Cadmium-tolerant protein ibcsase from ipomoea batatas and encoding gene and application thereof

By overexpressing the IbCSase protein and its encoding gene in sweet potato, the sweet potato's tolerance to cadmium was enhanced, solving the problem of growth restriction under heavy metal pollution and achieving a reduction in cadmium accumulation and an increase in cysteine ​​content.

CN118667789BActive Publication Date: 2026-06-05CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-07-31
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Sweet potatoes are affected by cadmium-contaminated soil, and current technologies lack effective gene cloning and bioengineering methods to improve their cadmium tolerance.

Method used

The IbCSase protein with the amino acid sequence SEQ ID No. 1 and its encoding gene were provided and overexpressed in sweet potato through bioengineering to enhance its tolerance to cadmium.

Benefits of technology

It improved the sweet potato's tolerance to cadmium, reduced cadmium accumulation, increased cysteine ​​content, and promoted plant growth under cadmium stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a cadmium tolerance related protein IbCSase of sweet potato and an encoding gene and application thereof, and belongs to the technical field of biotechnology, and particularly relates to the cadmium tolerance related protein IbCSase of sweet potato and the encoding gene and application thereof. The protein IbCSase is any one of the following: A1) a protein with an amino acid sequence as shown in SEQ ID No. 1; A2) a protein with more than 80% identity with the protein shown in A1) and the same function, which is obtained by substitution, deletion and / or addition of amino acid residues of the protein of A1); and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). By introducing the IbCSase encoding gene into wild type sweet potato, the tolerance of the plant to heavy metal cadmium can be improved, the IbCSase encoding gene can be applied to sweet potato breeding, and has wide application space and market prospect in the agricultural field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the cadmium-tolerant protein IbCSase in sweet potatoes, its encoding gene, and its applications. Background Technology

[0002] Due to the unreasonable discharge of industrial waste and domestic sewage, as well as the extensive use of agricultural inputs containing heavy metals, farmland soil has been contaminated with cadmium to varying degrees. Cadmium in the soil is easily absorbed and accumulated by crop roots, affecting the normal growth and development of crops and leading to a decline in crop quality. Sweet potatoes are widely cultivated in my country and play an important role in food supply, industrial production, and feed manufacturing. The edible parts of sweet potatoes are in direct contact with the soil, making them more susceptible to the toxic effects of cadmium during growth. Furthermore, cadmium is transmitted through the food chain, posing varying degrees of threat to human health.

[0003] Cysteine ​​synthase (CSase) catalyzes the reaction of sulfides with O-acetylserine (OAS) to produce cysteine ​​(Cys). Cysteine ​​then plays a significant role in the scavenging of reactive oxygen species in plants through cysteine ​​metabolism, thereby enhancing plant tolerance to cadmium stress. However, the cloning and functional studies of CSase genes in sweet potato have not yet been reported. Therefore, identifying new genes affecting cadmium tolerance in sweet potato and utilizing them through bioengineering is an effective way to improve sweet potato's tolerance to cadmium. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to effectively improve the cadmium tolerance of plants.

[0005] To address the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by this invention may be any of the following:

[0007] A1) A protein with the amino acid sequence shown in SEQ ID No. 1;

[0008] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1), which has more than 75% identity with the protein shown in A1) and has the ability to regulate plant cadmium tolerance; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 1 and conventional techniques such as the conserved substitution of amino acids, obtain a protein mutant with the same function as the amino acid sequence shown in SEQ ID No. 1 by substituting, deleting and / or adding one or more amino acids without affecting its activity.

[0009] A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in A1 above is named IbCSase. SEQ ID No. 1 consists of 325 amino acid residues.

[0011] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing.

[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tag proteins include, but are not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the IbCSase protein of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that have 75% or more of the nucleotide sequence identity with the IbCSase protein isolated in this invention, as long as they encode and function as IbCSase, are derived from and equivalent to the nucleotide sequence of this invention.

[0015] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0016] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid or nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences or nucleotide sequences, then the identity value (%) can be obtained.

[0017] In this document, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0018] In this document, the above 90% identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The protein mentioned above is derived from sweet potato ( Ipomoea batatas ).

