Monoclonal antibody 2D7 or its antibody fragment against monkeypox virus A35R protein

By developing the monoclonal antibody 2D7 against the monkeypox virus A35R protein, the gap in monkeypox virus detection in some areas has been resolved, and rapid detection with high specificity and high affinity has been achieved.

CN118496349BActive Publication Date: 2025-09-23WUHAN INST OF BIOLOGICAL PROD CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410472552.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-19
Publication Date
2025-09-23
Estimated Expiration
2044-04-19

AI Technical Summary

Technical Problem

Existing monkeypox virus detection methods have detection gaps in some backward areas, and lack highly specific and high-affinity antibodies for rapid detection of monkeypox virus A35R protein.

Method used

A monoclonal antibody 2D7 and its antibody fragment against the monkeypox virus A35R protein were developed, containing specific CDR sequences and detected by a colloidal gold rapid detection kit, combining high affinity and specificity for the rapid detection of monkeypox virus.

Benefits of technology

A highly specific and high-affinity monoclonal antibody 2D7 is provided for use in colloidal gold rapid detection kits, filling the detection gap in some areas and improving the rapid detection capability of monkeypox virus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118496349B_ABST
    Figure CN118496349B_ABST
Patent Text Reader

Abstract

The present invention specifically relates to a monoclonal antibody 2D7, which is directed against the monkeypox virus A35R protein. The present invention first repeats and concatenates the MPXV A35S gene sequence via a linker (Gly4Ser)3, and then uses this as an immunogen to screen and obtain the monoclonal antibody 2D7, which is directed against the monkeypox virus A35R protein. The heavy chain of this monoclonal antibody comprises CDR1, CDR2, and CDR3 composed of the amino acid sequences shown in SEQ ID NOs. 1 to 3, and the light chain comprises CDR1, CDR2, and CDR3 composed of the amino acid sequences shown in SEQ ID NOs. 4 to 6. Further experimental studies have revealed that it has good specificity, high binding activity and affinity, and can be used in colloidal gold rapid detection kits, laying the foundation for the detection of monkeypox virus A35R protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of monoclonal antibodies, and in particular to a monoclonal antibody 2D7 against monkeypox virus A35R protein. Background Art

[0002] Monkeypox is a zoonotic disease caused by the Monkeypox virus (MPXV). The virus is a double-stranded DNA virus belonging to the Poxviridae family, the Vertebropoxvirinae subfamily, and the Orthopoxvirus genus. Typical symptoms of monkeypox include head and body aches, fever, sore throat, fatigue, swollen lymph nodes, and a characteristic rash. Since May 2022, monkeypox has spread rapidly in several countries.

[0003] The monkeypox virus A35R protein is a component of the extracellular envelope of virions (EEVs). It controls the production of the actin tail and is essential for the spread of the virus between cells. The monkeypox virus A35R protein is one of the primary antigenic sites that stimulate the production of neutralizing antibodies, a key protective site for vaccines, and a potential target for serological testing, enabling specific identification of the virus and diagnosis of the disease. Anti-monkeypox virus A35R monoclonal antibodies can be used in colloidal gold rapid test kits, complementing existing monkeypox pathogen detection methods to assist in the detection of suspected patients and screening of key populations, thus filling the gap in MPXV detection in some underdeveloped regions. Summary of the Invention

[0004] One of the objects of the present invention is to provide a monoclonal antibody 2D7 or an antibody fragment thereof against the monkeypox virus A35R protein, wherein the heavy chain comprises CDR1, CDR2, and CDR3 composed of the amino acid sequences shown in SEQ ID NOs. 1 to 3, and the light chain comprises CDR1, CDR2, and CDR3 composed of the amino acid sequences shown in SEQ ID NOs. 4 to 6.

[0005] As a preferred embodiment, the monoclonal antibody 2D7 against monkeypox virus A35R protein or its antibody fragment comprises a heavy chain variable region as shown in SEQ ID NO.7 and a light chain variable region as shown in SEQ ID NO.8.

[0006] As a preferred embodiment, the heavy chain amino acid sequence of the monoclonal antibody 2D7 against monkeypox virus A35R protein or its antibody fragment is an amino acid sequence with the same function formed by replacing, deleting or adding one or more amino acid sequences as shown in SEQ ID NO.7, or an amino acid sequence that has more than 95% homology with the amino acid sequence shown in SEQ ID NO.7 and has the same function; and / or, the light chain amino acid sequence of the monoclonal antibody is an amino acid sequence with the same function formed by replacing, deleting or adding one or more amino acid sequences as shown in SEQ ID NO.8, or an amino acid sequence that has more than 95% homology with the amino acid sequence shown in SEQ ID NO.8 and has the same function.

