of neutralizing antibodies, but these antibodies often do not provide complete protection, and the use of potent adjuvants is required to enhance the immune response. In contrast, DNA vaccines work by injecting DNA fragments encoding ASFV antigens, which can induce strong cytotoxic T cell responses, providing stronger cellular immune protection than antibody-dependent vaccines. However, despite inducing specific T cell responses, the protective effect is still limited.Live vector vaccines are similar to nucleic acid-based vaccines, except that the gene encoding the target antigen is delivered into host cells using a non-pathogenic attenuated virus or bacteria. Live vector vaccines are based on viral, bacterial or plasmid gene expression vectors as antigen delivery systems to express viral antigens to elicit immune responses. However, the host can have an immune response to the vector itself, which can neutralize the vector, reduce its efficacy, and make the vaccine unable to effectively deliver the antigen, in addition, there are challenges in antigen expression efficiency, survival rate, stability, etc. SUMMARY
[0004] Therefore, the purpose of the present application is to provide a lactic acid bacteria expressing African swine fever virus fusion antigen and its application. The present application constructs a fusion gene comprising a gene encoding OprI protein and at least one gene selected from the group consisting of a gene encoding PP62 protein, MGF505-3R protein, EP364R protein, K145R protein and DP96R protein, and constructs a lactic acid bacteria therefrom, which has good growth ability and antigen expression ability, and can be used for immunizing animals against African swine fever, and can induce mucosal immunity, cellular immunity and humoral immune response in animals, comprehensively enhance the immune ability of the body, and achieve effective prevention and control of African swine fever.
[0005] Specifically, the present application provides the following technical features, and the combination of one or more of the following technical features constitutes the technical solution of the present application.
[0006] In a first aspect of the present application, a lactic acid bacteria expressing African swine fever virus fusion antigen is provided, wherein the lactic acid bacteria integrates a fusion gene, the fusion gene comprises: a gene encoding OprI protein and at least one gene selected from the group consisting of a gene encoding PP62 protein, MGF505-3R protein, EP364R protein, K145R protein and DP96R protein, and the starting strain of the lactic acid bacteria is Lactobacillus plantarum.
[0007] In an embodiment of the present application, the nucleotide sequence of the gene encoding OprI protein is shown in SEQ ID NO: 1; the nucleotide sequence of the gene encoding PP62 protein is shown in SEQ ID NO: 2; the nucleotide sequence of the gene encoding MGF505-3R protein is shown in SEQ ID NO: 3; the nucleotide sequence of the gene encoding EP364R protein is shown in SEQ ID NO: 4; the nucleotide sequence of the gene encoding K145R protein is shown in SEQ ID NO: 5; and the nucleotide sequence of the gene encoding DP96R protein is shown in SEQ ID NO: 6.
[0008] In an embodiment of the present application, the fusion gene is obtained by fusing a gene encoding OprI protein with a gene encoding PP62 protein, a gene encoding MGF505-3R protein, a gene encoding EP364R protein, a gene encoding K145R protein and a gene encoding DP96R protein, respectively. In an embodiment of the present application, the fusion gene further contains a gene encoding His-tag. In an embodiment of the present application, the fusion gene further contains a restriction enzyme recognition site sequence. The restriction enzyme is, for example, XbaI and / or HindIII, preferably XbaI and HindIII. In an embodiment of the present application, the fusion gene further contains a stop codon. In an embodiment of the present application, the gene encoding OprI protein in the fusion gene is connected to the gene encoding PP62 protein, the gene encoding MGF505-3R protein, the gene encoding EP364R protein, the gene encoding K145R protein or the gene encoding DP96R protein through a linker. For example, in an embodiment, the nucleotide sequence of the linker is shown in SEQ ID NO: 7. For example, in some embodiments of the present application, the nucleotide sequence of the fusion gene is selected from the following nucleotide sequences: a sequence shown in SEQ ID NO: 8, a sequence shown in SEQ ID NO: 9, a sequence shown in SEQ ID NO: 10, a sequence shown in SEQ ID NO: 11 and a sequence shown in SEQ ID NO: 12.
[0009] In an embodiment of the present application, the lactic acid bacteria is alanine racemase gene-deficient Lactobacillus plantarum NC8Δalr. In an embodiment of the present application, the lactic acid bacteria uses pSIP409-pgsA' vector as the expression vector.
[0010] In the second aspect of the present application, a method for constructing the lactic acid bacteria of the first aspect is provided, which comprises: linking the fusion gene with the expression vector to obtain a recombinant plasmid, and transforming the recombinant plasmid into the starting strain. For example, in an embodiment, Lactobacillus plantarum NC8 / Δalr is used as the exogenous antigen delivery vector, the asd-alr gene is used to replace the erythromycin gene as the marker gene on the anchoring expression plasmid pSIP409-pgsA', the positive recombinant bacteria are preliminarily screened by being transferred into the intermediate host E. coli χ6212, and the new functional Lactobacillus plantarum strain capable of expressing the exogenous protein is screened by being transferred into the deficient Lactobacillus plantarum NC8 / Δalr.
[0011] In a third aspect of the present application, a fusion gene is provided, which comprises: a gene encoding an OprI protein and at least one gene selected from the group consisting of a gene encoding a PP62 protein, a gene encoding a MGF505-3R protein, a gene encoding an EP364R protein, a gene encoding a K145R protein and a gene encoding a DP96R protein. In an embodiment of the present application, the nucleotide sequence of the gene encoding the OprI protein is shown as SEQ ID NO: 1; the nucleotide sequence of the gene encoding the PP62 protein is shown as SEQ ID NO: 2; the nucleotide sequence of the gene encoding the MGF505-3R protein is shown as SEQ ID NO: 3; the nucleotide sequence of the gene encoding the EP364R protein is shown as SEQ ID NO: 4; the nucleotide sequence of the gene encoding the K145R protein is shown as SEQ ID NO: 5; and the nucleotide sequence of the gene encoding the DP96R protein is shown as SEQ ID NO: 6.
[0012] In an embodiment of the present application, the fusion gene is obtained by fusing the gene encoding the OprI protein with the gene encoding the PP62 protein, the gene encoding the MGF505-3R protein, the gene encoding the EP364R protein, the gene encoding the K145R protein or the gene encoding the DP96R protein, respectively. In an embodiment of the present application, the fusion gene further comprises a gene encoding a His-tag. In an embodiment of the present application, the fusion gene further comprises a restriction enzyme recognition site sequence. For example, in an embodiment, the restriction enzyme is XbaI and / or HindIII, preferably both XbaI and HindIII. In an embodiment of the present application, the fusion gene further comprises a stop codon.
[0013] In an embodiment of the present application, the gene encoding the OprI protein in the fusion gene is connected to the gene encoding the PP62 protein, the gene encoding the MGF505-3R protein, the gene encoding the EP364R protein, the gene encoding the K145R protein or the gene encoding the DP96R protein through a linker. For example, in an embodiment, the nucleotide sequence of the linker is shown as SEQ ID NO: 7.
[0014] In an embodiment of the present application, the nucleotide sequence of the fusion gene is selected from the group consisting of: a sequence shown as SEQ ID NO: 8, a sequence shown as SEQ ID NO: 9, a sequence shown as SEQ ID NO: 10, a sequence shown as SEQ ID NO: 11 and a sequence shown as SEQ ID NO: 12.
[0015] In a fourth aspect of the present application, a fusion protein is provided, which is produced by the lactic acid bacteria of the first aspect above or encoded by the fusion gene of the third aspect above.
[0016] The present application also provides a method for obtaining the fusion protein of the fourth aspect above. In an embodiment of the present application, the method for obtaining the fusion protein comprises: constructing a fusion gene; inserting the fusion gene into an expression vector to form a recombinant expression vector; transforming the recombinant expression vector into a host cell selected from lactic acid bacteria, Escherichia coli or other microbial cells suitable for protein expression; culturing the transformed host cell to promote expression of the fusion gene and produce the fusion protein. In an embodiment of the present application, the method for obtaining the fusion protein further comprises collecting the fusion protein from the cultured host cell and purifying the fusion protein by affinity chromatography using His-tag to obtain the purified fusion protein.
[0017] In a fifth aspect of the present application, a composition comprising at least one lactic acid bacteria of the first aspect above or the fusion protein of the fourth aspect above is provided. In some embodiments of the present application, the composition is a bacterial agent, a pharmaceutical composition or a feed.
[0018] For example, in an embodiment of the present application, the composition comprises one lactic acid bacteria of the first aspect above, which has integrated therein a fusion gene obtained by fusing a gene encoding OprI protein with a gene encoding PP62 protein, a gene encoding MGF505-3R protein, a gene encoding EP364R protein, a gene encoding K145R protein and a gene encoding DP96R protein, respectively. For example, in an embodiment, the nucleotide sequence of the fusion gene is as set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12. For example, in an embodiment, the composition can comprise lactic acid bacteria integrated with any of the above-mentioned fusion genes or a combination of lactic acid bacteria integrated with the above-mentioned fusion genes, respectively, such as a combination of lactic acid bacteria integrated with the fusion genes as set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
[0019] In a sixth aspect of the present application, a vaccine is provided, which comprises at least one lactic acid bacteria as described in the first aspect above; or which uses lactic acid bacteria as a carrier and comprises the fusion gene as described in the third aspect above. In embodiments of the present application, the vaccine is a vector vaccine, in particular a live vector vaccine. In some embodiments of the present application, the live vector vaccine is administered orally. The subject of administration is an animal, in particular a pig.
[0020] For example, in an embodiment of the present application, the live vector vaccine comprises a lactic acid bacteria as described in the first aspect above, which has integrated therein a fusion gene, wherein the fusion gene is obtained by fusing a gene encoding OprI protein with a gene encoding PP62 protein, a gene encoding MGF505-3R protein, a gene encoding EP364R protein, a gene encoding K145R protein and a gene encoding DP96R protein, respectively. For example, in an embodiment, the nucleotide sequence of the fusion gene is as described in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12. For example, in an embodiment, the live vector vaccine can comprise a lactic acid bacteria having integrated therein any one of the above-mentioned fusion genes or a combination of lactic acid bacteria each having integrated therein one of the above-mentioned fusion genes. In an embodiment of the present application, the lactic acid bacteria is preferably Lactobacillus plantarum, in particular Lactobacillus plantarum NC8Δalr deficient in alanine racemase gene.
[0021] In a seventh aspect of the present application, the use of the lactic acid bacteria as described in the first aspect above or the fusion protein as described in the fourth aspect above or the composition as described in the fifth aspect above or the vaccine as described in the sixth aspect above in the preparation of a product for preventing and controlling African swine fever is provided. In some embodiments of the present application, the product is a bacterial agent, a pharmaceutical preparation or a feed, for example, the pharmaceutical preparation includes biological products, for example, vaccines.
[0022] In an eighth aspect of the present application, a method for preventing and controlling African swine fever is provided, which comprises administering to an animal susceptible to African swine fever, in particular a pig, an effective dose of the engineered bacteria as described in the first aspect above or the composition as described in the fifth aspect above or the vaccine as described in the sixth aspect above. The effective dose is sufficient to induce an immune response in the subject, thereby preventing and / or treating African swine fever. The method can be implemented by injection, oral administration or other suitable administration routes. The specific dose and administration frequency are determined by a veterinarian or a professional according to the health status, age, body weight and severity of the disease of the subject.