[0020] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0021] B1) Nucleic acid molecules that encode the proteins described above;

[0022] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0023] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0025] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0026] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0027] B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

[0028] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:

[0029] E1) The CDS sequence is the cDNA or DNA molecule from position 1 to position 978 of SEQ ID No. 2;

[0030] E2) The nucleotide is the cDNA molecule or DNA molecule of SEQ ID No. 3.

[0031] The DNA molecule shown in positions 1 to 978 of SEQ ID No. 2 (which regulates cadmium tolerance in plants) IbCSase The gene encodes the protein IbCSase, whose amino acid sequence is SEQ ID No. 1.

[0032] The nucleotide sequence shown in SEQ ID No. 2 is the nucleotide sequence of the protein IbCSase encoding gene (CDS).

[0033] The present invention IbCSase Genes can be any nucleotide sequence that encodes the protein IbCSase. Considering codon degeneracy and the codon preferences of different species, those skilled in the art can use codons suitable for expression in a specific species as needed.

[0034] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in positions 1 to 978 of SEQ ID No. 2.

[0035] B1) The nucleic acid molecule may also include a nucleic acid molecule that has more than 95% identity with the nucleotide sequence shown at positions 1 to 978 of SEQ ID No. 2 and originates from the same species.

[0036] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0037] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector pCAMBIA1300-GFP.

[0038] Existing plant expression vectors can be used to construct structures containing... IbCSase Recombinant gene expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0039] use IbCSase When constructing recombinant plant expression vectors, any type of enhancing promoter or constitutive promoter can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0040] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0041] Using any vector capable of guiding the expression of exogenous genes in plants, the present invention can be used to... IbCSase Introducing genes or gene fragments into plant cells or recipient plants can yield transgenic cell lines and transgenic plants with altered cadmium tolerance. IbCSase Gene expression vectors can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0042] As a specific embodiment, the recombinant vector is the recombinant vector pCAMBIA 1300-IbCSase-GFP. The recombinant vector pCAMBIA 1300-IbCSase-GFP is a restriction endonuclease of the pCAMBIA 1300-GFP vector. KpnI and BamHI A recombinant plasmid was obtained by inserting a DNA fragment from positions 1 to 978 of SEQ ID No. 2 between the restriction enzyme sites, while keeping the other sequences of the pCAMBIA1300-GFP vector unchanged. The recombinant vector pCAMBIA 1300-IbCSase-GFP expresses the IbCSase protein shown in SEQ ID No. 1 of the sequence listing.

[0043] The microorganisms mentioned in this article may be yeast, bacteria, algae, or fungi. Among them, bacteria may originate from the genus *Escherichia* (…). Escherichia Erwinia ( Erwinia Agrobacterium tumefaciens ( ), Agrobacterium tumefaciens Agrobacterium Flavobacterium ( Flavobacterium Alcaligenes ( ) Alcaligenes ), Pseudomonas ( Pseudomonas ), Bacillus spp. ( Bacillus (e.g., Agrobacterium tumefaciens EHA105).

[0044] In one specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105 / pCAMBIA1300-IbCSase-GFP.

[0045] The recombinant Agrobacterium EHA105 / pCAMBIA 1300-IbCSase-GFP is a recombinant bacterium obtained by introducing the recombinant vector pCAMBIA 1300-IbCSase-GFP into Agrobacterium tumefaciens EHA105.

[0046] The present invention also provides the use of the protein IbCSase described above, or a substance regulating gene expression, or a substance regulating the activity or content of said protein, in any of the following:

[0047] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U1) in regulating the cadmium tolerance of plants.

[0048] The application of the protein or gene expression regulator or the substance that regulates the activity or content of the protein described in U2) in the preparation of products that regulate the cadmium tolerance of plants.

[0049] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U3 in the cultivation of plants with cadmium tolerance.

[0050] The application of the protein or gene expression regulator or the substance that regulates the activity or content of the protein described in U4) in the preparation of products that cultivate cadmium-tolerant plants.

[0051] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5) in plant breeding.

[0052] The application of the protein or gene expression regulator or the substance that regulates the activity or content of the protein described in U6) in reducing the content of the heavy metal cadmium in plants.

