Preparation method and application of porcine IZUMO2 eukaryotic protein and monoclonal antibody thereof

By removing the transmembrane structure of porcine IZUMO2 protein and using a eukaryotic cell expression system, porcine IZUMO2 eukaryotic protein and monoclonal antibody were prepared, solving the problem of unclear expression and function in the prior art, improving the reproductive performance and sperm capacitation ability of boars, and possessing anti-inflammatory capabilities.

CN118598971BActive Publication Date: 2026-07-03SOUTH CHINA AGRICULTURAL UNIVERSITY
1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2024-07-01
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the effective expression and utilization of porcine IZUMO2 protein, and its functions in reproductive performance and immune regulation have not been fully explored.

Method used

By removing the transmembrane structure of porcine IZUMO2 protein, porcine IZUMO2 eukaryotic protein was prepared using a eukaryotic cell expression system, and corresponding monoclonal antibodies were prepared and applied to sperm capacitation fluid and sperm preservation fluid to enhance reproductive performance by utilizing the biological activity of eukaryotic proteins.

Benefits of technology

This study achieved efficient expression of porcine IZUMO2 protein and preparation of monoclonal antibodies, which improved the reproductive performance and sperm capacitation ability of boars and reduced the expression of inflammatory factors, showing broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118598971B_ABST
    Figure CN118598971B_ABST
Patent Text Reader

Abstract

The application discloses a pig IZUMO2 eukaryotic protein and a preparation method and application of a monoclonal antibody of the pig IZUMO2 eukaryotic protein. The full-length sequence of pig IZUMO2 nucleotide CDS is verified, a research method for removing the transmembrane structure of the pig IZUMO2 nucleotide CDS and only expressing the extramembrane sequence of the pig IZUMO2 nucleotide CDS in eukaryotes is designed, and the IZUMO2 protein is expressed and secreted by CHO-K1 cells. The protein expressed by the method is close to natural protein, has biological activity and is simple to operate. The qPCR and ELISA tests verify that the IZUMO2 protein can reduce the expression of inflammatory factors in RAW264.7 cells induced by LPS, and has a certain anti-inflammatory capacity. It is found through experiments that the IZUMO2 protein can promote the capacitation of boar sperm, and it is proved that the protein can be applied to the preparation of a reagent for promoting the capacitation of boar sperm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing and applying porcine IZUMO2 eukaryotic protein and its monoclonal antibody. Background Technology

[0002] The reproductive performance of boars directly affects the quantity and quality of offspring and production efficiency. Improving boar reproductive performance has become a major focus in the pig farming industry. Semen quality is a crucial factor in boar reproductive performance, and sperm proteins, as the main components of semen, determine sperm fertilization capacity. Exploring the influence and mechanisms of sperm proteins in the sperm-egg fusion process can provide new insights for screening fertilization-related biomarkers.

[0003] Porcine IZUMO2 protein is a transmembrane protein containing a domain of approximately 150 amino acid residues at its N-terminus. IZUMO2 protein is expressed in sperm and testes and is the least studied protein among the IZUMO family members. Studies have shown that the level of IZUMO2 protein in boar sperm is significantly positively correlated with litter size, farrowing rate, and reproductive efficiency. IZUMO2 antibodies and peptides have also been detected in the serum of infertile women. Recent research has found that IZUMO2 also plays a role in triple-negative breast cancer and colorectal cancer. These results suggest that IZUMO2 protein has certain effects on reproductive performance and immune regulation, but its biological function and regulatory mechanisms remain unclear. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a porcine IZUMO2 eukaryotic protein.

[0005] Another objective of this invention is to provide a porcine IZUMO2 eukaryotic protein monoclonal antibody.

[0006] Another object of the present invention is to provide a method for preparing the above-mentioned protein and monoclonal antibody.

[0007] Another object of the present invention is to provide applications of the above-mentioned protein and monoclonal antibody.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] A porcine IZUMO2 eukaryotic protein, the amino acid sequence of which is shown in SEQ ID NO.3.

[0010] The porcine IZUMO2 eukaryotic protein is obtained by removing the transmembrane sequence and replacing the signal peptide from the porcine IZUMO2 protein.

[0011] The nucleotide sequence of the gene encoding the porcine IZUMO2 eukaryotic protein is shown in SEQ ID NO.2.

[0012] The porcine IZUMO2 eukaryotic protein was obtained through expression using a eukaryotic cell expression system.

[0013] The eukaryotic cell expression system described herein is prepared by transfecting a lentiviral solution prepared using the CMV enhancer-MCS-EF1a-ZsGreen1-T2A-puro vector into CHO-K1 cells for expression.

[0014] The application of the above-mentioned porcine IZUMO2 eukaryotic protein in the preparation of anti-inflammatory drugs.