[0023] Compared with the prior art, the advantages of the present application include: the gene sequences encoding PP62 protein, MGF505-3R protein, EP364R protein, K145R protein and DP96R protein are respectively connected with the gene sequence encoding OprI protein, and lactic acid bacteria (especially Lactobacillus plantarum) integrated with the above gene sequences are constructed, and these Lactobacillus plantarum can express and produce specific ASFV fusion antigens which can be anchored on the surface of the strain. These lactic acid bacteria can be used as African swine fever vaccine in the form of oral administration for immunizing animals, can induce the activation of dendritic cells (DC) in Peyer's patch (PP), and start the protective immune response. The cellular immune response and humoral immune response in the spleen and mesenteric lymph nodes (MLN) are enhanced, the B cell activation and IgA antibody production in the PP are promoted, and the mucosal immune response is enhanced. At the same time, the level of antigen-specific IgG antibody in the serum is also increased, and the humoral immune response is enhanced. Among them, the production and promotion of mucosal immune response are particularly important for preventing pathogens transmitted through respiratory tract and digestive tract, and the bidirectional response of cellular immune and humoral immune and the production of specific antibodies can further enhance the overall defense against pathogens. In addition, the combined use of the lactic acid bacteria provided by the present application can produce combined immune effect, further improving the immune protection effect. In addition, the lactic acid bacteria of the present application has safety and environmental friendliness, and is selected by using non-antibiotic resistance marker, such as asd-alr fusion gene, which reduces the risk of spread of antibiotic resistance genes in the environment, and enhances the biosafety. BRIEF DESCRIPTION OF DRAWINGS
[0024] The accompanying drawings, which form a part of the present application, are used to provide further understanding of the present application, and the illustrative embodiments of the present application and their descriptions are used to explain the present application, and do not constitute improper limitations on the present application. Hereinafter, the embodiments of the present application will be described in detail with reference to the accompanying drawings, in which:
[0025] Figure 1 : Strain growth curve.
[0026] Figure 2: The left picture is the result of Western blot detecting the expression of the target protein of five new functional Lactobacillus plantarum strains. M: Protein marker 190KD; 1: NC8Δ-pSIP409-pgsA'; 2: NC8Δ-pSIP409-pgsA'-PP62; 3: NC8Δ-pSIP409-pgsA'-MGF505-3R; 4: NC8Δ-pSIP409-pgsA'-K145R; 5: NC8Δ-pSIP409-pgsA'-EP364R; 6: NC8Δ-pSIP409-pgsA'-DP96R. The right picture is the result of Western blot detecting the expression of the target protein in recombinant E. coli. M: Protein marker 170KD; 1: BL21-pET28a-K145R; 2: BL21-pET28a-EP364R; 3: BL21-pET28a-96R; 4: BL21-pET28a-PP62; 5: BL21-pET28a-MGF505-3R; 6: BL21-pET28a.
[0027] Figure 3 : Immunofluorescence verifies the protein expression of new functional Lactobacillus plantarum.
[0028] Figure 4 : The expression results of CD80 and CD86 of dendritic cells in the PP of mice in each group.
[0029] Figure 5 : The expression results of CD4 + T lymphocytes in the spleen.
[0030] Figure 6 : The expression results of CD8 + T lymphocytes in the spleen.
[0031] Figure 7 : The expression results of CD4 + T lymphocytes in the MLN.
[0032] Figure 8 : The expression results of CD8 + T lymphocytes in the MLN.
[0033] Figure 9 : The expression results of CD4 + T lymphocytes in the spleen.
[0034] Figure 10 : The expression results of CD4 + T lymphocytes in the MLN.
[0035] Figure 11 B220 cells in PP of each group of mice + IgA + Changes in cell number.
[0036] Figure 12 B220 cells in duodenum + IgA + Changes in cell number.
[0037] Figure 13 B220 cells in ileum + IgA + Changes in cell number.
[0038] Figure 14 Detection of specific IgA in feces of each group of mice
[0039] Figure 15 Detection of specific IgG in serum of each group of mice
[0040] Figure 16 Detection of IL-2 in serum of each group of mice
[0041] Figure 17 Detection of IFN-γ in serum of each group of mice
[0042] Figure 18 Detection of IL-4 in serum of each group of mice
[0043] Figure 19 qPCR detection of mRNA relative expression of IL-2 in spleen
[0044] Figure 20 qPCR detection of mRNA relative expression of IFN-γ in spleen
[0045] Figure 21 qPCR detection of mRNA relative expression of IL-4 in spleen DETAILED DESCRIPTION
[0046] The application will be further described in connection with the following specific examples. It should be understood that these examples are intended to illustrate the application and are not intended to limit the scope of the application. The experimental procedures in the following examples, unless otherwise indicated, were carried out in accordance with conventional procedures or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The materials used in the present application are commercially available and are used according to the manufacturer's instructions unless otherwise indicated. In addition, any method and material similar or equivalent to those described herein can be used in the practice of the present application. The particular methods and materials described herein are exemplary and are not intended to limit the scope of the application.
[0047] Example 1 Construction of new functional Lactobacillus plantarum expressing African swine fever virus fusion antigens
[0048] In this example, African swine fever virus PP62 protein, MGF505-3R protein, EP364R protein, K145R protein, DP96R protein were respectively fused with lipoprotein adjuvant OprI protein for expression, and a new functional Lactobacillus plantarum was constructed by using the non-antibiotic Lactobacillus plantarum to anchor and express foreign proteins on the surface.
[0049] The following plasmids, vectors and strains used in this example were from the Engineering Research Center of Animal Microecological Preparations, Jilin Agricultural University.
[0050] E. coli DH5α: pUC plasmid vector, plasmid cloning host. E. coli χ6212: asd gene-deficient E. coli χ6212, plasmid cloning host. NC8 / Δalr: alr gene-deficient Lactobacillus plantarum NC8, protein expression host. NC8Δ-pSIP409-pgsA': empty vector Lactobacillus plantarum strain carrying pSIP409 plasmid. BL21(DE3): E. coli strain, protein prokaryotic expression host. pLP-1261-asd-alr: non-antibiotic resistance plasmid.
[0051] Enzymes and main reagents: Prime STAR Max Premix (2x), restriction endonuclease (Xba I and Hind III), DL2000 DNA Marker, DL10000 DNA Marker, 10xLoading Buffer (Takara). DNA plasmid extraction kit, anti-His tag mouse monoclonal antibody, HRP labeled goat anti-mouse IgG, FITC labeled goat anti-mouse IgG (Beijing Kangwei Shijisheng Technology Co., Ltd.). Clon Express IIOne Step Cloning Kit (Vazyme). 5xSDS PAGE Loading Buffer, lysozyme, 50xTAE electrophoresis buffer, PBS phosphate buffer, anti-fluorescence quenching mounting medium (Beijing Solabio Technology Co., Ltd.). BeyoBlue TM Coomassie brilliant blue ultra-fast staining solution (Bi Yun Tian Biotechnology Co., Ltd.). SppIP inducing peptide and IPTG inducing peptide (Jilin Agricultural University Jilin Province Animal Microecological Preparation Engineering Research Center). Beef powder, yeast extract, tryptone, agar powder (UK OXOID Company). ECL chemiluminescence solution (34077), protein marker (Beijing TransGen Biotech). Other main reagents are imported products or domestic analytical pure products.
[0052] Instruments and manufacturers: inverted fluorescence microscope DMi8, full-automatic paraffin sectioning machine (RM2245) (Leica, Germany). Gradient PCR instrument, micropipette (Eppendorf, Germany). Low-temperature ultracentrifuge, full-automatic high-pressure sterilization pot GR85DA (Sigma, Germany). Gel imaging analysis system (Universal Hood II), vertical electrophoresis instrument (041BR 02682), electric breakdown instrument (Gene PμLser XcellTM System) (BIO-RAD, USA). Biochemical incubator (Heratherm IGS180), CO2incubator HERACELL 240i, real-time fluorescent quantitative PCR instrument (7500 Real Time PCR system) (Thermo Scientific, USA). AI600 chemiluminescence imaging system (GE, USA). Microplate spectrophotometer (Epoch 2) (BioTek, USA). Flow cytometer (BD LSRFortessa TMBD FACSCalibur (BD Biosciences, USA). Analytical balance ME204E (Mettler, Switzerland). Biosafety cabinet (Beijing Donglian Hale Instrument Manufacturing Co., Ltd.). General refrigerator and -80°C ultra-low temperature refrigerator (Haier). pH meter (Shanghai Yilian Scientific Instrument Co., Ltd.). Magnetic heating stirrer (Shanghai Meixiang Instrument Co., Ltd.). Electric heating constant-temperature water tank (Shanghai Jinghong Test Equipment Co., Ltd.). SCIENTZ-IID ultrasonic cell crusher (Ningbo Xinzhi Biological Technology Co., Ltd.). Metal bath (Hangzhou Bo Rijie Technology Co., Ltd.).
[0053] LB liquid medium: sodium chloride 20.0 g, tryptone 20.0 g, yeast extract 10.0 g, deionized water 2 L. Add to a beaker, completely dissolve, then divide the liquid into test tubes or conical flasks (if you want to configure solid medium, then add 1.5 g / mL of bacteriological agar powder), and then use the automatic high-pressure sterilization pot for sterilization treatment, the program is 121°C, 20 min. MRS liquid medium: beef protein powder 20 g, tryptone 20 g, yeast extract 10 g, D-anhydrous glucose 20 g, sodium acetate 10 g, diammonium citrate 4 g, potassium hydrogen phosphate 4 g, Tween-80 2 mL, magnesium sulfate heptahydrate 0.4 g, manganese sulfate monohydrate 0.1 g, deionized water 2 L. Add to a beaker, completely dissolve, then divide the liquid into test tubes or conical flasks (if you want to configure solid medium, then add 1.5 g / mL of bacteriological agar powder), and then use the automatic high-pressure sterilization pot for treatment, the sterilization program is 115°C 20 min.
[0054] 1% agarose gel: add 2 g of agarose and 0.2 L of 1×TAE buffer (diluted with deionized water from 50×TAE solution) to a triangular flask, heat it with a microwave oven to dissolve it, cool it at room temperature for 5 minutes, then add 10 μl of SuperGel Blue dye and mix well.
[0055] 20 mg / mL SppIP: SppIP powder 0.2 g, add deionized water 10.0 mL, mix well and dissolve, then filter with a 0.22 μm microporous filter to achieve sterilization, and then divide it into PCR tubes at 10 μL per tube, and store at -20°C.
[0056] 5×SDS-PAGE electrophoresis buffer: Tris 15.1 g, glycine 94.0 g, SDS 5.0 g, deionized water 1 L. Store at room temperature, and dilute it to 1×SDS-PAGE buffer before use.
[0057] Transfer solution: 1.45g Glycine, 2.9g Tris, 0.185g SDS were added to a beaker containing 0.3L of deionized water, stirred to dissolve, and then diluted to 0.4L, and then 0.2L of methanol solution was added and mixed, and stored at room temperature.
[0058] 10×TBS solution: 236g of sodium chloride, 72.6g of Tris were added to a beaker containing 2L of ddH2O, stirred to dissolve, and then the pH was measured, and adjusted to pH 7.6 by adding concentrated hydrochloric acid dropwise, and then diluted to 3L with ddH2O, and stored in a low-temperature storage box.
[0059] TBST solution: 1mL of Tween-20 was added to 100mL of 10×TBS solution, and deionized water was added to dilute 10×TBST to 1×TBST, and stored at 4°C.
[0060] Blocking buffer: 5g of skimmed milk powder was added to 100mL of TBST solution, and mixed, and stored in a 4°C refrigerator.
[0061] 80% glycerol: glycerol 80mL, deionized water 20mL, set the program of the autoclave to 121°C for 20min.
[0062] TES solution: lysozyme 10.6mg, sucrose 2.7g, RNAase A 32μL, 10×TE Buffer (pH 8.0) 8mL, ddH2O 7.2mL. Stored in a -20°C refrigerator.
[0063] Lysozyme solution (20mg / ml): 1g of lysozyme was dissolved in 50mL of deionized water, and stored at 4°C, and prepared as needed.
[0064] PBS phosphate buffer: 1 bag of PBS phosphate buffer powder, 1.6L of deionized water, stirred to completely dissolve, and then diluted to 2L, and set the program of the autoclave to 121°C for 20min. Stored at room temperature.
[0065] 1. Construction and identification of new functional lactobacillus plantarum
[0066] 1.1 Synthesis of target gene
[0067] The gene sequences encoding African swine fever virus proteins PP62, MGF505-3R, EP364R, K145R, DP96R and the gene sequence encoding adjuvant OprI protein are shown in SEQ ID NOs: 1-6, respectively. The five African swine fever virus proteins and the adjuvant OprI protein are connected by GGGGS-linker, respectively. The recombinant fusion gene is optimized according to the codon bias of lactic acid bacteria, and Xba I and Hind III restriction enzyme sites are added at the 5' end and 3' end, respectively. The recombinant fusion gene is synthesized by Nanjing Kingsriver Biotechnology Co., Ltd. and connected to the pUC-GW-Kan vector. The sequences of the recombinant fusion genes are shown in SEQ ID NOs: 8-12, respectively.