[0053] The application of the protein or gene expression regulator or the substance that regulates the activity or content of the protein described in U7) in improving the fresh weight and dry weight of plants under cadmium stress.

[0054] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U8 in increasing the cysteine ​​content of plants.

[0055] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein IbCSase.

[0056] In the above applications, the substance regulating gene expression or the substance regulating the activity or content of the protein can be a biological material related to the protein, and the biological material can be any of the following:

[0057] B1) Nucleic acid molecules that encode the proteins described above;

[0058] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0059] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0060] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0061] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0062] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0063] B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

[0064] In the above text, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:

[0065] 1) Regulation occurring at the transcriptional level of the aforementioned gene;

[0066] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene).

[0067] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm).

[0068] 4) Regulation of the translation of the aforementioned genes;

[0069] 5) Regulation of mRNA degradation of the aforementioned gene;

[0070] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0071] The present invention also provides a method for regulating the cadmium tolerance of plants, including regulating the activity and / or content of the proteins described above in the target plant, and / or the expression level of the genes encoding the proteins, to regulate the cadmium tolerance of the plants.

[0072] In the above method, regulating the activity and / or content of the protein IbCSase in the target plant, and / or the expression level of the gene encoding the protein, includes introducing the gene encoding the protein into the recipient plant. IbCSase The desired plant with altered cadmium tolerance was obtained; IbCSase The gene encodes the protein IbCSase.

[0073] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.

[0074] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0075] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0076] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.

[0077] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.

[0078] The present invention also provides a method for cultivating plants with altered cadmium tolerance, comprising: 1) increasing, enhancing and / or upregulating the expression level of the coding gene of the protein described above in the target plant, or / and increasing, enhancing and / or upregulating the activity and / or content of the coding gene of the protein described above, to obtain a plant with improved cadmium tolerance;

[0079] 2) Inhibit, reduce, or silence the expression level of the coding gene of the protein described above in the target plant, or / and inhibit, reduce, or silence the activity and / or content of the coding gene of the protein described above, to obtain a plant with reduced cadmium tolerance.

[0080] As one embodiment of the present invention, the method for cultivating plants with improved cadmium tolerance includes the following steps:

[0081] (1) Construct a system containing the following as shown in SEQ ID No. 2 IbCSase Expression vectors for gene coding sequences;

[0082] (2) Introduce the expression vector constructed in step (1) into plants;

[0083] (3) Plants with improved cadmium tolerance were obtained through screening and identification.

[0084] The present invention also provides a method for cultivating plants with improved cadmium tolerance, comprising the following steps: increasing the content of IbCSase protein in the plant to obtain plants with improved cadmium tolerance.

[0085] In this invention, the purpose of plant breeding includes cultivating plants with increased / decreased cadmium tolerance.

[0086] In this invention, the cadmium tolerance is mainly reflected in improving the plant's tolerance to the heavy metal cadmium, increasing the cysteine ​​content, reducing the cadmium content in the plant, and increasing the fresh weight and dry weight of the plant under cadmium stress conditions.

[0087] In this invention, the cadmium content is determined using dried samples of plants after cadmium-tolerant potted plant treatment and the HNO3-H2O2 microwave digestion-ICP method.

[0088] In the above applications or methods, the plant is any one of the following:

[0089] N1) Dicotyledonous or monocotyledonous plants; N2) Tubularflora plants; N3) Convolvulaceae plants; N4) Ipomoea plants; N5) Sweet potato.

[0090] This invention discovered the IbCSase protein and its encoding gene, and introduced the IbCSase protein encoding gene into sweet potato, resulting in overexpression. IbCSase Sweet potato positively transformed plants. Compared with wild-type controls, the positively transformed plants showed improved tolerance to the heavy metal cadmium, specifically manifested in increased cysteine ​​content and reduced cadmium accumulation in the body. Therefore, the present invention provides... IbCSase Genes and the proteins they encode play an important role in improving plant tolerance to the heavy metal cadmium, and have broad application prospects and market potential in the agricultural field. Attached Figure Description

[0091] Figure 1 These are the PCR amplification results of transgenic sweet potato plants; where M is the DNA marker, W is the negative control water, and P is the positive control (pCAMBIA1300- IbCSase -GFP), WT is the genomic DNA of the wild-type sweet potato plant Chestnut Fragrance, and CS-1 and CS-2 are overexpressed genes. IbCSase Genetically modified sweet potato plants.