[0015] The application of the above-mentioned porcine IZUMO2 eukaryotic protein in inhibiting the expression of inflammatory factors.

[0016] The inflammatory factors include at least one of IL-1α, IL-1β, IL-6, iNOS, and TNF-α.

[0017] The application of the above-mentioned porcine IZUMO2 eukaryotic protein in the preparation of sperm capacitation solution.

[0018] The application of the above-mentioned porcine IZUMO2 eukaryotic protein in the preparation of reagents that promote sperm capacitation in boars.

[0019] A sperm capacitation fluid contains the following components:

[0020] Each 100mL contains 0.6611g NaCl, 0.0224g KCl, 0.1102g CaCl2·2H2O, 0.2324g Tris, 0.1982g D-Glucose, 0.055g sodium pyruvate, 0.01g sodium heparin, 800μg porcine IZUMO2 eukaryotic protein, with the remainder being water.

[0021] A method for preparing a porcine IZUMO2 eukaryotic protein monoclonal antibody includes the following steps:

[0022] (1) Take porcine IZUMO2 protein and Bio-Drone water-soluble adjuvant and mix them thoroughly. Then, administer the initial immunization to mice by intramuscular injection in the hind leg.

[0023] (2) Twenty-one days after the initial immunization, the porcine IZUMO2 protein was thoroughly mixed with Bio-Drone water-soluble adjuvant and used to boost the immunization of mice;

[0024] (3) One week after booster immunization, blood was collected from the tail vein of the experimental mice, and serum titer was measured. Spleen cells from mice with a serum titer of 128,000 were fused with SP2 / 0 cells to prepare hybridoma cells;

[0025] (4) After three rounds of screening of subcloning and positive hybridoma cell lines, a hybridoma cell line that stably secretes monoclonal antibodies was obtained.

[0026] (5) Ascites fluid was prepared from experimental mice and collected for antibody purification to obtain porcine IZUMO2 eukaryotic protein monoclonal antibody.

[0027] A porcine IZUMO2 eukaryotic protein monoclonal antibody was prepared using the method described above.

[0028] The above-mentioned porcine IZUMO2 eukaryotic protein monoclonal antibody was used in the selection of high-breeding boars.

[0029] The above-mentioned porcine IZUMO2 eukaryotic protein monoclonal antibody was used in the preparation of sperm preservation solution.

[0030] The present invention has the following advantages and effects compared with the prior art:

[0031] (1) IZUMO2 protein is a transmembrane protein, which is difficult to express completely in the existing technology. This invention verifies the full-length CDS sequence of porcine IZUMO2 nucleotides and designs a research method to remove its transmembrane structure and express, purify and prepare monoclonal antibodies for eukaryotic expression of only its extramembrane sequence. IZUMO2 protein is secreted and expressed by CHO-K1 cells. The protein expressed by this method is close to the natural protein, has biological activity and is simple to operate.

[0032] (2) A highly specific porcine IZUMO2 monoclonal antibody was prepared, providing experimental materials for the subsequent localization of IZUMO2 protein in reproductive tissues and cells and the exploration of the biological function of IZUMO2 protein.

[0033] (3) This invention promotes sperm capacitation in boars by adding IZUMO2 protein. Adding IZUMO2 protein to the fertilization fluid increases the cleavage rate of embryos in in vitro fertilization experiments in pigs. This facilitates its widespread application in the industry.

[0034] (4) The IZUMO2 protein was verified by qPCR and ELISA to reduce the expression of inflammatory factors in LPS-induced RAW264.7 cells and has a certain anti-inflammatory ability. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of the preparation steps for porcine IZUMO2 protein and its monoclonal antibody.

[0036] Figure 2This is a 3' end amplification band diagram of the IZUMO2 gene. M is the DL2000 Marker, 1 is β-actin, and 2 is the 3' end sequence of the IZUMO2 gene.

[0037] Figure 3 This is an amplification diagram of the 5' end of IZUMO2 cDNA. 1 is GAPDH, and 2 is the RACE amplification band.

[0038] Figure 4 This is a prediction of the transmembrane structure of the porcine IZUMO2 protein.

[0039] Figure 5 This is an RT-PCR detection of CHO-K1-IZUMO2 positive cells. Lanes 1 and 4 contain CHO-K1-IZUMO2 cells; lanes 2 and 5 contain CHO-K1 cells infected with the empty vector; lanes 3 and 6 contain untreated CHO-K1 cells.

[0040] Figure 6 This is a Western blot image of the supernatant from CHO-K1-IZUMO2 positive cells. Lanes 1-3 represent untreated CHO-K1 cells, CHO-K1 cells infected with the empty vector, and CHO-K1-IZUMO2 cells, respectively.

[0041] Figure 7 This is an image showing the SDS-PAGE identification results of the recombinant IZUMO2 protein.