[0068] 1.1.1 Design primers: The correctness of the recombinant plasmid is determined by designing primers for five target fragments. Five sets of primers are mainly used for PCR identification and company sequencing (the primer synthesis and sequencing of this test are entrusted to Shanghai Sangon Biological Engineering Co., Ltd.). The primer names and sequences are as follows:
[0069] PP62-F: 5'-TCTAGAATGCCAAGTAACATGAAGC-3'; PP62-R: 5'-AAGCTTTTAATGATGATGATGATGATGTTTACGTGA-3'.
[0070] MGF-F: 5'-TCTAGAATGAGTTCAAGTTTACAAG-3'; MGF-R: 5'-AAGCTTTTAATGATGATGATGATGATGTTTCCGACT-3'.
[0071] EP-F: 5'-TCTAGAATGTACTTTTTAGTTGCTG-3'; EP-R: 5'-AAGCTTTTAATGATGATGATGATGATGCTTCCGTG-3'.
[0072] K145-F: 5'-TCTAGAATGGATCATTACTT-3'; K145-R: 5'-AAGCTTTTAATGATGATGATGATGATGTTTACG-3'.
[0073] DP-F: 5'-TCTAGAATGAGTACTCATGATTGTTC-3'; DP-R: 5'-AAGCTTTTAATGATGATGATGATGATGTTTACGTGATGC-3'.
[0074] 1.1.2 Acquisition of pSIP409-pgsA' (E) vector framework and target fragments: To construct recombinant plasmids pSIP409-pgsA'-PP62 (E), pSIP409-pgsA'-MGF505-3R (E), pSIP409-pgsA'-EP364R (E), pSIP409-pgsA'-K145R (E), pSIP409-pgsA'-DP96R (E), Primer 5.2 software was used to design seamless cloning primers for five groups of target fragments of pUC-PP62, pUC-MGF505-3R, pUC-EP364R, pUC-K145R, pUC-DP96R and the seamless cloning primers for the Xba I and Hind III end sequences of the pSIP409-pgsA' (E) vector. The names and sequences of the seamless cloning primers are shown in Table 1-1.
[0075] Table 1-1 Primer sequences
[0076]
[0077] Note: The homologous arm sequence is underlined.
[0078] Seamless cloning vector framework PCR amplification system: Prime STAR Max Premix (2x) 20.0 μL, pSIP409-pgsA'-(E) vector 1.0 μL, 9E-F 1.0 μL, 9E-R 1.0 μL, ddH2O 17.0 μL, a total of 40.0 μL. The amplification conditions of the pSIP409-pgsA' (E) vector framework were set on the gradient PCR instrument: 98°C pre-denaturation for 10 s, (98°C denaturation for 10 s, 56°C annealing for 5 s, 72°C extension for 40 s) x 30 cycles, 72°C extension for 5 min.
[0079] Seamless cloning target fragment PCR amplification system: Prime STAR Max Premix (2x) 20.0 μL, pUC-target fragment (5 plasmids) 1.0 μL, PP6-F / PM5-F / PE3-F / PK1-F / PD9-F 1.0 μL, PP6-R / PM5-R / PE3-R / PK1-R / PD9-R 1.0 μL, ddH2O 17.0 μL, a total of 40.0 μL.
[0080] The amplification conditions of the template pUC-PP62 were set on the gradient PCR instrument: 98°C pre-denaturation for 10 s, (98°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 60 s) x 30 cycles, 72°C extension for 7 min.
[0081] The PCR amplification conditions of template pUC-MGF505-3R were the same as those of template pUC-PP62, but the annealing temperature was changed to 58°C. The PCR amplification conditions of template pUC-EP364R were the same as those of template pUC-PP62, but the annealing temperature was changed to 61°C. The PCR amplification conditions of template pUC-K145R were the same as those of template pUC-PP62, but the annealing temperature was changed to 59°C. The PCR amplification conditions of template pUC-DP6R were the same as those of template pUC-PP62, and the annealing temperature was also the same.
[0082] 2 μL of the PCR product was mixed with 1 μL of 10×Loading buffer, and the band size was identified by electrophoresis (both the PCR results and the double enzyme digestion identification results were identified by 1% agarose gel electrophoresis).
[0083] 1.1.3 Seamless cloning to connect the pSIP409-pgsA'(E) vector framework and the target fragment: The concentration of the above-mentioned amplification product was determined by a microplate reader, and the vector framework and the target fragment were connected in the optimal system according to the instructions of the seamless cloning kit of Vazyme. The seamless cloning system: pSIP409-pgsA'(E) 3.0 μL, target fragment 4.0 μL, 5×CE II Buffer 2.0 μL, Express II 1.0 μL, a total of 10.0 μL. It was placed in a PCR instrument, and the connection temperature was set to 37°C, and the connection time was 30 min.
[0084] 1.1.4 Transformation of the connection product into E. coli DH5α: 1) Take the DH5α competent cells from the -80°C storage box, and place them on ice for 10 min to make them in an ice-water mixture state; 2) Mix 5 μl of the connection product with 100 μl of the DH5α competent cells in an ultraviolet sterilized clean bench, and place them on ice for 30 min; 3) Heat shock in a constant temperature water tank at 42°C for 1 min 30 s, and then immediately ice bath for 5 min; 4) Add 600 μL of LB liquid medium, and then place it in a 37°C shaking bed at 180 rpm / min for 1.5 h; 5) Centrifuge at 4000 rpm / min for 5 min, discard the supernatant, mix 200 μL of bacterial liquid with the bacterial pellet, and evenly plate it on LB solid medium with 10 μg / mL erythromycin; 6) Place it in a 37°C incubator and invert for 18 h; 7) Pick a single colony into LB liquid medium with 10 μg / mL erythromycin and culture for 16 h. 8) Store the bacterial strain: 600 μL of bacterial liquid and 400 μL of 80% glycerol in a bacterial strain storage tube and store it in a -80°C refrigerator.
[0085] 1.1.5 Identification of recombinant plasmid in E. coli DH5a: bacterial solution was used to extract plasmid with DNA plasmid extraction kit, as described in the instruction. Then the plasmid was identified by double enzyme digestion method with restriction endonuclease Xba I and Hind III, enzyme digestion system: pSIP409-pgsA'-target fragment (E) (five kinds of recombinant plasmids) 5.0 μL, Xba I 0.5 μL, Hind III 0.5 μL, 10×M buffer 1.0 μL, ddH2O 3.0 μL, a total of 10.0 μL. After enzyme digestion at 37°C for 2 h, the band size was identified by electrophoresis. The plasmid identified correctly by double enzyme digestion method was sent to Shengong Biotechnology Company for sequencing, and Snap Gene 4.3.6 software was used to make plasmid map.
[0086] 1.1.6 Acquisition of antibody-free carrier framework and asd-alr fragment: in order to construct antibody-free recombinant plasmids pSIP409-pgsA'-PP62(A), pSIP409-pgsA'-MGF505-3R(A), pSIP409-pgsA'-EP364R(A), pSIP409-pgsA'-K145R(A), pSIP409-pgsA'-DP96R(A), seamless cloning primers with target fragments in pSIP409-pgsA'-target fragment (E) (five kinds of recombinant plasmids) and seamless cloning primers of asd-alr fragment in pLP-1261-asd-alr carrier were designed. The names and sequences of the seamless cloning primers are shown in Tables 1-2.
[0087] Table 1-2 Primer sequences
[0088]
[0089] Note: The homologous arm sequence is underlined.
[0090] Seamless cloning of antibody-free carrier framework PCR system: Prime STAR Max Premix (2x) 20.0 μL, pSIP409-pgsA'-target fragment (E) (five kinds of recombinant plasmids) 1.0 μL, 409 pgsA'-F 1.0 μL, 409 pgsA'-R 1.0 μL, ddH2O 17.0 μL, a total of 40.0 μL. The PCR amplification conditions of the template are the same as those of the template pUC-PP62 in 1.1.2.
[0091] Seamless cloning asd-alr fragment PCR amplification system: Prime STAR Max Premix (2x) 20.0 μL, pLP-1261-asd-alr 1.0 μL, 409ata-F 1.0 μL, 409ata-R 1.0 μL, ddH2O 17.0 μL, a total of 40.0 μL. The PCR amplification conditions of the asd-alr fragment are the same as those of the pSIP409-pgsA'(E) vector framework in 1.1.2, and the annealing temperature is changed to 55°C. Mix 2 μL of PCR product with 1 μL of 10xLoading buffer and identify by electrophoresis.
[0092] 1.1.7 Seamless cloning of the connection of the asd-alr fragment and the vector framework without resistance: The concentration of the above amplification product is determined by the enzyme marker, and the connection is carried out by the seamless cloning kit of Vazyme company. The seamless cloning system: pSIP409-pgsA'-target fragment 3.0 μL / 2.0 μL, asd-alr fragment 4.0 μL / 5.0 μL, 5xCE II Buffer 2.0 μL, Express II 1.0 μL, a total of 10.0 μL.
[0093] The connection system of the asd-alr fragment and the vector framework without resistance carrying the target fragment PP62, MGF505-3R in the seamless cloning system is 3 μL and 4 μL, and the connection system of the asd-alr fragment and the vector framework without resistance carrying the target fragment EP364R, K145R, DP96R is 2 μL and 5 μL. Place it in the PCR instrument, set the connection temperature to 37°C, and the connection time is 30 min.
[0094] 1.1.8 Transformation of the connection product into E. coli χ6212 competent cells: The resistance-free connection product is transformed into E. coli χ6212 competent cells by electroporation.
[0095] a) Take the electroporation cup in 70% alcohol out of the clean bench, place it on the PE gloves, and sterilize it under UV light and dry it. Place it in the -20°C refrigerator for 10 min. b) Take the competent cells from the -80°C ultra-low temperature storage box, and place them on ice for 10 min to make them in an ice-water mixture state; c) In the clean bench, gently add 5 μl of the ligation product to 100 μl of E. coli χ6212 competent cells, mix gently, and transfer to the sterilized and pre-cooled electroporation cup, and place it on ice for 20 min. d) Use kitchen paper to wipe the moisture of the electroporation cup, and then place it in the electroporation instrument, and perform the electroporation according to the procedure (4→1→2 (2500V, 200Ω, 25 μF)). e) After the electroporation is completed, place it on ice for 6 min, and then add 700 μL of antibiotic-free LB liquid medium, mix, and then transfer it to a 2 ml EP tube, and seal it with a sealing film. f) Place it in a 37°C shaking bed at 220 rpm / min for 1 h; g) Centrifuge at 5000 rpm / min for 3 min, discard the supernatant, mix the bacterial liquid with the bacterial precipitate, and take 150 μL of the bacterial liquid to evenly spread on the antibiotic-free LB solid medium; h) Place it in a 37°C incubator for 16 h; i) Pick a single colony into 5 mL of liquid medium and culture for 16 h; j) The bacterial liquid needs to be preserved first, and then the plasmid is extracted.
[0096] 1.1.9 Identification of antibiotic-free recombinant plasmid in E. coli χ6212: The bacterial liquid is used to extract the plasmid by using the DNA plasmid extraction kit, and the details are described in the instruction manual. Then, PCR and double enzyme digestion techniques are used for identification.
[0097] 1.1.10 PCR identification: PCR amplification conditions of this template are the same as that of the template pUC-PP62 in 1.1.2, and the annealing temperature is changed to 58℃. The PCR product is verified by electrophoresis. PCR identification reaction system: PrimeSTAR Max Premix (2x) 25 μL, no-antibiotic recombinant plasmid 5 μL, PP62-F / MGF-F / EP-F / K145-F / DP-F 2.5 μL, PP62-R / MGF-R / EP-R / K145-R / DP-R 2.5 μL, ddH2O 15 μL, a total of 50 μL. 1.1.11 Double enzyme digestion identification: after 2h enzyme digestion at 37℃, the band size is identified by electrophoresis. The correct plasmid is identified by PCR and double enzyme digestion, sequenced by Shengong Biotechnology Co., Ltd., and the plasmid map is made by Snap Gene4.3.6 software. Enzyme digestion reaction system: pSIP409-pgsA'-target fragment (A) recombinant plasmid 4.0 μL, Xba I 0.5 μL, Hind III 0.5 μL, 10xM buffer 1.0 μL, ddH2O 4.0 μL, a total of 10.0 μL. 1.1.12 No-antibiotic recombinant plasmid is electroporated into NC8 / Δalr: the correct no-antibiotic recombinant plasmid is electroporated into NC8 / Δalr competent cells by electroporation method.