[0092] Figure 2 In overexpression IbCSase Genetically modified sweet potato plants and wild-type sweet potato plants IbCSase Gene expression; where WT is the cDNA of wild-type sweet potato, and CS-1 and CS-2 are overexpressed genes. IbCSase cDNA of gene-transformed sweet potato plants.

[0093] Figure 3 For overexpression IbCSase Identification of cadmium tolerance in transformed and wild-type sweet potato plants; where A represents plant phenotypic identification; B represents statistical results of plant fresh and dry weights. WT represents wild-type sweet potato, and CS-1 and CS-2 represent overexpressed sweet potatoes. IbCSase Sweet potato transformation plants.

[0094] Figure 4 For overexpression IbCSase The content of heavy metal cadmium in sweet potato transformed plants and wild-type sweet potatoes; among them, WT is wild-type sweet potato, and CS-1 and CS-2 are overexpressed sweet potatoes. IbCSase Sweet potato transformation plants.

[0095] Figure 5 For overexpression IbCSase Cysteine ​​content in transformed sweet potato plants and wild-type sweet potato plants; where WT represents wild-type sweet potato, and CS-1 and CS-2 represent overexpressed plants. IbCSase Sweet potato transformation plants. Detailed Implementation

[0096] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0097] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0098] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0099] The Agrobacterium tumefaciens EHA105 used in the following examples has been described in: Liu Qingchang, Lu Dihui, Ma Biao, et al., Sweet potato cell suspension culture and effective plant regeneration, Journal of Agricultural Biotechnology, 1996. This biological material is available to the public from the applicant and is intended solely for repeating the experiments of this invention; it may not be used for any other purpose.

[0100] The sweet potato strain "JS6-5" in the following examples has been described in: Zhao Hongyuan. Transcriptome analysis of the sweet potato mutant JS6-5 with high anthocyanin content. IbMYB4 , IbMYB48 and IbMYC2 Cloning and functional identification of genes, Doctoral dissertation, China Agricultural University, 2018. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0101] The sweet potato variety "Chestnut Fragrance" used in the following examples has been documented in: Ren Zhitong. Overexpression IbCbEFP and IbSnRK1Characterization and Molecular Mechanism Analysis of Genetically Modified Sweet Potato Plants, Doctoral Dissertation, China Agricultural University, 2018. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0102] The method for establishing the sweet potato embryogenic cell suspension line in the following examples has been described in: Liu Qingchang, Lu Dihui, Ma Biao, et al., Sweet potato cell suspension culture and effective plant regeneration, Journal of Agricultural Biotechnology, 1996. This biological material is available to the public from the applicant and is intended solely for repeating the experiments of this invention and may not be used for any other purpose.

[0103] The vector pCAMBIA 1300-GFP used in the following examples was preserved by the Key Laboratory of Sweet Potato Biology and Biotechnology, Ministry of Agriculture and Rural Affairs, China Agricultural University. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention; it may not be used for any other purpose.

[0104] The cloning vector pMD19-T used in the following examples is a product of Takara Bio Engineering (Dalian) Co., Ltd., product catalog number 6013. The plant total RNA extraction kit is the Transzol Plant Total RNA Extraction Kit (catalog number: ET111) from TransGen Biotech (Beijing). The PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, PR047A) is a product of Takara Bio Engineering (Dalian) Co., Ltd.

[0105] The following examples used GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0106] Example 1 IbCSase Acquisition of genes

[0107] 1. Obtaining cDNA template

[0108] Total RNA was extracted from sweet potato cultivar 'JS6-5' plantlets using a plant total RNA extraction kit, and the total RNA was reverse transcribed into first-strand cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser kit.

[0109] 2. Using the Sweetpotato Garden database (http: / / sweetpotato-garden.kazusa.or.jp / index.html) IbCSase Blastx analysis was performed on the genes to identify complete gene ORFs that are highly similar to EST sequences.