[0042] Figure 8 This is a peptide coverage diagram of purified porcine IZUMO2 protein.

[0043] Figure 9 This is a graph showing the results of specific identification of the IZUMO2 monoclonal antibody. The lanes represent the IZUMO2 protein.

[0044] Figure 10 This is a fluorescence image of FITC-PNA and Hoechst staining of porcine sperm.

[0045] Figure 11 The effect of different concentrations of IZUMO2 protein on sperm acrosome integrity.

[0046] Figure 12 The effect of different concentrations of IZUMO2 antibody on sperm acrosome integrity.

[0047] Figure 13 This study investigated the effect of IZUMO2 protein on the acrosome integrity rate of capacitation sperm.

[0048] Figure 14 The effect of IZUMO2 antibody on the acrosome integrity rate of capacitation sperm.

[0049] Figure 15 It is a diagram of embryonic cleavage.

[0050] Figure 16 The effect of IZUMO2 protein on the expression levels of inflammatory cytokine genes. A represents the gene expression level of inflammatory cytokine IL-1α; B represents the gene expression level of inflammatory cytokine IL-1β; C represents the gene expression level of inflammatory cytokine IL-6; D represents the gene expression level of inflammatory cytokine iNOS; **** represents highly significant (P<0.0001), n=3.

[0051] Figure 17 This describes the effect of IZUMO2 protein on the expression levels of inflammatory cytokine proteins. A represents the protein expression level of inflammatory cytokine IL-6; B represents the protein expression level of inflammatory cytokine TNF-α; n = 3. Detailed Implementation

[0052] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0053] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0054] Example 1: Verification of the full-length porcine IZUMO2 nucleotide CDS

[0055] According to NCBI search predictions, the CDS sequence of porcine IZUMO2 nucleotides (accession number: XM_021094780.1) is a 951 bp sequence. However, repeated conventional PCR amplifications failed to fully express the CDS sequence. Subsequently, a segmented amplification method was used to amplify the 3' end of the porcine IZUMO2 nucleotide. The experimental steps are as follows:

[0056] Based on the 3' end sequence of porcine IZUMO2 nucleotides, specific primers were designed, and the primer sequences were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0057] IZUMO2-1F:

[0058] GGATCCCGCCACCATGGAGACCGACACCCTGCTGCTGTGGGTG

[0059] IZUMO2-1R:

[0060] CTCGAGTCAATGATGATGATGATGATGTG

[0061] RNA was extracted from testicular tissue of sexually mature boars according to the instructions of the Tiangen Biotech Animal Tissue Total RNA Extraction Kit, and cDNA was synthesized according to the TaKaRa Reverse Transcription Kit instructions. PCR amplification was performed using the synthesized specific primers, and the PCR products were subjected to 1% agarose gel electrophoresis. The results are as follows: Figure 2 As shown, the 3' end sequence of porcine IZUMO2 nucleotides was amplified, with a size of 627 bp.

[0062] Previous PCR amplification attempts using 5' end-specific primers failed to amplify the 5' end. Therefore, 5' RACE technology was employed to investigate the 5' end position of porcine IZUMO2 nucleotides. Based on the known 3' end nucleotide sequence, antisense primers RT1 and RT2 were designed for cDNA synthesis, and specific antisense primers R1 and R2 were designed for amplification of the 5' end cDNA fragment of the target gene. The sense primers were provided by the Sangon Biotech 5' RACE kit. Primer sequences were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0063] R1: TAAAGGACGCCACAAGGTCCAGCTG

[0064] R2: AGCGCGTAGTCTCGGAAGAAGGGC

[0065] RT1: TCGTCTTTCAGCAAGAGGCAA

[0066] RT2: TGGGACTAATCCTCTGGCAAT

[0067] Following the instructions of the Sangon Biotech 5'RACE kit, cDNA from the testicular tissue of sexually mature boars was used as a template, and the 5' end of porcine IZUMO2 nucleotides was amplified using the synthesized specific primers. The amplified 5'RACE product was sent to Sangon Biotech Ltd. for sequencing. The sequencing results, combined with the position of the specific antisense primer R2, determined the full-length CDS sequence of porcine IZUMO2 nucleotides. The results are as follows: Figure 3 As shown, a base sequence of approximately 270 bp was obtained. Based on the sequencing results and the position of the specific primer R2, the full-length CDS sequence of porcine IZUMO2 nucleotides was finally determined to be 627 bp, encoding 208 amino acids.