[0098] a) In the super-clean bench, take out the electric shock cup placed in 70% alcohol, put it on the PE glove, ultraviolet irradiation sterilization and dry. Put it in the-20℃ refrigerator for 10 min. b) Take out the NC8 / Δalr competent cells from the ultra-low temperature storage box, place it on ice for 10 min to make it in ice water mixture state; c) In the super-clean bench, gently add the correct recombinant plasmid to 50 μl NC8 / Δalr competent cells, mix gently, then transfer to the electric shock cup, and stand on ice for 5 min. d) Use kitchen paper to wipe the electric shock cup, then put it into the electric shock perforator, and follow the program (4→1→9 (2000V, 400Ω, 25 μF)) to perform electric transformation. e) After the electric transformation is completed, place it on ice for 5 min, add 600 μL of no-antibiotic MRS liquid medium and mix, then transfer it to a 2.0 mL centrifuge tube, add 150 μL of 5% sucrose solution, seal it with a sealing film, and place it in a 30℃ water bath for 2h. f) Place it in a 37℃ shaking incubator at 220 rpm / min for 1h. g) Centrifuge at 5000 rpm / min for 3 min, discard the supernatant, leave 200 μL of bacterial solution to mix the bacterial pellet, take 150 μL of bacterial solution and evenly plate it on no-antibiotic MRS solid medium. h) Place it in a 37℃ anaerobic workstation and invert culture for 22h. i) Pick single colonies into MRS liquid medium and place it in a 37℃ anaerobic incubator for 18h.
[0099] 1.1.13 Verification of the absence of antibodies in the NC8 / Δalr recombinant plasmid: Before extracting the plasmid in NC8 / Δalr, it is necessary to treat it with lysozyme: In a clean bench, pour the lactic acid bacteria liquid into a 2.0 mL EP tube, centrifuge at 12000 rpm / min for 1 min, discard the supernatant, and collect the bacterial cells. Add 200 μL of 50 mg / mL lysozyme, and incubate in a 37°C metal bath for 2 h. Centrifuge at 12000 rpm / min for 1 min, discard the supernatant, and collect the bacterial cells. The subsequent operation steps are carried out according to the plasmid extraction kit instructions. The extracted antibody-free plasmid is subjected to PCR identification. The PCR identification reaction system and amplification conditions are the same as those in 1.10.
[0100] 1.2 Optimization of the culture conditions of the new functional Lactobacillus plantarum
[0101] 1.2.1 Determination of the growth curve of Lactobacillus plantarum: Place the new functional Lactobacillus plantarum stored in the ultra-low temperature storage box on ice, and in a clean bench, add 100 μL of the bacterial liquid to 5 mL of MRS liquid medium, and incubate it in a 37°C anaerobic incubator overnight. The next day, transfer 100 μL of the overnight cultured bacterial liquid to 40 mL of MRS liquid medium, and incubate it in a 37°C anaerobic incubator. After 1 h, in a clean bench, take 2 mL of the bacterial liquid and measure the OD 600 value with a UV spectrophotometer. The OD 600 value is less than 0.2, and after half an hour, measure the OD 600 value again. The OD 600 value of the bacterial liquid is about 0.3, add 100 μL of SppIP inducing peptide, and incubate it in a 37°C anaerobic workstation. Every 1 h, take out 2 mL of the bacterial liquid to measure the OD 600 value, continuously monitor for 24 h, and use GraphPad Prism software to draw the growth curve.
[0102] 1.2.2 Plate colony counting: Gradient dilute the bacterial liquid in the logarithmic growth phase after induction in 1.2.1 to 10 6 , 10 7 , and 10 8 , respectively, and uniformly drop 100 μL of the bacterial liquid onto MRS solid medium for plate counting.
[0103] 1.2.3 Verification of the expression of the target protein of the new functional Lactobacillus plantarum: Detect whether the new functional Lactobacillus plantarum can express the expected protein through Western blotting.
[0104] 1.2.4 Processing Lactobacillus plantarum protein sample: a) Re-activate the new functional Lactobacillus plantarum strain in the ultra-low temperature storage box: take 100 μL of bacterial solution into MRS liquid medium, and cultivate in an anaerobic incubator at 37°C overnight; b) The next day, take 400 μL of bacterial solution and transfer into 40 mL of MRS liquid medium, cultivate in an anaerobic incubator at 37°C for 1.5 h (OD 600 = 0.2-0.3), add 100 μL of SppIp inducing peptide, and induce cultivation for 7 h (bacterial solution is in logarithmic growth phase); c) Take 4 mL of bacterial solution, centrifuge at 5000 rpm / min for 5 min, and discard the supernatant; d) Add 1 mL of TES solution to suspend the bacterial precipitate, and place in a 37°C water bath for 30 min; e) Centrifuge at 2500 g for 10 min, discard the TES solution, add 1 mL of PBS to suspend the precipitate; f) Centrifuge at 2500 g for 5 min, discard the PBS, resuspend with 500 μL of deionized water, and place in a -80°C refrigerator for repeated freezing and thawing for 5 times (6 min / time); g) Ultrasonic crushing under the condition of 60 W for 20 min; h) Centrifuge at 21000 g for 1 h at 4°C, discard the supernatant; i) Add 150 μL of PBS and 50 μL of 5x SDS PAGE Buffer to the bacterial precipitate, and resuspend; j) Boil in a water bath at 100°C for 10 min (to denature the protein), centrifuge at 12000 rpm / min for 1 min, and store the supernatant in a -20°C refrigerator.
[0105] 1.2.5 Western blot verification of the expression of the target protein: 1) Prepare 12% lower separation gel and 5% upper concentrated gel in a glass plate fixed on a gel making frame, insert the comb immediately after adding the upper concentrated gel (no bubbles can be allowed), place at room temperature for solidification, and store at 4°C after complete solidification (only 3-5 days can be stored); 2) Place it in an electrophoresis tank containing electrophoresis liquid, pull out the comb, and add 8 μL protein marker and 12 μL protein sample in the gel hole; 3) Run the upper gel at 80 V for 50 min, and run the lower gel at 120 V until the protein marker is completely dispersed and the bromophenol blue is about to reach the bottom of the electrophoresis tank; 4) Place it in a large plate containing transfer liquid to make a sandwich: black side down, then filter paper, gel, NC membrane, filter paper, and sponge pad in turn, roll out the bubbles between the gel and the NC membrane with a small roller, and do not touch the NC membrane during this period; 5) Place it in a tank containing transfer liquid according to the black side as the negative pole and the white side as the positive pole, place the tank in ice, and transfer at a constant current of 300 mA for 1.5 h; 6) Place the NC membrane in 5% skimmed milk powder, and seal it in a shaker at room temperature for 2 hours; 7) Discard the 5% skimmed milk powder, add the primary antibody (anti-His tag mouse monoclonal antibody, 1000-fold dilution), and incubate at 4°C overnight; 8) The next day, recover the primary antibody, wash three times with TBST for 5 min each time; 9) Add the secondary antibody (HRP-labeled goat anti-mouse IgG, 2000-fold dilution), and incubate at room temperature for 1.5 h; 10) Recover the secondary antibody, wash three times with TBST for 5 min each time; 11) Add color developing liquid to the NC membrane, and place it in an AI 600 imaging system for exposure.
[0106] 1.2.6 Immunofluorescence verification of the expression of the fusion protein: 1) Activate the new functional Lactobacillus plantarum strain in the ultra-low temperature storage box: take 100 μL of bacterial solution and transfer it to MRS liquid medium, and place it in a 37°C anaerobic workstation for overnight culture; 2) The next day, take 400 μL of bacterial solution and transfer it to 40 mL of MRS liquid medium, and culture at 37°C for 1.5 h (OD 600= 0.2~0.3), 100 μL SppIp inducing peptide was added, and the culture was induced for 7 h (the bacterial solution was in the logarithmic growth phase); 3) 500 μL of the bacterial solution was centrifuged at 12000 rpm / min for 1 min, the supernatant was discarded, and the bacterial pellet was resuspended in 1 mL of PBS, centrifuged again for 1 min, and the supernatant was discarded; 4) 1 mL of PBS (1% BSA) was added, and the solution was sealed in a 4°C refrigerator for 1 h, and then washed with PBS for 3 times; 5) the primary antibody was added, and the solution was incubated at 4°C overnight; 6) the solution was washed with 1 mL of PBS (0.2% Tween-20) for 3 times, and the bacterial pellet was collected; 7) the secondary antibody (goat anti-mouse IgG) labeled with FITC was incubated at room temperature for 2 h, and the process was performed in the dark; 8) the solution was centrifuged, the supernatant was discarded, and the bacterial pellet was washed with 1 mL of PBS (0.2% Tween-20) for 3 times; 9) the bacterial pellet was suspended in 100 μL of PBS, and then 10 μL of the bacterial solution was added dropwise to a glass slide, and the glass slide was baked with an alcohol lamp; 10) the anti-fluorescence quencher was added, and the solution was observed, photographed, and saved under an inverted fluorescence microscope.
[0107] 1.2.7 Construction and expression verification of the adjuvant bacteria NC8Δ-pSIP409-pgsA'-OprI
[0108] 1.2.7.1 Acquisition of pSIP409-pgsA'(A) without the adjuvant vector framework and OprI gene: five new functional L. plantarum strains constructed all have the gene of the adjuvant OprI protein, in order to construct the adjuvant recombinant plasmid pSIP409-pgsA'-OprI(A), the seamless cloning primer of the pSIP409-pgsA'(A) adjuvant vector framework and OprI gene fragment was designed by using the adjuvant recombinant plasmid pSIP409-pgsA'-PP62(A) in E. coli χ6212 as the template DNA, and was also synthesized by the Genechem Company. The names and sequences of the primers are shown in Tables 1-3.
[0109] Table 1-3 Primer sequences
[0110]
[0111] Note: The homologous arm sequence is underlined.
[0112] PCR amplification system of seamless cloning of antibody-free vector framework and OprI gene fragment: Prime STAR Max Premix (2x) 20.0 μL, pSIP409-pgsA'-PP62 (A) 1.0 μL, AA-F / AP-F 1.0 μL, AA-R / AP-R 1.0 μL, ddH2O 17.0 μL, a total of 40.0 μL. The PCR amplification conditions of the pSIP409-pgsA'(A) antibody-free vector framework are the same as those of the pSIP409-pgsA'(E) vector framework in 1.1.2, and the annealing temperature is changed to 60°C. The PCR amplification conditions of the OprI gene fragment are the same as those of the template pUC-PP62 in 1.1.2. The PCR product is identified by electrophoresis.
[0113] 1.2.7.2 Seamless cloning of pSIP409-pgsA'(A) antibody-free vector framework and OprI gene fragment: The concentration of the above amplification product is determined by a microplate reader, and the pSIP409-pgsA'(A) antibody-free vector framework and the OprI gene fragment are connected in the optimal system according to the instructions of the seamless cloning kit of Vazyme company, and the seamless cloning system: pSIP409-pgsA'(A) 2.0 μL, OprI gene fragment 5.0 μL, 5x CE II Buffer 2.0 μL, Express II 1.0 μL, a total of 10.0 μL. Place in a PCR instrument, set the connection temperature to 37°C, and the connection time is 30 min.
[0114] 1.2.7.3 Antibody-free recombinant plasmid pSIP409-pgsA'-OprI(A) is electroporated into E. coli χ6212 competent cells: the method steps are the same as 1.1.8.
[0115] 1.2.7.4 PCR identification of plasmid pSIP409-pgsA'-OprI(A) in E. coli χ6212: The plasmid is extracted by the DNA plasmid extraction kit, and then PCR identification is performed, and the PCR identification reaction system: Prime STAR Max Premix (2x) 25 μL, plasmid pSIP409-pgsA'-OprI(A) 5 μL, AP-F 2.5 μL, AP-R 2.5 μL, ddH2O 15 μL, a total of 50 μL. The PCR amplification conditions of the template are the same as those of the template pUC-PP62 in 1.1.2, and the annealing temperature is changed to 62°C. The PCR product is identified by electrophoresis. The correct plasmid is sent to GenScript Biotech Corporation for sequencing.