[0007] The monoclonal antibody 2D7 has good specificity, high binding activity and affinity, and can be used in colloidal gold rapid detection kits, laying the foundation for the detection of monkeypox virus A35R protein.

[0008] A second object of the present invention is to protect the nucleotide molecules encoding the above-mentioned monoclonal antibody 2D7 against monkeypox virus A35R protein or its antibody fragment.

[0009] Preferably, the polynucleotide molecule has the nucleotide sequence shown in SEQ ID NO.9; and / or, the polynucleotide molecule has the nucleotide sequence shown in SEQ ID NO.10.

[0010] The third purpose of the present invention is to protect the engineered cells and recombinant vectors containing the above-mentioned nucleotide molecules.

[0011] A fourth object of the present invention is to protect a kit for detecting monkeypox virus, which comprises the above-mentioned monoclonal antibody or antibody fragment, or the monoclonal antibody or antibody fragment encoded by the above-mentioned nucleotide molecule.

[0012] A fifth object of the present invention is to protect the use of the above-mentioned monoclonal antibody or antibody fragment in the preparation of a kit for detecting monkeypox virus.

[0013] A sixth object of the present invention is to protect the use of the above-mentioned monoclonal antibodies or antibody fragments in the preparation of drugs for inhibiting, preventing and treating monkeypox virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Figures 1 and 2 are the results of SDS-PAGE and Western blot analysis of the purified monkeypox virus A35R protein in Example 1; wherein A is an SDS-PAGE image of the monkeypox virus A35R protein, B is a Western blotting image of the monkeypox virus A35R protein, M is a marker, and I is the monkeypox virus A35R protein;

[0015] Figure 2 The SDS-PAGE electrophoresis results of the monoclonal antibody 2D7 obtained in Example 2 are shown; lane 1 is a non-reducing SDS-PAGE electrophoresis, and lane 2 is a reducing SDS-PAGE electrophoresis;

[0016] Figure 3 The figure shows the Western blot test results of the monoclonal antibody 2D7 specifically binding to the monkeypox virus A35R protein and inactivated monkeypox virus; A is the Western blot image of the monkeypox virus A35R protein, B is the Western blot image of the inactivated monkeypox virus, M is a marker, 1: primary antibody 2D7, 2: positive control;

[0017] Figure 4 This is the binding activity test result of monoclonal antibody 2D7;

[0018] Figure 5 This is the affinity test result of monoclonal antibody 2D7. DETAILED DESCRIPTION

[0019] The present invention will be further described in detail below with reference to specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0020] The following embodiments are only used to illustrate the present invention, but are not intended to limit the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention.

[0021] In the examples of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the examples of the present invention, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0022] Sources of reagents: BL21 (DE3) competent cells were purchased from Beijing Solaibao Technology Co., Ltd.; SPF-grade BALB / c female mice, 6-8 weeks old, were provided and raised by the Laboratory Animal Laboratory of Wuhan Institute of Biological Products Co., Ltd.; RPMI1640 medium and fetal bovine serum (FBS) were purchased from Gibco, USA; urea and mouse anti-HIS tag antibody (HRP labeled) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; anti-monkeypox virus A35R mouse monoclonal antibody was purchased from Beijing Sino-Bio Technology Co., Ltd.; hybridoma culture supplements were purchased from Frdbio Technology (Wuhan) Co., Ltd.; Protein Maker (Protein Ladder) and BCA protein quantification kit were purchased from Thermo Fisher Scientific, USA; bovine serum albumin (BSA) was purchased from Sigma, USA; TMB colorimetric solution was purchased from BD Biosciences, USA; HAT, HT, Freund's complete adjuvant, Freund's incomplete adjuvant, Protein G gravity columns and IPTG were purchased from Sangon Biotech (Shanghai) Co., Ltd.; ascites-specific adjuvant and mouse monoclonal antibody subtype identification kit were purchased from Beijing Biolong Immunotechnology Co., Ltd.; Scientz-IID ultrasonic cell disruptor was purchased from Ningbo Xinzhi Biotechnology Co., Ltd., and ELx800 absorbance microplate reader was purchased from Biotek, USA.