[0068] Example 2: IZUMO2 gene amplification and construction of eukaryotic expression plasmid

[0069] In previous experiments, our research group successfully expressed the full-length sequence of the IZUMO2 protein using a prokaryotic expression system. However, when expressing the full-length sequence of the IZUMO2 protein using a eukaryotic expression system, the target product could not be obtained. Analysis revealed that the expression failure might be due to the transmembrane structure. Therefore, this invention removes the transmembrane structure and the last intramembrane amino acid from the porcine IZUMO2 protein, allowing for eukaryotic expression of the extramembrane structure. The transmembrane structure of the porcine IZUMO2 protein after removing the signal peptide sequence was predicted based on data from the website http: / / www.cbs.dtu.dk / services / TMHMM / . Figure 4 It is known that the porcine IZUMO2 protein has only one transmembrane structure, located at the C-terminus of the protein, consisting of 21 amino acid residues, with the last amino acid residue at the C-terminus inside the cell membrane.

[0070] Based on the full-length nucleotide sequence of porcine IZUMO2, codon optimization was performed using frequently used synonymous codons in mammalian cells without altering the encoding amino acids. The transmembrane structure sequence of the IZUMO2 protein was removed, and the signal peptide was replaced. A kozak sequence was added to the 5' end, and a His tag sequence and a flexible peptide sequence were added to the 3' end. The optimized sequence was synthesized by Shanghai Sangon Biotech Co., Ltd. Specific primers were designed based on the optimized sequence, with a BamHI restriction site added upstream and an XhoI restriction site added downstream. The primer sequences were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0071] IZUMO2-2F:

[0072] GGATCCCGCCACCATGGAGACCGACACCCTGCTGCTGTGGGTG

[0073] IZUMO2-2R:

[0074] CTCGAGTCAATGATGATGATGATGATGTG

[0075] Using the target gene synthesized by Sangon Biotech as a template, PCR amplification was performed using the aforementioned synthesized specific primers. After electrophoresis, the target gene fragment was recovered according to the instructions of the Magen Gel DNA Miniature Recovery Kit. The concentration of the recovered product was calculated using a UV spectrophotometer and then stored at -20°C.

[0076] The recovered target gene IZUMO2 was double-digested with the CMV enhancer-MCS-EF1a-ZsGreen1-T2A-puro plasmid (purchased from GV707, plasmid number GV707) using the following digestion system: plasmid: 6 μL; BamHI: 6 μL; XhoI: 6 μL; 10×buffer: 6 μL; ddH2O: 36 μL. The mixture was digested at 37°C for 6 h to obtain the IZUMO2 gene fragment and the linearized CMV enhancer-MCS-EF1a-ZsGreen1-T2A-puro vector.

[0077] The enzyme digestion products were subjected to 1.5% agarose gel electrophoresis, and the gel was excised and recovered. The obtained DNA fragments were stored at -20°C for later use. The IZUMO2 fragment and the CMV enhancer-MCS-EF1a-ZsGreen1-T2A-puro plasmid were ligated using T4 ligase (ligation system: IZUMO2 gene fragment: 20 μL; CMV enhancer-MCS-EF1a-ZsGreen1-T2A-puro vector: 4 μL; 10×T4 DNA Buffer: 6 μL; T4 DNA Ligase: 1 μL; ddH2O: 29 μL. The mixture was incubated overnight at 16°C). The ligation products were transformed into BL21(DE3) Escherichia coli, and positive colonies were screened by plate coating. Positive colonies were identified by double enzyme digestion and sequencing. Colonies with correct sequencing results were engineered bacteria successfully transformed with the IZUMO2 gene. For strains with correct sequencing, the bacterial culture was preserved and recombinant plasmids were extracted according to the instructions of the endotoxin-free plasmid small-scale extraction kit from Tiangen Biotech Co., Ltd.

[0078] Example 3: Eukaryotic expression and Western blot detection of IZUMO2 protein

[0079] 293T cells were seeded into 10cm cell culture dishes, approximately 5 × 10⁶ cells / mL. 6Once the cell density reaches 70%, cells can be used for transfection (293T cells are cultured in DMEM complete medium). One hour before transfection, replace the complete cell medium with 5 mL of 2% serum medium (without penicillin and streptomycin), and return the cells to the cell culture incubator. Prepare the transfection reagent in a 1.5 mL centrifuge tube. Add 500 μL of DMEM medium to the centrifuge tube, and then add 20 μg of the recombinant plasmid / empty vector prepared in Example 2, 15 μg of pHelper 1.0 vector plasmid, and 10 μg of pHelper 2.0 vector plasmid to the medium. Mix well by pipetting. In another 1.5 mL centrifuge tube, add 500 μL of DMEM medium and 60 μL of LentiFit transfection reagent. Mix gently and incubate at room temperature for 5 min. Combine the two liquids, mix gently by pipetting, and incubate at room temperature for 15 min. Slowly add the transfection reagent dropwise to the 293T cell culture medium, mix well, and incubate at 37°C in a cell culture incubator containing 5% CO2 for 6-8 hours. Discard the culture medium containing the transfection reagent, wash once with 4 mL of PBS buffer, and add DMEM complete culture medium. Continue incubation for 48 hours, collect the supernatant, and replace with fresh complete culture medium. After another 24 hours, continue collecting the supernatant. Filter the collected supernatant, perform ultrafiltration centrifugation, and store the concentrated lentivirus solution at -80°C for later use.