[0116] 1.2.7.5 Electroporation of the recombinant plasmid pSIP409-pgsA'-Oprl(A) into NC8 / Δalr: the method steps are the same as 1.1.12.
[0117] 1.2.7.6 PCR identification of the recombinant plasmid pSIP409-pgsA'-Oprl(A) of NC8 / Δalr: the steps of plasmid extraction are the same as 1.1.13. The reaction system and amplification conditions of PCR identification are the same as 1.2.7.4.
[0118] 1.2.7.7 Western blot detection of the expression of the target protein of Lactobacillus plantarum NC8Δ-pSIP409-pgsA'-Oprl: the method steps are the same as 1.2.4 and 1.2.5.
[0119] 1.2.8 Construction of recombinant E. coli BL21-pET28a-target fragment
[0120] 1..2.8.1 Acquisition of pET28a vector framework and target fragment: in order to construct the prokaryotic expression plasmids pET28a-PP62, pET28a-MGF505-3R, pET28a-EP364R, pET28a-K145R, pET28a-DP96R, five groups of seamless cloning primers of target fragments of pUC-PP62, pUC-MGF505-3R, pUC-EP364R, pUC-K145R, pUC-DP96R and two end sequence seamless cloning primers of pET28a expression vector BamH I and Hind III were designed. The names and sequences of the primers are shown in Tables 1-4.
[0121] Table 1-4 Primer sequences
[0122]
[0123] Note: the homologous arm sequence is underlined.
[0124] Amplification system of seamless cloning vector framework pET28a: Prime STAR Max Premix (2x) 20.0 μL, pET28a 1.0 μL, PET-F 1.0 μL, PET-R 1.0 μL, ddH2O 17.0 μL, a total of 40.0 μL.
[0125] The PCR amplification conditions of the template are the same as those of the template pUC-PP62 in 1.1.2. The amplification system of the target fragment: Prime STAR Max Premix (2x) 20.0 μL, pUC-target fragment (5 plasmids) 1.0 μL, ETP6-F / ETM5-F / ETE3-F / ETK1-F / ETD9-F 1.0 μL, ETP6-R / ETM5-R / ETE3-R / ETK1-R / ETD9-R 1.0 μL, ddH2O 17.0 μL, a total of 40.0 μL. The PCR amplification conditions of the template are the same as those of the template pUC-PP62 in 1.1.2, and the annealing temperature is changed to 65°C. Mix 2 μL of PCR product with 1 μL of 10xLoading buffer, and identify by electrophoresis.
[0126] 1..2.8.2 Seamless cloning of the pET28a vector framework and the target fragment: use the seamless cloning kit for ligation, the ligation system: pET28a 5.0 μL, target fragment 2.0 μL, 5xCE II Buffer 2.0 μL, Express II 1.0 μL, a total of 10.0 μL. Place in a PCR instrument, set the ligation temperature to 37°C, and the ligation time is 30 min.
[0127] 1.2.8.3 Transformation of the five prokaryotic expression plasmids pET28a-target fragments into DH5a for amplification: the steps are the same as 1.1.4 (replace the LB solid and liquid culture medium added with 10 μg / mL erythromycin with the LB solid and liquid culture medium added with 10 μg / mL kanamycin).
[0128] 1.2.8.4 Identification of recombinant prokaryotic expression plasmids in E. coli DH5a: use the high-purity plasmid extraction kit to extract the bacterial solution, and then identify by PCR method.
[0129] 1.2.8.5 Transformation of the five recombinant prokaryotic expression plasmids into BL21 competent: the steps are the same as 1.1.4 (replace the LB solid and liquid culture medium added with 10 μg / mL erythromycin with the LB solid and liquid culture medium added with 10 μg / mL kanamycin; replace the DH5a competent with the BL21 competent).
[0130] 1.2.8.6 Purification of protein: five strains of bacteria were induced under the optimal induction conditions, and then the bacterial solution was transferred to a 50 mL centrifuge tube and centrifuged at 10000 g in a 4°C horizontal centrifuge for 15 min. The supernatant was discarded, washed once with PBS, and then suspended with PBS. Then it was repeatedly frozen and thawed with liquid nitrogen for three times, and then ultrasonically broken (150 W ultrasonic for 40 min). The supernatant was centrifuged at 12000 rpm for 10 min at 4°C, and stored at 4°C for standby use. The bacterial pellet was resuspended with Equp Buffer and refrigerated at 4°C overnight. The next day, it was centrifuged at 12000 rpm for 25 min in a 4°C horizontal centrifuge, and the supernatant was collected and filtered with a 0.22 μm filter. Then the supernatant was purified by column. Eluted repeatedly 5 times with Wash Buffer to remove impurities, and then added Elution Buffer to elute repeatedly 10 times to obtain the target protein. The protein sample was treated and the western blot verification steps were the same as 1.2.4 and 1.2.5.
[0131] 1.3 Results
[0132] 1.3.1 Construction and identification of new functional Lactobacillus plantarum
[0133] 1.3.1.1 PCR amplification results of pSIP409-pgsA'(E) vector framework and target fragments
[0134] Using the five synthesized plasmids and pSIP409-pgsA'(E) vector as templates, the corresponding seamless cloning primers were amplified, and the PCR products were identified by agarose gel electrophoresis. The vector fragment sequence band was visible at 6161 bp, and the five target fragment sequence bands were visible at 1881 bp, 1131 bp, 1398 bp, 730 bp and 579 bp.
[0135] 1.3.1.2 Double enzyme digestion identification and plasmid sequencing results of recombinant plasmids pSIP409-pgsA'-PP62(E), pSIP409-pgsA'-MGF505-3R(E), pSIP409-pgsA'-EP364R(E), pSIP409-pgsA'-K145R(E), pSIP409-pgsA'-DP96R(E)
[0136] The recombinant plasmids connected by seamless cloning were digested with Xba I and Hind III restriction endonucleases, and the results showed that the target bands were visible at 1881 bp, 1131 bp, 1398 bp, 730 bp and 579 bp. And the correct recombinant plasmid was verified by double enzyme digestion, and the sequencing result was also correct.
[0137] 1.3.1.3 PCR amplification results of asd-alr fragment and vector framework without antibody
[0138] The five recombinant plasmids and pLP-1261-asd-alr vector were used as templates, and the corresponding seamless cloning primers were used for amplification. The results showed that the asd-alr fragment band was at 4000 bp, and the five bands with the target fragment were at 6774 bp, 6024 bp, 6291 bp, 5619 bp and 5472 bp.
[0139] 1.3.1.4 Verification of the anti-recombinant plasmid in E. coli χ6212
[0140] 1.3.1.4.1 PCR identification
[0141] The anti-recombinant plasmid in E. coli χ6212 was identified by PCR method, and five clear target fragment bands of 1881 bp, 1131 bp, 1398 bp, 730 bp and 579 bp were visible.
[0142] 1.3.1.4.2 Double enzyme digestion identification and plasmid sequencing
[0143] The anti-recombinant plasmid verified by PCR was further verified by double enzyme digestion. The anti-vector band was visible at 8127 bp, and the target bands were visible at 1881 bp, 1131 bp, 1398 bp, 730 bp and 579 bp. The anti-recombinant plasmid verified by PCR and double enzyme digestion was also correct, and the plasmid sequencing result was correct.
[0144] 1.3.1.5 PCR identification of anti-recombinant plasmid in Lactobacillus plantarum NC8 / Δalr
[0145] The anti-recombinant plasmid in Lactobacillus plantarum NC8 / Δalr was identified by PCR method to determine its successful transfer into NC8 / Δalr. The results showed that five clear target fragment bands were visible at 1881 bp, 1131 bp, 1398 bp, 730 bp and 579 bp.
[0146] 1.3.2 Optimization of culture conditions for new functional Lactobacillus plantarum
[0147] The growth curves of the five successfully constructed new functional Lactobacillus plantarum were determined and the plate colony count was determined. The growth curve determination results of NC8Δ-pSIP409-pgsA'-PP62, NC8Δ-pSIP409-pgsA'-MGF505-3R, NC8Δ-pSIP409-pgsA'-EP364R, NC8Δ-pSIP409-pgsA'-K145R and NC8Δ-pSIP409-pgsA'-DP96R were drawn by GraphPad Prism software, as shown inFigure 1 The best induction time is 1.5h after the culture of the bacteria, and the best feeding time is 7h after the induction (8.5h after the culture of the bacteria). Figure 1
[0148] 1.3.3 Verification of the expression of the target protein of the new functional Lactobacillus plantarum
[0149] 1.3.3.1 Verification of the expression of the target protein by Western blot: the new functional Lactobacillus plantarum was treated by repeated freeze-thawing and ultrasonic crushing, and was detected by Western blot. Clear protein bands were observed at 68.8KDa, 41.3KDa, 26.5KDa, 51.1KDa and 21.2KDa (left). Figure 2
[0150] 1.3.3.2 Verification of the expression of the target protein by immunofluorescence: the five constructed new functional Lactobacillus plantarum were treated, the primary antibody was anti-His tag mouse monoclonal antibody, and the secondary antibody combined therewith was FITC-labeled goat anti-mouse IgG. The empty vector strain was used as a control, and the results are shown in Figure 3
[0151] 1.3.4 Construction of the adjuvant bacteria NC8Δ-pSIP409-pgsA'-OprI and verification of the expression of the target protein
[0152] 1.3.4.1 PCR acquisition of the pSIP409-pgsA'(A) without the vector framework and the OprI gene: the pSIP409-pgsA'-PP62(A) was used as a template, and PCR amplification was performed with seamless cloning primers. The electrophoresis detection results show that a vector fragment band is visible at 8127bp, and an OprI gene fragment band is visible at 312bp.
[0153] 1.3.4.2 PCR identification of the plasmid pSIP409-pgsA'-OprI(A) in E. coli χ6212: the plasmid pSIP409-pgsA'-OprI(A) in E. coli χ6212 was identified by PCR, and an OprI gene fragment band was visible at 312bp.
[0154] 1.3.4.3 PCR identification of the recombinant plasmid pSIP409-pgsA'-OprI(A) of NC8 / Δalr: the recombinant plasmid pSIP409-pgsA'-OprI(A) of NC8 / Δalr was identified by PCR, and an OprI gene fragment band was visible at 312bp.
[0155] 1.3.4.4 Western blot detection of the expression of the target protein of Lactobacillus plantarum NC8Δ-pSIP409-pgsA'-Oprl: Western blot was used to detect the expression of the Oprl protein of Lactobacillus plantarum NC8Δ-pSIP409-pgsA'-Oprl, and a clear protein band was observed at 10.5 KDa.
[0156] 1.3.5 Construction of recombinant E. coli BL21-pET28a-target fragment
[0157] 1.3.5.1 PCR amplification results of pET28a vector framework and target fragment: Using pUC-PP62, pUC-MGF505-3R, pUC-EP364R, pUC-K145R, pUC-DP96R plasmids and pET28a expression vector as templates, amplification was performed using seamless cloning primers. Through electrophoresis detection, a 5344 bp vector fragment band and five target fragment sequence bands of 1596 bp, 846 bp, 1113 bp, 441 bp and 294 bp were observed.
[0158] 13.5.2 PCR identification of recombinant prokaryotic expression plasmid in E. coli DH5a: The recombinant prokaryotic expression plasmid in E. coli DH5a was identified by PCR method, and five clear target fragment bands of 1596 bp, 8406 bp, 1113 bp, 441 bp and 294 bp were observed.
[0159] 1.3.5.3 Expression verification of purified target protein: Five groups of recombinant E. coli were induced by IPTG, the target protein was purified and the protein sample was treated, and western blot technology was used for detection. Clear protein bands were observed at 18.8 KDa, 47.5 KDa, 12.5 KDa, 68.1 KDa and 36.1 KDa (right). Figure 2
[0160] 1.4 Summary: This example successfully constructed five strains of recombinant protein expressing ASFV proteins PP62, MGF505-3R, EP364R, K145R, DP96R fused with bacterial lipoprotein OprI in new functional Lactobacillus plantarum (NC8Δ-pSIP409-pgsA'-PP62, NCΔ-pSIP409-pgsA'-MGF505-3R, NC8Δ-pSIP409-pgsA'-EP364R, NC8Δ-pSIP409-pgsA'-K145R, NC8Δ-pSIP409-pgsA'-DP96R), and determined the expression of the corresponding target proteins on the surface of Lactobacillus plantarum by Western blot and immunofluorescence techniques. The adjuvant bacteria NC8Δ-pSIP409-pgsA'-OprI were successfully constructed and the expression of OprI protein was verified. The PP62 protein, MGF505-3R protein, EP364R protein, K145R protein and DP96R protein were successfully purified, which prepared for the animal experiment in Example 2.