[0110] 3. Design and artificially synthesize primers IbCSase -F and IbCSase Using the cDNA obtained in step 1 as a template, PCR amplification was performed to obtain a PCR amplification product of approximately 978 bp. This product was then ligated with the cloning vector pMD19-T to obtain the recombinant vector pMD19-T-. IbCSase And sequencing was performed. The primer sequences are as follows:

[0111] IbCSase -F: 5'-ATGGGAGAGGAGCAGATTGG -3';

[0112] IbCSase -R: 5'- TCAAGACTCAAAGGTCATGTTTTCT -3'.

[0113] The results showed that the nucleotide sequence of the PCR amplification product was as shown in positions 1 to 978 of SEQ ID No. 2, and the gene represented by this sequence was named... IbCSase The gene encodes a protein named IbCSase protein or protein IbCSase, with the amino acid sequence shown in SEQ ID No. 1.

[0114] Example 2: Application of IbCSase protein in improving cadmium tolerance in plants

[0115] I. Recombinant plasmid pCAMBIA1300- IbCSase Construction of -GFP

[0116] 1. A double-stranded DNA molecule, as shown in positions 1 to 978 of SEQ ID No. 2, was artificially synthesized. Using this double-stranded DNA molecule as a template, pCAMBIA1300- IbCSase -F ( Kpn I) / pCAMBIA1300- IbCSase -R ( Bam Using HI as primers, PCR amplification was performed, yielding a product containing a restriction endonuclease at the N-terminus. Kpn The I and C terminals contain restriction endonucleases. Bam HI double-stranded DNA molecule.

[0117] pCAMBIA1300- IbCSase -F ( Kpn I):

[0118] 5'-ACGGGGGACGAGCTC GGTACC ATGGGAGAGGAGCAGATTGG-3' (underlined is restriction endonuclease) Kpn I's identification sequence);

[0119] pCAMBIA1300- IbCSase -R ( Bam HI):

[0120] 5'-CATGTCGACTCTAGA GGATCC TCAAGACTCAAAGGTCATGTTTTCT -3' (underlined characters indicate restriction endonuclease) Bam HI recognition sequence).

[0121] 2. Using restriction endonucleases Kpn I and Bam The vector pCAMBIA 1300-GFP was digested with HI double enzymes, and the vector backbone of approximately 10442 bp was recovered.

[0122] 3. The N-terminus contains a restriction endonuclease. Kpn The I and C terminals contain restriction endonucleases. Bam HI double-stranded DNA molecules are processed using restriction endonucleases Kpn I and Bam Double digestion with HI yielded fragment 2 containing approximately 1020 bp.

[0123] 4. Ligate fragment 2 to vector backbone 1 to obtain recombinant plasmid pCAMBIA1300- IbCSase -GFP.

[0124] Based on the sequencing results, the recombinant plasmid pCAMBIA 1300- IbCSase -GFP is structurally described as follows: The restriction endonuclease of the recombinant plasmid pCAMBIA1300-GFP is... Kpn I and Bam The small fragments between the HI recognition sequences are replaced with DNA molecules shown in positions 1 to 978 of SEQ ID No. 2, and the recombinant plasmid can express the IbCSase protein shown in SEQ ID No. 1.

[0125] II. Overexpression IbCSase Obtaining transgenic sweet potato plants

[0126] 1. The recombinant plasmid pCAMBIA 1300- IbCSase-GFP transformation of Agrobacterium tumefaciens EHA105 yielded recombinant Agrobacterium, which was named EHA105 / pCAMBIA 1300- IbCSase -GFP.

[0127] 2. Preparation of sweet potato embryogenic suspension cell clusters: The embryogenic cell suspension culture line of the sweet potato variety "Lizixiang" was established according to the method of Liu Qingchang et al. (1996). Bright yellow suspension cells with good growth status after subculture for about 8-12 weeks were selected and gently ground on a small-pore sieve (30 mesh) for about 5-10 minutes to create wounds. After cleaning, the cells were cultured for 3 days and then used as genetic transformation recipients.