[0023] Example 1 Prokaryotic Expression of Monkeypox Virus A35R Protein

[0024] The monkeypox virus A35R genome sequence (GenBank accession number: AAL40603.1) was obtained from NCBI. The non-transmembrane region sequence was retained, and the gene sequence was repeatedly concatenated using linker (Gly4Ser)3. NcoⅠ and XhoⅠ restriction sites were introduced at the 3' and 5' ends of the gene sequence, respectively, and the sequence was optimized. The optimized sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd. and constructed on the pET22b(+) vector.

[0025]

[0026] The recombinant plasmid was transformed into BL21 (DE3) competent cells and inoculated into LB liquid medium containing kanamycin. The cells were shaken at 37°C and 200 rpm for 3 h. IPTG was added to a final concentration of 1 mmol / L and cultured for 3-4 h. The bacterial culture was harvested and disrupted by ultrasonic cell disruptor. The supernatant was discarded by centrifugation and the precipitate was dissolved and purified by Ni-NTA affinity column. The purified proteins were gradient dialyzed in renaturation buffer containing 6 / 4 / 2 / 0 M urea (2 mM reduced glutathione GSH, 0.2 mM oxidized glutathione GSSG, 20 mM Tris, 1% glycine, 5% glycerol, 0.1% PEG 6000, 6 / 4 / 2 / 0 M urea, pH 8.0) for 6-12 h each time at 4°C. The purified renatured proteins were identified by reducing SDS-PAGE and Western blot. The monkeypox virus A35R protein was added with reducing 5×SDS loading buffer. Buffer, the sample was boiled at 100℃ for 10 min and then subjected to SDS-PAGE electrophoresis, transferred to nitrocellulose membrane (NC membrane), blocked with 5% skim milk powder at 4℃ overnight, washed with PBST, and incubated with 1:10000 diluted mouse anti-HIS tag antibody (HRP labeled) at 37℃ for 1h. After washing the membrane, the color developing solution was added and the membrane was exposed and photographed. Figure 1 .

[0027] Example 2 Preparation of Monoclonal Antibodies Against Monkeypox Virus A35R Protein

[0028] The purified monkeypox virus A35R protein was immunized into mice by intraperitoneal and subcutaneous immunization of the limbs. The first immunization was 100 μg / mouse, supplemented with an equal volume of Freund's complete adjuvant; the second immunization was performed 21 days later, 50 μg / mouse, supplemented with an equal volume of Freund's incomplete adjuvant; the third immunization was performed 14 days later, 50 μg / mouse. After immunization, the serum titer was detected by indirect ELISA, and the mice with the highest serum titer were selected for tail vein shock immunization at 50 μg / mouse. After 3 days, the mouse spleen cells were taken and fused with SP2 / 0 by PEG fusion method. The fused cells were screened by HAT medium, and the fused hybridoma cell culture supernatant was detected by indirect ELISA. The 0.1 μg / mL monkeypox virus A35R protein was used as the antigen to coat the enzyme labeling plate, and the hybridoma cell culture supernatant was added after blocking with 1% BSA. After incubation at 37°C for 1 hour, a 1:20000 diluted HRP-labeled goat anti-mouse IgG antibody was added and incubated at 37°C for 1 hour. TMB colorimetric solution was added and incubated at 37°C for 15 minutes. 2M H2SO4 was added to terminate the reaction, and the A plate was read on a microplate reader. 450 nm Value. Pick A 450 nmPositive hybridoma cell wells with a value greater than 2.0 were subcloned, and the hybridoma cells were inoculated into mice to prepare ascites, which was purified by Protein G gravity column to obtain the anti-monkeypox virus A35R protein monoclonal antibody 2D7.

[0029] The purification effect was detected by SDS-PAGE. The purity of the antibody was determined by reducing and non-reducing SDS-PAGE. The purified antibody was added to reducing 5× SDS Loading Buffer and non-reducing 4× SDS Loading Buffer. The sample was boiled at 100℃ for 10 minutes and then subjected to SDS-PAGE electrophoresis. The SDS-PAGE results are shown in Figure 2 , showing that under non-reducing conditions, the mouse SARS-CoV-2 antibody presents a band with a molecular weight of approximately 200kDa; under reducing conditions, two bands with molecular weights of approximately 55kDa and 25kDa appear, corresponding to the heavy and light chains of the antibody, respectively. Sequencing revealed that the sequence information of monoclonal antibody 2D7 is as follows:

[0030] The heavy chain CDR1 (VHCDR1) has the amino acid sequence shown in SEQ ID NO. 1: GYAFTSYN;

[0031] The heavy chain CDR2 (VHCDR2) has the amino acid sequence shown in SEQ ID NO. 2: IDPYNGFT;

[0032] The heavy chain CDR3 (VHCDR3) has the amino acid sequence shown in SEQ ID NO. 3: ARRGSFDY;

[0033] The light chain CDR1 (VLCDR1) has the amino acid sequence shown in SEQ ID NO. 4: QDINKF;

[0034] The light chain CDR2 (VLCDR2) has the amino acid sequence shown in SEQ ID NO. 5: YTS;

[0035] The light chain CDR3 (VLCDR3) has the amino acid sequence shown in SEQ ID NO. 6: LQYDNLWT.