[0161] Example 2 Immune effect of new functional Lactobacillus plantarum
[0162] In this example, BLAB / c mice were orally immunized with the successfully constructed new functional Lactobacillus plantarum, and the changes in immune indicators of the mice were detected by flow cytometry, ELISA, immunofluorescence and other techniques, so as to study the immune effect of the new functional Lactobacillus plantarum.
[0163] 2.1 Materials and methods
[0164] Experimental strains: Five strains of new functional Lactobacillus plantarum (NC8Δ-pSIP409-pgsA'-PP62, NCΔ-pSIP409-pgsA'-MGF505-3R, NC8Δ-pSIP409-pgsA'-EP364R, NC8Δ-pSIP409-pgsA'-K145R, NC8Δ-pSIP409-pgsA'-DP96R) were constructed in Chapter 1. The empty vector Lb. plantarum NC8Δ-pSIP409-pgsA' was preserved in the laboratory.
[0165] Experimental animals: 81 SPF female BLAB / c mice of 4 weeks old were purchased from Beijing Huafukang Biotechnology Co., Ltd. and were immunized after adapting to the environment in the animal base of Jilin Agricultural University for one week.
[0166] Main reagents: 200 mesh copper mesh and nylon mesh were provided by Solarbio (Beijing); red blood cell lysis solution, sodium citrate antigen repair solution, DAPI staining solution, goat serum, triton X-100, anti-quenching mounting agent, protease inhibitor (PMSF) were provided by Biyun Tian Biotechnology Co., Ltd.; 4% paraformaldehyde fixing solution and RPMI-1640 medium were provided by Biosharp (Beijing); OprI protein polypeptide (sequence: ADEAYRKADEALGAAQK) was synthesized by Sangon Biotech (Shanghai); flow cytometry antibodies were preserved in the laboratory, and other reagents were the same as in Example 1.
[0167] Experimental instruments: the same as in Example 1.
[0168] 2.2 Method
[0169] 2.2.1 Experimental scheme
[0170] Experimental animal grouping: the mice were randomly divided into 9 groups, namely PBS group, empty vector group, adjuvant group, PP62 group, MGF505-3R group, EP364R group, K145R group, DP96R group and mixed bacteria group, 9 mice in each group. The specific experimental grouping is shown in Table 2-1.
[0171] Table 2-1 Animal immunization and grouping scheme
[0172]
[0173] Immunization procedure: primary immunization was performed on days 1, 2 and 3, with a seven-day interval; booster immunization was performed on days 11, 12 and 13, with a seven-day interval; flow cytometry detection was performed on day 20, and the third immunization was performed on days 21, 22 and 23. Blood and feces of mice were collected on the seventh day after the initial immunization and for 3 consecutive days after each immunization. The collected blood was placed in a 4°C refrigerator for 2h, centrifuged at 4°C 4000rpm / min for 20min, and the serum was absorbed into a PCR tube and stored at -80°C. The mouse feces were weighed, 3mL PMSF solution (diluted 100 times with PBS) was added per 1g of feces, incubated at 4°C for 2h, centrifuged at 4°C 4000rpm / min for 20min, and the supernatant was taken into a PCR tube and stored in a -80°C refrigerator.
[0174] 2.2 Flow cytometry
[0175] Tissue collection: 5 mice in each group were eye bled and decapitated, and the spleen, Peyer's patch lymph nodes (PP) and mesenteric lymph nodes (MLN) of the mice were taken out in a clean bench.
[0176] Ice grinding: Put it into a cell culture dish with 200 mesh copper mesh, add 700 μL complete medium, and gently grind the spleen, PP, and MLN with a 1 mL syringe tail. After the tissue is ground, 700 μL of complete medium is used to rinse the copper mesh, and then the cell suspension in the cell culture dish is transferred to a 2 mL centrifuge tube, which is placed in a 4°C horizontal centrifuge, and the speed is adjusted to 2000 rpm for 5 min. After centrifugation, the supernatant is gently aspirated. PP and MLN cells are washed once with PBS, and then 1 mL of complete medium is added to suspend the cell stock solution. Spleen cells need to remove red blood cells.
[0177] Spleen red cell lysis: Add 500 μL of red blood cell lysis solution to the centrifuged spleen cell solution and mix well, lyse for 3 min on ice, and centrifuge again in a 4°C horizontal centrifuge for 5 min. If the amount of spleen cells is too large, it can be lysed again. Add 500 μL of PBS and place it on ice for 2 min to terminate the lysis reaction. Centrifuge for 5 min in a 4°C horizontal centrifuge. Wash once with PBS, then add 1 mL of complete medium to suspend the cell stock solution.
[0178] Counting: Dilute the spleen cell stock solution 100 times with PBS, dilute the MLN cell stock solution 50 times with PBS, and dilute the PP cell stock solution with the original solution because the number of cells is small. Count the diluted spleen cell solution, MLN cell solution, and PP cell stock solution with a cell counting plate, calculate the original solution concentration by the number of cells, and calculate how much volume of cell stock solution is needed for 1.0 x 10 7 cells. Take the corresponding volume of cell stock solution into a 2 mL centrifuge tube, add 4°C pre-cooled PBS for washing once, and mix 200 μL of the remaining solution to prepare a cell suspension, which is stored at 4°C for subsequent experiments.
[0179] Dilute the antibody: Dilute the antibody with PBS on ice and in a tin foil light-proof condition. The antibody name and dilution ratio are shown in Table 2-2.
[0180] Table 2-2 Antibody Dilution
[0181]
[0182] Dendritic cell staining in PP: Mix the three kinds of diluted CD11c, CD80, and CD86 antibodies together, add 30 μL of the mixed antibody to the prepared 200 μL cell suspension, mix well, incubate in a 4°C refrigerator for 25 min in the dark, centrifuge, wash once with PBS, mix with 250 μL of PBS, filter through a nylon screen into a flow tube, and detect with a BD flow cytometer.
[0183] T cell staining of spleen and MLN: The cell suspension of treated spleen and MLN was placed in a 48-well cell culture plate, and 300 μL of complete medium, 2 μL of stimulant PMA (final concentration 40 ng / ml, and prepared immediately before use), 1 μL of blocking agent, and 1 μL of purified corresponding antigen protein (final concentration 4 ug / mL) (antigen protein of each group see Table 2-3) were added. Incubate in a 37°C cell incubator for 5 hours, take out and place on ice, mix the cells and aspirate into a 1.5 EP tube, wash once with 1 mL of 1% BSA PBS, leave 100 μL, add 30 μL of diluted mixed CD3 CD4 CD8 antibody, wash once with pre-cooled 1 mL of 1% BSA PBS, add 200 μL of formaldehyde fixing solution, and fix in a 4°C refrigerator for 20 min in the dark, wash once with 800 μL of membrane permeation solution (diluted 1:9 with Wahaha), mix with 1 mL of membrane permeation solution, incubate in the dark for 3 min, centrifuge and discard the supernatant, leave 200 μL. Add 20 μL of diluted mixed IL-4 and IFN-γ antibody, incubate at 4°C in the dark for 20 min. Wash once with PBS, and finally mix with 250 μL of PBS, filter, and detect on the machine.
[0184] PP surface (germinal center) antibody staining: Add 10 μL of B220 antibody to the prepared 200 μL cell suspension and mix well, incubate in a low-temperature storage box in the dark for 25 min, wash once with PBS containing 1% BSA, add 200 μL of formaldehyde fixing solution, and fix again in a low-temperature storage box in the dark for 25 min, wash once with 800 μL of membrane permeation solution (diluted 1:9 with Wahaha), mix with 1 mL of membrane permeation solution, incubate at room temperature in the dark for 3 min, centrifuge and discard the supernatant, leave 150 μL, add IgA antibody, incubate at 4°C in the dark for 25 min. After centrifugation for 5 min, wash once with PBS, and finally mix with 250 μL of PBS, filter, and detect with a BD flow cytometer.
[0185] Data processing and analysis: Flow data were analyzed using FlowJo_v10.6.2 software, and GraphPad Prism 8.0.2 was used for plotting and statistical data. One-way ANOVA was used for statistical analysis of differences between groups (*, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).
[0186] Table 2-3 Antigen protein of each group
[0187]
[0188]
[0189] 2.3 Immunofluorescence: The number of B cells in the duodenum and ileum of mice was detected by immunofluorescence.
[0190] 2.3.1 Treatment of intestinal tissue: After the mice were sacrificed, the duodenum and ileum of each group of mice were taken out and fixed in 4% paraformaldehyde for 5 days on the experimental bench. The tissue was taken out in a fume hood, and the duodenum and ileum were both taken in a ring and trimmed flat. The trimmed tissue was placed in an embedding box and dehydrated in an alcohol gradient: 70% anhydrous ethanol (2 h)→80% anhydrous ethanol (2 h)→85% anhydrous ethanol (overnight)→90% anhydrous ethanol (2 h)→95% anhydrous ethanol I (1.5 h)→95% anhydrous ethanol II (1.5 h)→100% anhydrous ethanol I (1 h)→100% anhydrous ethanol II (1 h), and each dehydration needed to be dried on newspaper. Xylene was used for transparency: complete immersion in xylene I and xylene II for 1 minute, and the transparent gel was observed. Wax I, wax II, and wax III were placed in a 58°C water bath in advance to completely melt. The transparent tissue was placed in wax I, wax II, and wax III for 40 minutes in turn. After the wax immersion was completed, the tissue was placed in an embedding machine preheated in advance to stand and embed. The tissue was sectioned using a full-automatic paraffin microtome, with a section thickness of 2.5 μm. The section was placed in deionized water at 42°C to completely unfold, and then a polylysine treatment was used to adhere the glass slide and was taken out and placed on a glass slide staining rack. The section was baked in an oven at 60°C for 2 h.
[0191] 2.3.2 Immunofluorescence staining: 1) Preparation before experiment: sodium citrate antigen retrieval solution (50x) is diluted with deionized water to sodium citrate antigen retrieval solution (1x), stored at 4°C, and prepared in advance, not reusable; Antibody (lightproof): the optimal dilution of the antibody is explored in advance, and the diluted antibody needs to be centrifuged at 5000 rpm / min for 5 min before use; Preparation of blocking solution: dilute 5% goat serum and 0.3% Triton-100 with PBS under lightproof conditions; DAPI is diluted 1000 times with PBS, and stored at 4°C in the dark. 2) De-waxing: place the baked sections in xylene I, xylene II, anhydrous ethanol I, anhydrous ethanol II, 90% anhydrous ethanol I, 90% anhydrous ethanol II, 70% anhydrous ethanol, and distilled water for 7 min, 5 min, 5 min, 5 min, 5 min, and 2 times, respectively. 3) Antigen repair: place the sections in a staining jar containing antigen repair solution (1x), heat them in boiling water at 100°C for about 20 min, then place the staining jar in cold water for 10 min, and wash with PBS for 2 times, 4 min each time. 4) Blocking: start blocking in the dark until the end of mounting. Dry the water with kitchen paper, and circle the tissue with an immunohistochemical pen without damaging the tissue. Cover the tissue completely with the blocking solution, and incubate for 60 min. Discard the blocking solution, and dry the liquid with kitchen paper. 5) B cell staining: add 50 μL of 200-fold diluted B220 and IgA to cover the tissue, and incubate in a wet box at 4°C overnight. Wash with PBS for 5 min, 2 times (recover the antibody before washing). 6) Nucleus staining: add 50 μL of DAPI, and incubate in the dark for 10 min. Wash with PBS for 2 times, 6 min each time. 7) Mounting: mount with anti-fluorescence quenching mounting agent, and observe under a microscope as soon as possible after mounting, or store at 4°C.
[0192] 2.3.3 ELISA detection of SIgA: The supernatant of the feces of the treated mice is subjected to specific SIgA detection.