[0080] Resuscitate CHO-K1 cells, propagate and passage them (CHO-K1 cells were cultured in DMEM / F12 complete medium). Follow the regimen of 1×10⁶ cells / cells. 5 The cells were passaged into T25 cell culture flasks at a density of 60%-70% and then infected. 2 mL of complete culture medium (without antibiotics) was added to a 15 mL centrifuge tube, followed by 80 μL of HitransGA reagent and 5 μL of concentrated lentivirus solution. The mixture was gently pipetted to mix. The complete culture medium was discarded and replaced with complete culture medium containing lentivirus. 8-16 h post-infection, the medium was replaced with fresh complete culture medium. The cells were cultured for another 72 h, and GFP expression efficiency was observed using a fluorescence microscope. If the infection efficiency was high, the medium was replaced with complete culture medium containing 6 μg / mL puromycin for drug screening. The medium was changed every 2-4 days, and a CHO-K1-IZUMO2 positive cell line was obtained after one week.

[0081] RNA was extracted from CHO-K1-IZUMO2 cells, cells transfected with empty vector plasmids, and untreated cells according to the instructions of the Tiangen Biotech Animal Tissue Total RNA Extraction Kit. cDNA was synthesized according to the TaKaRa Reverse Transcription Kit instructions. RT-PCR was performed using primers IZUMO2-2F / R, and the results are as follows: Figure 5As shown, the IZUMO2 gene is expressed in CHO-K1-IZUMO2 cells. Cell supernatants were collected from CHO-K1-IZUMO2 cells, cells transfected with an empty vector plasmid, and untreated cells, and 100 μL was used for Western blotting. The results are shown below. Figure 6 As shown, IZUMO2 protein was expressed in the supernatant of positive cells, with a molecular weight of 24 kDa, consistent with the expected size.

[0082] Example 4: Purification and Identification of IZUMO2 Eukaryotic Protein

[0083] A large amount of supernatant from CHO-K1-IZUMO2 cells was collected, centrifuged, and filtered. Protein purification was performed using affinity chromatography, with the following steps: The supernatant was loaded onto a Ni-IDA-Sepharose Cl-6B affinity chromatography column pre-equilibrated with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min using a peristaltic pump; the Ni column was washed with 5-10 column volumes of Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min; the Ni column was washed with 5-10 column volumes of Ni-IDA Washing-Buffer at a flow rate of 1 mL / min; the target protein was eluted with 5-10 column volumes of Ni-IDA Elution-Buffer at a flow rate of 1 mL / min, and the eluent was collected; the collected protein eluent was placed in a dialysis bag and dialyzed in PBS buffer at 4°C for 12 h. Dialysis was repeated three times to obtain the target protein, which was then verified by SDS-PAGE. The results are shown below. Figure 7 As shown, after purification, IZUMO2 protein with high purity was obtained. The target band was excised and analyzed by LC-MS / MS mass spectrometry, and the results are as follows. Figure 8 As shown, the amino acid sequence of the protein is compared with that of the porcine IZUMO2 protein, and the peptide coverage reaches 60%, indicating that the protein is a recombinant porcine IZUMO2 protein.

[0084] In addition, the eukaryotic protein was verified by glycosylation enzyme digestion. Compared with the IZUMO2 protein expressed in prokaryotes, the eukaryotic protein was found to have glycosylation modification.

[0085] Example 5: Preparation of IZUMO2 monoclonal antibody

[0086] Twelve 6-week-old female BALB / c mice (purchased from Guangdong Provincial Experimental Animal Center) were selected and randomly divided into two groups: a control group and an experimental group. 50 μg of the purified IZUMO2 protein solution prepared in Example 4 was mixed with 50 μL of water-soluble adjuvant and thoroughly mixed. The mice were injected intramuscularly into their hind legs on days 0 and 21. The control group was injected with the PBS and water-soluble adjuvant mixture using the same method. The specific immunization schedule is shown in Table 1. One week after the booster immunization, approximately 100 μL of blood was collected from the mice via tail vein sampling. The blood was centrifuged at 4000 rpm for 10 min at 4°C, and the serum was collected and stored at -80°C. The serum from the control group served as a negative control. The serum titer of the mice was detected using an indirect ELISA method. The results are shown in Table 2. Two mice had serum titers above 128,000.