[0036] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7: PGASVKVSCKAS GYA FTSYN MYWVKQSHGKSLEWIGY IDPYNGFT NYNQKFKGKATLTADKSSS TAYMHLNSLTSEDSAVYYC ARRGSFDY WGQGTTLTVSS;

[0037] The amino acid sequence of the light chain variable region is shown in SEQ ID NO.8: LSASLVGKVTIICKAS QDINKF MAWYQHKPGKGPRLLIH YTS TLQPGIPSRFSGGSGRDYSFSISN LETEDIATYYC LQYDNLWT FGGGTKLEIK.

[0038] The nucleotide sequence of the heavy chain variable region is shown in SEQ ID NO.9: CCTGGGGCTTCAGTG AAGGTATCCTGCAAGGCTTCTGGTTATGCATTCACTAGCTACAACATGTACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTGATCCTTACAATGGATTTACTAATTACAACCAGAAGTTCAAGGGCAA GGCCACATTGACTGCTGACAAGTCCTCCAGCACAGCCTATATGCATCTCAACAGCCTGACATCTGAGGACTCAGCAGTCTATTACTGTGCAAGAAGGGGATCCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA;

[0039] The nucleotide sequence of the light chain variable region is shown in SEQ ID NO.10: CTTTCTGCATCTCTG GTAGGCAAAGTCACCATTATTTGCAAGGCAAGCCAAGACATTAACAAGTTTATGGCTTGGTACCAACACAAGCCTGGCAAAGGTCCTAGACTTCTCATACATTACACATCTACATTACAGCCAGGCATCCCATCAAG GTTCAGTGGAAGTGGGTCTGGGAGAGATTATTCCTTCAGCATCAGCAACCTGGAGACTGAAGATATTGCAACTTATTATTGTCTACAGTATGATAATCTGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA.

[0040] Example 3 Functional Analysis of Antibodies

[0041] (1) Specificity detection of mouse anti-monkeypox virus A35R antibody 2D7 and antigen

[0042] Western blot was used to identify the specificity of the antibody. Monkeypox virus A35R antigen protein and inactivated monkeypox virus (West African strain of monkeypox virus, clade IIb B.1, see reference: The assessment on cross immunity with smallpox virus and antiviral drug sensitivity of the isolated monkeypox virus strain WIBP-MPXV-001 in China) were subjected to SDS-PAGE and transferred to a NC membrane. The membrane was blocked with 5% skim milk powder overnight at 4°C, washed with PBST, and incubated with purified 2D7 as the primary antibody at 37°C for 1 hour. A mouse monoclonal antibody against monkeypox virus A35R purchased from Sino Biological Technology Co., Ltd. was also used as a positive control. After washing, HRP-conjugated goat anti-mouse IgG antibody was added and incubated at 37°C for 1 hour. After washing, the membrane was developed and exposed to light for photography.

[0043] The results are as follows Figure 3 As shown. Figure 3 2D7 specifically binds to both the MPXV A35R protein and inactivated MPXV. Note: Due to the relatively small molecular weight of the MPXV A35R protein, the MPXV A35R gene sequence was repeatedly concatenated via a linker (Gly4Ser)3 to enhance its immunogenicity. Therefore, in Western blot analysis, the molecular weight of the prokaryotically expressed MPXV A35R protein differs from that of the native A35R protein in inactivated MPXV.

[0044] (2) Detection of the binding activity of mouse anti-monkeypox virus A35R antibody 2D7 with antigen

[0045] The ELISA method was used to determine the binding ability of the antibody to the monkeypox virus A35R protein. The steps were as follows: 0.1 μg / mL MPXVA35R protein was used as the antigen to coat the enzyme-labeled plate at 4°C overnight. After blocking with 1% BSA for 2 hours, 2D7 was diluted 5-fold starting from 125 μg / mL, with 12 dilution gradients, and incubated at 37°C for 1 hour. A 1:20000 diluted HRP-labeled goat anti-mouse IgG antibody was added at 100 μL / well and incubated at 37°C for 1 hour. TMB colorimetric solution was added, and after incubation at 37°C for 15 minutes, 2M H2SO4 was added to terminate the incubation, and the A was read on an enzyme reader. 450 nm The concentration for 50% of maximal effect (EC 50 ), which is the binding activity of the monoclonal antibody.