[0193] Coating: dilute the target antigen protein to 2 μg / mL with the coating solution, and spread it in a 96-well ELISA plate (the antigen proteins of each group are shown in Tables 2-3), 100 μL per well, and store in a 4°C refrigerator overnight. Washing: wash three times with 200 μL of PBST (PBS with 0.05% Tween-20), and shake for 5 min each time. Blocking: add 100 μL of PBS (containing 1% BSA), and block in a 37°C incubator for 2 h. Washing: add 200 μL of PBST, shake for 5 min, and repeat three times.
[0194] Add the sample to be detected: dilute the mouse fecal supernatant 50 times with PBS, 100 μL / well, three repeats. Incubate in a 37°C incubator for 2 h, and wash. Add secondary antibody: add 2000-fold diluted HRP-labeled goat anti-mouse IgG, 100 μL / well, incubate at 37°C for 60 min, and wash with PBST for 3 times. Color development: add 100 μL TMB color developing solution, 37°C, avoid light for 15 min, and observe the color of the solution. Stop: add 50 μL of 20% H2SO4 to stop the color development reaction. Detect with a microplate reader, set conditions: wavelength 450 nm, shake plate for 30 s. Save the data and analyze.
[0195] Data analysis: use GraphPad Prism 8.0.2 to plot, and use Two-way ANOVA to analyze the differences between each experimental group and the empty group at each time point (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).
[0196] 2.3.4 ELISA detection of specific IgG levels in mouse serum: detect the content of specific IgG in serum samples. The method is the same as 2.3.3, but the dilution factor of the antibody is different. Dilute the serum sample 100 times, and dilute the HPR-labeled goat anti-mouse IgG H&L 1000 times.
[0197] 2.3.5 ELISA detection of IL-2, IFN-γ, IL-4 levels in serum: use ELISA kit to detect the content of cytokines IL-2, IL-4, IFN-γ in mouse serum.
[0198] 2.3.6 Fluorescence quantitative PCR (qPCR)
[0199] 2.3.6.1 Trizol method for extracting total RNA from tissues: 1) Add 1 mL of Trizol reagent and 100 mg of spleen tissue or mesenteric tissue to a 2 mL centrifuge tube, and use a tissue homogenizer to grind. 2) Absorb the supernatant into a new centrifuge tube, mix with 200 μL of chloroform, and stand for 5 minutes, then centrifuge at 4°C 13000g for 20 min, and transfer the supernatant to an enzyme-free tube. 3) Add 500 μL of pre-cooled isopropanol, mix well, and stand in a 4°C refrigerator for 15 minutes. Centrifuge at 4°C 10000g for 20 min, and discard the supernatant. 4) Resuspend with 1 mL of 75% ethanol, centrifuge at 4°C 8500g for 10 min, and discard the supernatant. 5) Stand at room temperature for 5 minutes, add 30 μL of enzyme-free water to dissolve, and store at -80°C.
[0200] 2.3.6.2 Reverse transcription reaction: remove genomic DNA and reverse transcribe RNA to cDNA by reverse transcription kit. See instructions for specific steps. Store the cDNA product in a -20°C refrigerator, and use within six months.
[0201] 2.3.6.3 Design primers: Query the sequence of mouse IL-2, IL-4, IFN-γ through NCBI, and design qPCR primers through Primer 5 software.
[0202] IL-2: Forward: GCAGCAGCAGCAGCAGCAG; Reverse: GCCGCAGAGGTCCAAGTTCATC.
[0203] IL-4: Forward: GGACGCCATGCACGGAGATG; Reverse: GAAGCACCTTGGAAGCCCTACAG.
[0204] IFN-γ: Forward: AAACCTTGTACTTCTGACGGCTGAG; Reverse: CGAGTCCTGGCTGGTCTGTGAG.
[0205] ACT-β: Forward: CTACCTCATGAAGATCCTGACC; Reverse: CACAGCTTCTCTTTGATGTCAC.
[0206] 2.3.6.4 Fluorescent quantitative PCR: Detect the transcription level of IL-2, IL-4, IFN-γ in the spleen through fluorescent quantitative PCR method. qPCR reaction system: 2x Universal SYBR qPCR mix 10 μL, IL-2-F / IL-4-F / IFN-γ-F / ACT-β-F 0.8 μL, IL-2-R / IL-4-R / IFN-γ-R / ACT-β-R 0.8 μL, cDNA template 2 μL, ROX Reference Dye 0.4 μL, RNase-Free ddH2O 6 μL, total 20 μL. Place in fluorescent quantitative PCR instrument, reaction condition is: 95℃, 60s; (95℃, 10s; 60℃, 34s) x 40 cycle. Wait for the program to run and save the data. Apply GraphPad Prism 8.0.2 to plot and statistical data, use One-way ANOVA statistics between groups (*, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).
[0207] 2.4.1 Flow cytometry detection results
[0208] 2.4.1.1 Effect of immunization with new functional Lactobacillus plantarum on DC cells in mouse PP
[0209] To evaluate the effect of the successfully constructed new functional Lactobacillus plantarum on the dendritic cells of mice, the expression of CD80 and CD86 on the surface of dendritic cells in PP was detected by flow cytometry. The results are shown in Table 2 and Table 3. Figure 4 The results show that the expression of CD80 in dendritic cells in the PP62 group, the MGF505-3R group, the EP364R group, the K145R group, the DP96R group and the PBS control group was extremely significantly increased (P<0.01) compared with the PBS control group. The expression of CD80 in dendritic cells in the mixed bacteria group was extremely significantly increased (P<0.001) compared with the PBS control group. The expression of CD86 in dendritic cells in the PP62 group, the MGF505-3R group, the EP364R group, the K145R group and the DP96R group was extremely significantly increased (P<0.01) compared with the PBS control group. The expression of CD86 in dendritic cells in the mixed bacteria group was extremely significantly increased (P<0.001) compared with the PBS control group.
[0210] 2.4.1.2 Effect of immunization with new functional Lactobacillus plantarum on the expression of IFN-γ in CD4 + and CD8 + T lymphocytes in the spleen of mice
[0211] To detect whether the new functional Lactobacillus plantarum can cause a cellular immune response in mice, the expression of IFN-γ in CD4 + T lymphocytes in the spleen of mice was detected. The results are shown in Table 4 and Table 5. Figure 5 The results show that the content of IFN-γ expressed in CD4 + T lymphocytes in the PP62 group, the MGF505-3R group, the EP364R group and the K145R group was significantly different (P<0.05) compared with the PBS group. The content of IFN-γ expressed in CD4 + T lymphocytes in the DP96R group was extremely significantly different (P<0.01) compared with the PBS group. The content of IFN-γ expressed in CD4 + T lymphocytes in the mixed bacteria group was extremely significantly different (P<0.001) compared with the PBS group.
[0212] The expression of IFN-γ in CD8 + T lymphocytes in the spleen of mice was detected. The results are shown in Table 6 and Table 7. Figure 6 The results show that the content of IFN-γ expressed in CD8 + T lymphocytes in the PP62 group, the MGF505-3R group, the EP364R group, the K145R group and the DP96R group was extremely significantly increased (P<0.01) compared with the PBS group. The content of IFN-γ expressed in CD8 + T lymphocytes in the mixed bacteria group was extremely significantly different (P<0.001) compared with the PBS group.
[0213] 2.4.1.3 Effect of immunization with new functional Lactobacillus plantarum on the expression of IFN-γ in CD4 + and CD8 + T lymphocytes in MLN of mice
[0214] To detect the effect of new functional Lactobacillus plantarum on T lymphocytes in MLN of mice, the expression of IFN-γ in CD4 + T lymphocytes in MLN of mice in each group was determined by flow cytometry. The results are shown in Figure 7 , which showed that the content of IFN-γ expressed in CD4 + T lymphocytes in PP62 group and K145R group was significantly higher than that in PBS group (P < 0.05), and the content of IFN-γ expressed in CD4 + T lymphocytes in MGF505-3R group, EP364R group and DP96R group was extremely significantly higher than that in PBS group (P < 0.01), and the content of IFN-γ expressed in CD4 + T lymphocytes in mixed bacteria group was extremely significantly different from that in PBS group (P < 0.001).
[0215] The expression of IFN-γ in CD8 + T lymphocytes in MLN of mice in each group was detected. The results are shown in Figure 8 , which showed that the content of IFN-γ expressed in CD8 + T lymphocytes in PP62 group, MGF505-3R group, EP364R group, K145R group and DP96R group was significantly different from that in PBS group (P < 0.05), and the content of IFN-γ expressed in CD8 + T lymphocytes in mixed bacteria group was extremely significantly higher than that in PBS group (P < 0.01).
[0216] 2.4.1.4 Effect of immunization with new functional Lactobacillus plantarum on the expression of IL-4 in CD4 + T lymphocytes in spleen of mice
[0217] To detect whether new functional Lactobacillus plantarum can cause cellular immune response in mice, the expression of IL-4 in CD4 + T lymphocytes in spleen of mice in each group was detected. The results are shown in Figure 9 , which showed that the content of IL-4 expressed in CD4 + T lymphocytes in PP62 group, MGF505-3R group, EP364R group, K145R group and DP96R group was extremely significantly different from that in PBS group (P < 0.05), and the content of IL-4 expressed in CD4 +The IL-4 expression in T lymphocytes showed a significant difference (P<0.01). 2.4.1.5 Effect of the new functional Lactobacillus plantarum on CD4 + Effect of the new functional Lactobacillus plantarum on IL-4 expression in T lymphocytes
[0218] The CD4 + The IL-4 expression in T lymphocytes was detected, and the results are shown in Table 2.4.1.4. Figure 10 The results show that the CD4 + The IL-4 expression in T lymphocytes was significantly increased (P<0.05), and the CD4 + The IL-4 expression in T lymphocytes was significantly increased (P<0.05), and the CD4
[0219] 2.4.1.6 Effect of the new functional Lactobacillus plantarum on B cells in the PP of mice
[0220] This example investigates whether the five successfully constructed new functional Lactobacillus plantarum affect the activation of B cells. The B220 + IgA + cells in the PP of mice in each group were detected by flow cytometry, and the results are shown in Table 2.4.1.6. Figure 11 The results show that the B220 + IgA + cells in the PP62 group and the MGF505-3R group were significantly increased (P<0.05) compared with the PBS control group, and the B220 + IgA + cells in the EP364R group, the K145R group, the P96R group, and the mixed bacteria group were significantly increased (P<0.01) compared with the PBS control group, which indicates that the five new functional Lactobacillus plantarum can effectively activate the B cells of mice.
[0221] 2.4.2 Immunofluorescence results: To evaluate whether the new functional Lactobacillus plantarum has an effect on B cells in the intestinal tract of mice, the number of B220 + IgA + cells in the duodenum and ileum of mice was detected by immunofluorescence technology, and the results are shown in Figures 2.4.2.1 and 2.4.2.2. Figure 12 Figure 13 The results show that in the duodenum, the B220 + IgA + cells of mice orally immunized with the new functional Lactobacillus plantarum were significantly increased compared with the PBS group and the empty vector group. In the ileum, the B220 + IgA + Cells were significantly increased.
[0222] 2.4.3 Results of ELISA detection of specific antibody SIgA in mouse feces: The specific antibody SIgA content in the feces of each group of mice before immunization, after primary immunization, after booster immunization and after the third immunization was detected by ELISA, and the results are shown in Figure 14 (the significant differences marked in the figure are the results of comparative analysis of the experimental group of oral immunization of new functional plant lactobacillus and the blank group), the results show that: there is no significant difference in the SIgA content in the feces of each group of mice before immunization; on the tenth day after immunization (the seventh day after primary immunization), the SIgA content in the feces of mice in the PP62 group, the MGF505-3R group, the EP364R group, the K145R group and the DP96R group is significantly increased compared with the blank group (P<0.05), and the SIgA content in the feces of mice in the mixed bacteria group is extremely significantly increased compared with the blank group (P<0.01); on the twentieth day after immunization (the seventh day after booster immunization), the SIgA content in the feces of mice in the MGF505-3R group, the EP364R group and the K145R group is extremely significantly different from the blank group (P<0.01), the SIgA content in the feces of mice in the PP62 group, the DP96R group and the mixed bacteria group is extremely significantly increased compared with the blank group (P<0.001); on the thirtieth day after immunization (the seventh day after the third immunization), compared with the blank group, the SIgA content in the feces of mice in the PP62 group, the MGF505-3R group, the EP364R group, the K145R group and the DP96R group is extremely significantly increased (P<0.001), and the SIgA content in the feces of mice in the mixed bacteria group is extremely significantly increased (P<0.0001).