[0087] One week prior to hybridoma cell fusion, SP2 / 0 cells were revived and passaged for expansion. On the day of fusion, logarithmically growing SP2 / 0 cells were harvested, centrifuged at 1100 rpm for 3 min, washed twice with culture medium, and 2 × 10⁶ cells were collected. 7 Cells were placed in a cell culture incubator for later use. One day before fusion, a healthy BALB / c mouse was euthanized by cervical dislocation. Under aseptic conditions, 7 ml of HAT-1640 medium was injected intraperitoneally, and the mouse's abdomen was gently massaged with a finger. Peritoneal fluid was aspirated. The cells were centrifuged at 1200 rpm for 6 min. The supernatant was discarded, and the cells were resuspended in 1 ml of HAT-1640 complete medium, adjusting the cell concentration to 1 × 10⁻⁶ cells / mL. 5 / mL, mix well, and plate onto 96-well culture plates, 100μL per well, and place in a cell culture incubator as a feeder layer for cell culture. Select mice with a titer of 128000, grind their spleens, and take 1×10 8 Spleen cells were fused with SP2 / 0 cells at a ratio of 5:1. Centrifuge at 1200 rpm for 5 min to remove as much residual supernatant as possible. Gently tap the centrifuge tube to loosen the cells. Within 1 min, add 1 mL of PEG 1450 to the cell pellet using a pipette, gently shaking to mix thoroughly. Incubate at 37°C for 90 s, then add 10 mL of HAT-1640 medium at a constant rate over 3 min to terminate the PEG 1450 incubation. Centrifuge the cell suspension at 800 rpm for 6 min and discard the supernatant. Resuspend the cell pellet in 10 mL of HAT-1640 complete medium and add 100 μL / well to a 96-well plate containing a feeder layer. On day 5, partially replace the fused cells with HAT medium, and completely replace the medium with HT medium on day 7. Screening of positive wells begins on day 10.

[0088] Positive cell wells were detected using an indirect ELISA method. Wells with higher absorbance values ​​were labeled and subcloned using a limiting dilution method. Cells were resuspended, counted, and diluted to 100 μL per well, theoretically ensuring one hybridoma cell per well. Hybridoma cell subcloning was continued for three rounds of subcloning until the positive cell rate in each well reached 100%. This indicated the acquisition of a hybridoma cell line that stably secretes the IZUMO2 monoclonal antibody.

[0089] Eight-week-old female healthy BALB / c mice were selected, and each mouse was intraperitoneally injected with 500 μL of incomplete Freund's adjuvant. Seven days later, the mice were divided into groups of three, with one hybridoma cell line per group. Hybridoma cells were pre-collected, washed twice with 1640 medium, resuspended in basal medium, and adjusted to a concentration of 2 × 10⁻⁶. 6 Cell / mL. 500 μL was injected intraperitoneally into each mouse. Approximately 7-10 days later, ascites fluid was collected from mice with distended abdomens. Ascites fluid could be collected again approximately 3-4 days later. The collected ascites fluid was centrifuged at 2000 rpm for 15 min, and the supernatant was collected. The supernatant was purified to obtain the IZUMO2 monoclonal antibody.

[0090] The titer of the IZUMO2 monoclonal antibody was determined, and the results are shown in Table 3, with a titer as high as 128,000. The specificity of the monoclonal antibody was detected by Western blotting, and the results are as follows: Figure 9 As shown, a protein band appears at the 24kDa position, indicating that the IZUMO2 monoclonal antibody can specifically recognize the IZUMO2 protein.

[0091] Table 1. Immunization schedule for mice

[0092]

[0093] Table 2 Serum titer of mouse immune IZUMO2 protein

[0094]

[0095] Table 3. IZUMO2 Monoclonal Antibody Titer Detection

[0096]

[0097] Example 6: Effects of IZUMO2 protein on sperm capacitation

[0098] 6.1 Test of the effect of protein / antibody on acrosome integrity

[0099] Fresh boar semen was collected and washed twice with semen washing solution at 1300 rpm for 4 min to remove seminal plasma. The semen was resuspended in the washing solution and divided into two groups. One group was supplemented with 0, 3, 5, 8, and 10 μg / mL of eukaryotic recombinant IZUMO2 protein, respectively; the other group was supplemented with 3, 6, 12, and 24 μg / mL of IZUMO2 antibody (using mouse IgG as a negative control). After incubation at 37℃ for 30 min, 20 μL of semen from each group was spread onto a glass slide and dried at 56℃ for 5 min. FITC-PNA working solution was added to the semen and incubated at 37℃ in the dark for 30 min. The working solution was then removed by centrifugation and incubated with Hoechst working solution at 37℃ in the dark for 5 min. The semen was washed three times with PBS buffer, 5 min each time. The semen was observed and photographed under a fluorescence microscope for analysis. Five fields of view were selected each time, with at least 200 sperm cells selected in each field, and at least three replicates were required for each group. Figure 10 The FITC-PNA shown fluoresces the sperm acrosome in green, while Hoechst fluoresces the sperm nucleus in blue. The integrity of the sperm acrosome was analyzed.