[0046] The results are as follows Figure 4 As shown. Figure 4 It can be seen that the binding activity of monoclonal antibody 2D7 against A35R protein is EC 50 =11.41ng / mL.

[0047] (3) Affinity detection of mouse anti-monkeypox virus A35R antibody 2D7

[0048] Surface plasmon resonance experiments were performed using GE's Biacore 8K instrument to detect antibody affinity. Anti-mouse IgG Fc antibody (purchased from Cytiva, catalog number: BR100838) was coupled to the surface of a CM5 chip. 10 μg / mL of monoclonal antibody 2D7 was captured with the anti-mouse IgG Fc antibody at a flow rate of 1 μL / min for 20 seconds. The analyte antigen, monkeypox virus A35R protein, was diluted to concentrations of 125, 62.5, 31.25, and 15.625 nM, respectively, and injected into the chip channel at a flow rate of 30 μL / min. The binding time was set to 180 seconds and the dissociation time was greater than 600 seconds. Finally, the chip was regenerated using glycine at pH 1.5 for 30 seconds at a flow rate of 30 μL / min. The Biacore Evaluation Software program was opened to perform fitting analysis on the experimental data.

[0049] The results are as follows Figure 5 As shown. Figure 5 It can be seen that the binding constant ka value of 2D7 is 2.245E+5 1 / Ms, the dissociation constant kd value is 2.620E-4 1 / s, and the affinity constant KD value is 1.167E-9M.

[0050] It is important to note that the above embodiments are intended only to further illustrate and describe the technical solutions of the present invention and are not intended to further limit the technical solutions of the present invention. The methods of the present invention are merely preferred implementations and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A monoclonal antibody 2D7 against monkeypox virus A35R protein, characterized in that: The heavy chain comprises CDR1, CDR2, and CDR3, each consisting of the amino acid sequences shown in SEQ ID NOs. 1 to 3. The light chain comprises CDR1, CDR2, and CDR3 consisting of the amino acid sequences shown in SEQ ID NOs. 4 to 6, respectively.

2. The monoclonal antibody 2D7 against monkeypox virus A35R protein according to claim 1, characterized in that: It comprises a heavy chain variable region as shown in SEQ ID NO.7 and a light chain variable region as shown in SEQ ID NO.

8.

3. The monoclonal antibody 2D7 against monkeypox virus A35R protein according to claim 1, characterized in that The amino acid sequence of the heavy chain variable region of the monoclonal antibody is an amino acid sequence with the same function formed by replacing, deleting or adding one or more amino acid sequences to the amino acid sequence shown in SEQ ID NO. 7, or an amino acid sequence that has more than 95% homology to the amino acid sequence shown in SEQ ID NO. 7 and has the same function; and / or, the amino acid sequence of the light chain variable region of the monoclonal antibody is an amino acid sequence with the same function formed by replacing, deleting or adding one or more amino acid sequences to the amino acid sequence shown in SEQ ID NO. 8, or an amino acid sequence that has more than 95% homology to the amino acid sequence shown in SEQ ID NO. 8 and has the same function.

4. A nucleotide molecule encoding the monoclonal antibody 2D7 against monkeypox virus A35R protein according to claim 1, 2 or 3.

5. The nucleotide molecule according to claim 4, characterized in that The nucleotide molecule has the nucleotide sequence shown in SEQ ID NO.9; and, the nucleotide molecule has the nucleotide sequence shown in SEQ ID NO.

10.

6. An engineered cell or recombinant vector comprising the nucleotide molecule according to claim 4 or 5.

7. A kit for detecting monkeypox virus, characterized in that: The kit comprises the monoclonal antibody according to claim 1, 2 or 3, or the monoclonal antibody encoded by the nucleotide molecule according to claim 4 or 5.

8. Use of the monoclonal antibody according to claim 1, 2 or 3, or the monoclonal antibody encoded by the nucleotide molecule according to claim 4 or 5, in the preparation of a kit for detecting monkeypox virus.

Citation Information

Patent Citations

  • Antibody bound with monkey pox virus or antigen binding fragment thereof and application thereof

    CN115925885A

  • Monoclonal antibody of monkey pox virus as well as preparation and application of monoclonal antibody

    CN116751283A