[0223] 2.4.4 Results of ELISA detection of specific antibody IgG in mouse serum: The specific antibody IgG level in the serum of each group of mice before immunization, after primary immunization, after booster immunization and after the third immunization was detected by ELISA, and the results are shown in Figure 15The results showed that there was no significant difference in the specific antibody IgG level in the serum of mice in each group before immunization. On the seventh day after the first immunization, the specific antibody IgG level in the serum of mice in the PP62 group, the MGF505-3R group, the EP364R group, the K145R group and the DP96R group was extremely significantly different (P<0.01) from that in the blank group, and the specific antibody IgG level in the serum of mice in the mixed bacteria group was extremely significantly higher (P<0.001) than that in the blank group. On the seventh day after the booster immunization, the specific IgG content in the serum of mice in the PP62 group and the K145R group was extremely significantly increased (P<0.01) compared with the blank group, the specific IgG content in the serum of mice in the MGF505-3R group, the EP364R group and the DP96R group was extremely significantly increased (P<0.001), and the specific antibody IgG content in the serum of mice in the mixed bacteria group was extremely significantly increased (P<0.0001). On the seventh day after the third immunization, the specific IgG content in the serum of mice in the PP62 group, the EP364R group and the K145 group was extremely significantly different (P<0.001) from that in the blank group, and the specific IgG content in the serum of mice in the MGF505-3R group, the DP96R group and the mixed bacteria group was extremely significantly increased (P<0.0001) compared with the blank group.
[0224] 2.4.5 ELISA detection of the content changes of cytokines IL-2, IFN-γ and IL-4 in the serum of mice
[0225] The content of cytokines IL-2, IFN-γ and IL-4 in the serum of mice after the booster immunization was detected by ELISA. The results are shown in Table 2. Figure 16 , Figure 17 , Figure 18The results showed that the oral immunization of new functional plant lactobacillus could significantly increase the levels of cytokines IL-2, IFN-γ and IL-4 in the serum of mice. The IL-2 level in the serum of mice in the MGF505-03R group, the EP364R group and the DP96R group was significantly higher than that in the PBS group (P<0.05), the IL-2 level in the serum of mice in the PP62 group and the K145R group was significantly higher than that in the PBS group (P<0.01), and the IL-2 level in the serum of mice in the mixed bacteria group was significantly higher than that in the PBS group (P<0.001); compared with the PBS control group, the IFN-γ level in the serum of mice in the MGF505-03R group and the DP96R group was significantly increased (P<0.05), the IFN-γ level in the serum of mice in the PP62 group, the EP364R group and the K145R group was extremely significantly increased (P<0.01), and the IFN-γ level in the serum of mice in the mixed bacteria group was extremely significantly increased (P<0.001); the IL-4 level in the serum of mice in the PP62 group, the EP364R group, the K145R group and the DP96R group was significantly different from that in the PBS control group (P<0.05), and the IL-4 level in the serum of mice in the MGF505-3R group and the mixed bacteria group was extremely significantly different from that in the PBS control group (P<0.01).
[0226] 2.4.6 Detection of IL-2, IFN-γ and IL-4 mRNA transcription levels in the spleen of mice by fluorescence quantitative PCR: the mRNA transcription levels of IL-2, IFN-γ and IL-4 in the spleen of mice in each group were detected by fluorescence quantitative PCR, and the results are shown in Figure 19 、 Figure 20 、 Figure 21 The expression level of IL-2 cytokine in the spleen of mice in the PP62 group, the MGF505-3R group, the EP364R group, the K145R group and the DP96R group was significantly higher than that in the PBS group (P<0.01), and the expression level of IL-2 cytokine in the spleen of mice in the mixed bacteria group was extremely significantly higher than that in the PBS group (P<0.001); compared with the PBS group, the expression levels of IFN-γ cytokine in the spleen of mice in the PP62 group and the EP364R group were significantly increased (P<0.05), the expression levels of IFN-γ cytokine in the spleen of mice in the MGF505-3R group, the K145R group and the DP96R group were extremely significantly increased (P<0.01), and the expression level of IFN-γ cytokine in the spleen of mice in the mixed bacteria group was extremely significantly increased (P<0.001); the expression levels of IL-4 cytokine in the spleen of mice in the PP62 group, the MGF505-3R group, the EP364R group and the DP96R group were extremely significantly different from those in the PBS group (P<0.01), and the expression levels of IL-4 cytokine in the spleen of mice in the K145R group and the mixed bacteria group were significantly higher than those in the PBS group (P<0.001).
[0227] 2.5 Discussion:
[0228] The initiation of mucosal immune responses in PP depends on the uptake, processing and efficient presentation of foreign antigens by dendritic cells (DCs). Among antigen-presenting cells, DCs are the most potent in initiating antigen-specific responses and are the cells that can induce naive CD4 + and CD8 + T cell differentiation. The surface marker of DCs is CD11c, and DCs induce the expression of B7 costimulatory molecules (CD80 and CD86) after capturing antigens. The flow cytometry results of this example show that oral immunization with new functional Lactobacillus plantarum can effectively induce the activation of DCs in the mouse PP, thereby initiating antigen-specific immune responses. When DCs present processed antigens, adaptive immune responses are activated. CD4 + T cells play a central role in adaptive immunity by producing various cytokines and chemokines to recruit and activate other immune cells, enhance their immune activity, and resist pathogen infection by coordinating immune responses. After pathogen infection, CD4 + T cells differentiate into Th1 cells, and developed Th1 cells release a large amount of IFN-γ, which then induces further stable differentiation of Th1 cells through a positive feedback pathway. Cytotoxic T cells (CD8 + T, CTL) are the main cell subpopulation for clearing viral infections. IFN-γ is an effector molecule released by activated CTLs. In this example, the flow cytometry results show that oral immunization with new functional Lactobacillus plantarum can promote the expression of IFN-γ in CD4 + T and CD8 + T cells in mice, thereby promoting cell-mediated immune responses. Th2 is involved in humoral immune responses, and interleukin-4 (IL-4) is a key cytokine secreted by Th2 cells, which has important immune regulatory functions on immune and non-immune cells. The flow cytometry results of this example show that oral immunization with new functional Lactobacillus plantarum can promote the expression of IL-4 in CD4 +The expression of IL-4 in T cells mediates the humoral immune response. The secretion levels of cytokines IL-2, IFN-γ, and IL-4 in the serum of mice in the experimental group were significantly increased, which further confirmed that the new functional Lactobacillus plantarum could enhance the cellular immune level and humoral immune level of the body. The relative expression levels of IL-2, IL-4, and IFN-γ gene mRNAs in the spleen of mice in the experimental group were significantly increased, which, combined with the flow cytometry results, indicated that specific immune memory responses might exist in the spleen. The PP of the small intestine is the primary induction site of the mucosal immune response. Most of the germinal center cells of the PP are B lymphocytes, and B cells are activated by antigens to produce IgA, thereby preventing pathogenic bacterial and viral infections. IgA is a non-inflammatory antibody that is specifically used for the protection of the intestinal mucosa. IgA is the most abundant antibody in mucosal secretions, and in the intestine, monomeric IgA interacts with small plasma cell-derived polypeptides to form IgA dimers, which can recognize the polymeric immunoglobulin receptor (pIgR) on the basolateral surface of the mucosal intestinal epithelial cells (IEC). The pIgR can promote the release of secretory IgA (SIgA) to the surface of the intestine. SIgA can protect the mucosal epithelium from pathogen infection. After the mice were orally immunized with the new functional Lactobacillus plantarum expressing the African swine fever virus fusion protein constructed in Example 1, the B220 + IgA + cells in the PP germinal center were significantly increased. At the same time, the immunofluorescence results also showed that the B220 + IgA + cells in the small intestine of mice orally immunized with the new functional Lactobacillus plantarum were higher than those in the PBS control group and the empty vector control group. The ELISA detection results also showed that the specific antibody SIgA content in the feces of mice orally immunized with the new functional Lactobacillus plantarum was significantly increased, which indicated that oral immunization with the new functional Lactobacillus plantarum could enhance the mucosal immune response of mice. Th1 and Th2 cells participate in protective immune responses, and at the same time, induce B cells to produce specific IgG antibodies to protect the body. Most of the IgG antibodies produced by activated B cells exist in the blood in a secreted form, accounting for 75% of the proportion of serum antibodies, and play an important role in humoral immunity. In the detection results of this example, the specific IgG antibody level in the serum of mice was significantly increased, which indicated that immunization with the new functional Lactobacillus plantarum could promote the humoral immune response, thereby enhancing the immune ability of the body.
[0229] 2.6Summary: The results of the study of this embodiment show that the new functional Lactobacillus plantarum NC8Δ-pSIP409-pgsA'-PP62, NCΔ-pSIP409-pgsA'-MGF505-3R, NC8Δ-pSIP409-pgsA'-EP364R, NC8Δ-pSIP409-pgsA'-K145R and NC8Δ-pSIP409-pgsA'-DP96R, alone or in combination, can induce the activation of DC in the PP, initiate the protective immune response, enhance the cellular and humoral immune response in the spleen and MLN, promote the activation of B cells and the production of IgA antibodies in the PP, and enhance the mucosal immune response. At the same time, the level of antigen-specific IgG antibodies in the serum is also increased, and the humoral immune response is enhanced.
[0230] The preferred embodiments of the present application have been described above with the specific examples, but the present application is not limited to the above examples. Although the technical solutions described in the foregoing embodiments have been described in detail, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A lactic acid bacterium expressing an African swine fever virus fusion antigen, characterized in that, The fusion gene has a gene encoding OprI protein connected with a gene encoding PP62 protein, a gene encoding MGF505-3R protein, a gene encoding EP364R protein, a gene encoding K145R protein or a gene encoding DP96R protein through a linker, respectively; the nucleotide sequence of the linker is shown as SEQ ID NO: 7; The nucleotide sequence of the fusion gene is selected from the following nucleotide sequences: a sequence shown as SEQ ID NO: 8, a sequence shown as SEQ ID NO: 9, a sequence shown as SEQ ID NO: 10, a sequence shown as SEQ ID NO: 11 and a sequence shown as SEQ ID NO: 12; The lactic acid bacteria is *Lactobacillus plantarum*, a gene-deficient type of alanine racemase. Lactobacillus plantarum )NC8 / ΔaLr; The lactic acid bacteria use pSIP409-pgsA' vector as the expression vector.
2. The method of constructing a lactic acid bacterium according to claim 1, comprising: After the fusion gene is connected with the expression vector, the recombined plasmid is obtained by transforming the competent cell, and the recombined plasmid is transformed into the starting strain.
3. A composition comprising the lactic acid bacteria according to claim 1.
4. The composition according to claim 3, which is a bacterial agent, a pharmaceutical composition or a feed.
5. A vaccine comprising the lactic acid bacteria according to claim 1.
6. The vaccine of claim 5, characterized in that, The vaccine is a vector vaccine.
7. The vaccine of claim 5, wherein the vaccine is characterized by, The vaccine is a live vector vaccine.
8. Use of the lactic acid bacteria according to claim 1 or the composition according to claims 3-4 or the vaccine according to claims 5-7 in the preparation of a product for preventing and controlling African swine fever.
9. Use according to claim 8, characterized in that, The product is a bacterial agent, a pharmaceutical preparation or a feed.
10. Use according to claim 9, characterized in that, The pharmaceutical preparation is a biological product.
11. Use according to claim 9, characterized in that, The pharmaceutical preparation is a live vector vaccine.
Citation Information
Patent Citations
Non-resistant lactobacillus plantarum anchoring expression vector pLPSa and preparation method thereof
CN108410900A
Recombinant African swine fever antigen cocktail vaccine containing intramolecular adjuvant and application thereof
CN114377121A
African swine fever virus antigen protein recombinant expression vector, recombinant plant lactobacillus as well as preparation method and application of recombinant plant lactobacillus
CN114426981A