[0100] The results are as follows Figure 11 and Figure 12 As shown, the acrosome integrity rate in the group with 10 μg / mL eukaryotic protein was significantly lower than that in the control group (P<0.05). In the groups with different concentrations of IZUMO2 antibody, the acrosome integrity rates in the 6, 12, and 24 μg / mL antibody groups were significantly higher than those in the control group (P<0.01).

[0101] 6.2 Effects of Protein / Antibody on Sperm Capacitation

[0102] Fresh boar semen was collected and washed twice with semen washing solution at 1300 rpm for 4 min to remove seminal ether. The semen was divided into two portions. One portion was resuspended in capacitation solution for sperm capacitation. The capacitation solution formula is as follows: Weigh 0.6611 g NaCl, 0.0224 g KCl, 0.1102 g CaCl2·2H2O, 0.2324 g Tris, 0.1982 g D-Glucose, 0.055 g sodium pyruvate, and 0.01 g sodium heparin into a 100 mL beaker. Dissolve the contents thoroughly in Milli-Q water, bring the volume to 100 mL, adjust the pH to 7.2–7.4, filter through a 0.22 μm filter, aliquot, and store at 4℃ for later use. Resuspend the sperm in the capacitation solution to achieve a sperm density of 102. 6The sample was prepared by adding 8 μg / mL of IZUMO2 protein and 24 μg / mL of IZUMO2 antibody to the test group. Another sample was resuspended in washed semen solution without capacitation treatment, and similarly treated with 8 μg / mL of IZUMO2 protein and 24 μg / mL of IZUMO2 antibody to prepare the pre-capacitation test group. The control group was prepared under the same conditions with the addition of an equal volume of PBS or mouse IgG. FITC-PNA and Hoechst staining were then performed, and the effect of IZUMO2 on acrosome integrity before and after sperm capacitation was analyzed by photographic analysis.

[0103] The results are as follows Figure 13 and Figure 14 As shown, after capacitation, the acrosome integrity rate in the IZUMO2 protein group was significantly lower than that in the control group (P<0.05); while in the antibody-added group, the acrosome integrity rate was significantly higher than that in the control group after capacitation (P<0.0001). This indicates that IZUMO2 protein can alter sperm acrosome integrity and promote sperm capacitation.

[0104] Example 7: Effect of IZUMO2 protein on embryo cleavage rate in in vitro fertilization experiments

[0105] Swine ovaries were collected from the slaughterhouse and placed in a thermos containing 37°C saline solution with penicillin and streptomycin. The ovaries were transported to the laboratory within 3 hours. The ovaries were washed three times with 37°C saline solution containing 1000 IU / mL penicillin and streptomycin. The ovaries were then transferred to clean saline solution and placed in a 37°C water bath. Follicles with a diameter of 3-6 mm were aspirated using a syringe. The follicular fluid was transferred to 50 mL centrifuge tubes. The follicular fluid was incubated in a 37°C water bath for 20 min. The supernatant was carefully discarded, and the ovaries were resuspended in 20 mL of preheated 37°C DPBS-PVA washing solution. The incubation period was repeated for 20 min, and this process was repeated three times. 3 mL of the washed follicular fluid was placed in a medium dish. Under a stereomicroscope (equipped with a 37°C warming plate), cumulus-oocyte complexes (COCs) with homogeneous cytoplasm and multiple layers of cumulus cells were selected. COCs were washed three times with DPBS-PVA, and then three times with pre-equilibrated oocyte maturation culture medium. The washed COCs were then placed in oocyte maturation culture medium pre-equilibrated for 6-12 hours. The cells were cultured for 44 hours in a cell culture incubator at 38.5℃, 5% CO2, and 100% relative humidity. After maturation, the cumulus cells surrounding the oocytes were removed using cumulus-removing fluid, and mature oocytes with extruded first polar bodies were selected. These were washed three times each with HN manipulation solution and fertilization solution, and then placed in a drop of fertilization solution pre-equilibrated for 12 hours. The cells were then returned to the incubator for fertilization.

[0106] Semen stored at 17℃ was removed and washed twice with washing solution at 1300 rpm for 4 min to remove seminal ether. The semen was then resuspended in capacitation solution and capacitation was performed using the flotation method for 40 min. 10 μL of the supernatant sperm was collected and its motility was observed under a stereomicroscope. The density of the motile sperm was adjusted to 102. 6 20 μL of diluted semen was placed into a fertilization droplet containing oocytes. Simultaneously, IZUMO2 eukaryotic protein (0, 3, 5, 8, 10 μg / mL) and IZUMO2 antibody (3, 6, 12, 24 μg / mL; mouse IgG was used as a negative control) were added to the fertilization droplet. The cells were incubated for 6-8 hours. The oocytes were washed three times with PZM-3 embryo culture medium and transferred to a pre-equilibrated PZM-3 embryo culture droplet. The cells were then placed in an incubator for further incubation. After 48 hours, the cleavage rate was observed. The cleavage criteria were as follows: Figure 15 As shown, the two-cell state can be clearly seen.

[0107] The results are shown in Tables 4 and 5. The cleavage rate of embryos added at 8 μg / mL and 10 μg / mL eukaryotic protein concentrations was significantly higher than that of the control group and the low-concentration group (P<0.05), and the cleavage rate of in vitro fertilization showed an increasing trend with increasing eukaryotic protein concentration. Conversely, the cleavage rate of the 24 μg / mL IZUMO2 antibody group was significantly lower than that of the control group and the 3 μg / mL antibody group (P<0.05), and the cleavage rate of in vitro fertilization showed a certain decreasing trend with increasing antibody concentration. These results indicate that IZUMO2 protein can improve the cleavage rate of embryos in porcine in vitro fertilization experiments.

[0108] Table 4. Effects of IZUMO2 eukaryotic protein on cleavage rate in in vitro fertilization

[0109]

[0110] Note: Data labeled with different letters showed significant differences (P<0.05).

[0111] Table 5. Effect of IZUMO2 antibody on cleavage rate in in vitro fertilization

[0112]

[0113] Note: Data labeled with different letters showed significant differences (P<0.05).

[0114] Example 8: Verification of the anti-inflammatory effect of porcine IZUMO2 protein

[0115] 8.1 Effect of protein on the expression levels of inflammatory factor-related genes by qPCR detection

[0116] Before the experiment, RAW264.7 cells were revived (cultured in DMEM complete medium), passaged, and expanded in culture. Cells were then cultured at a rate of 1×10⁶ cells / year. 6 Cells were seeded into six-well plates. When the cells reached 80%–90% confluence, they were divided into control and experimental groups. The control group received 0, 3, 5, 8, 10, and 15 μg / mL IZUMO2 recombinant protein in the culture medium, respectively; the experimental group received 0, 3, 5, 8, 10, and 15 μg / mL IZUMO2 recombinant protein, respectively. After co-incubation for 30 min, cells were stimulated with 1.5 μg / mL LPS. A blank control group and a positive control group (containing only LPS) were also included. Cells were collected 6 h after LPS addition, cDNA was extracted, and the expression levels of inflammatory genes were detected by qPCR using the primers listed in Table 6.

[0117] Table 6 Primer sequences for qPCR of inflammatory factors

[0118]

[0119] qPCR test results as follows Figure 16 As shown, in the absence of LPS induction, the addition of different concentrations of IZUMO2 eukaryotic protein did not significantly affect the mRNA expression levels of cellular inflammatory factors (P>0.05). In the LPS-only group, the mRNA expression levels of IL-1α, IL-1β, IL-6, and iNOS were significantly increased compared to the LPS-free group (P<0.0001). In the groups with LPS and different concentrations of porcine IZUMO2 eukaryotic protein, the mRNA expression levels of inflammatory factors were significantly decreased (P<0.0001).

[0120] 8.2 Detection of the effect of protein on the expression levels of inflammatory factors using an ELISA kit

[0121] Following the method in step 8.1, cells were cultured and experimental groups were set up. At 12h and 24h after LPS stimulation, cell culture supernatant was collected, centrifuged at 1500 prm for 5 min at 4℃ to remove cell pellet, and the inflammatory factor proteins in the supernatant were detected according to the instructions of the Linko Bio mouse IL-6 and TNF-α ELISA detection kit.

[0122] ELISA kit test results as follows Figure 17As shown, compared with the control group, the levels of IL-6 and TNF-α proteins in the LPS-only group were significantly increased (P<0.0001). However, in the groups with LPS and 5, 8, 10, and 15 μg / mL porcine IZUMO2 eukaryotic protein, the expression levels of inflammatory factors were significantly decreased compared with the control group (P<0.0001). Since TNF-α is an early inflammatory factor, its peak value in the inflammatory response usually occurs earlier than that of IL-6. Therefore, in the TNF-α detection, the expression level at 12 h was higher than at 24 h, while the expression level of IL-6 was higher at 24 h.

[0123] Experimental results demonstrate that the IZUMO2 eukaryotic recombinant protein prepared in this invention has the ability to reduce the expression of inflammatory factors in RAW264.7 cells, and has broad application prospects in the preparation of anti-inflammatory drugs.

[0124] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The use of a pig IZUMO2 eukaryotic protein in the preparation of an anti-inflammatory drug, characterized in that: The amino acid sequence of the pig IZUMO2 eukaryotic protein is shown in SEQ ID NO. 3.

Citation Information

Patent Citations

  • CN108840919A