[0128] 3. Culture of Agrobacterium: Activate the Agrobacterium culture on antibiotic-resistant plates, pick a single colony and inoculate it into 20 mL of LB liquid medium (containing Kans antibiotic, concentration 100 mg / L) with the corresponding antibiotic added. Incubate overnight at 28°C with shaking at 200 rpm until OD is reached. 600 The value was in the range of 0.5-0.7. Centrifuge at 5000 rpm and discard the supernatant. Wash the cells twice with an equal volume of LB medium, then wash once with an equal volume of MS liquid medium containing 2.0 mg / L 2,4-D. Resuspend the cells in an equal volume of MS liquid medium containing 2.0 mg / L 2,4-D to obtain recombinant Agrobacterium EHA105 / pCAMBIA 1300- IbCSase –GFP bacterial culture.

[0129] 4. Infection and Co-culture: Chestnut embryogenic cell clusters were suspended in the prepared Agrobacterium EHA105 / pCAMBIA1300 medium. IbCSase In the -GFP bacterial suspension, shake for a moment to fully disperse the cells so that the chestnut embryogenic cell clusters can fully contact the bacterial suspension. Let stand for 5 minutes, then use a pipette to aspirate the bacterial suspension. Transfer the infected embryogenic cell clusters to MS solid medium containing 30 mg / L AS and 2.0 mg / L 2,4-D for co-culture. Place a layer of ordinary filter paper on the solid medium and incubate in the dark at 27±1℃ for 3 days.

[0130] 5. Selection Culture and Regeneration of Transgenic Plants: After 3 days of co-culture, embryogenic cell masses were gently scraped off with a blade and washed three times with MS liquid medium containing 500 mg / L Carb and 2.0 mg / L 2,4-D. The cells were then transferred to MS liquid medium containing 100 mg / L Carb and 2.0 mg / L 2,4-D and cultured for 1 week. The liquid medium was then aspirated as dry as possible, and the cells were placed on solid MS medium lined with 1-2 layers of filter paper containing 5 mg / L Hyg, 100 mg / L Carb, and 2.0 mg / L 2,4-D for selection culture at 27±1℃ in the dark. After 2 weeks, well-grown callus tissue was transferred to solid MS medium lined with 1 layer of filter paper containing 11 mg / L Hyg, 100 mg / L Carb, and 2.0 mg / L 2,4-D for selection culture. Subculture was performed every 2 weeks thereafter. Resistant callus tissue formed after 8 weeks of culture on solid MS medium containing 11 mg / L Hyg, 100 mg / L Carb, and 2.0 mg / L 2,4-D was transferred to solid MS medium containing 100 mg / L Carb and 1 mg / L ABA, under conditions of 27±1℃, 13 h daily, and 3000 lux light, to induce somatic embryo formation. After 2-4 weeks of induction, mature somatic embryos were transferred to solid MS medium, under conditions of 27±1℃, 13 h daily, and 3000 lux light, and cultured for 4-8 weeks to regenerate complete transgenic plants. The regenerated plantlets were cut off and subcultured on solid MS medium under conditions of 27±1℃, 13 h daily, and 3000 lux light, with subculture every 6 weeks to obtain... IbCSase Proposed transgenic sweet potato lines.

[0131] 6. Identification of transgenic plants: A combination of PCR and RT-qPCR detection methods was used.

[0132] 1) The PCR detection method is as follows:

[0133] Extracting chestnut aroma (WT) from wild-type sweet potato plants and IbCSase DNA from the proposed transgenic sweet potato transformation lines was identified by PCR. pCAMBIA 1300- IbCSase The vector plasmid served as a positive control, while water and wild-type WT served as negative controls. The primers are as follows:

[0134] 35S-F: 5'- GACGCACAATCCCACTATCC -3';

[0135] IbCSase -R:5'- TCAAGACTCAAAGGTCATGTTTTCT -3'.

[0136] The amplified PCR products were separated by electrophoresis on a 1% (w / v) agarose gel. PCR-positive plants should have a specific 1050 bp electrophoretic band. The strain number of the PCR-positive plants was recorded.

[0137] The results are as follows Figure 1 As shown, only the positive control and IbCSase Overexpression lines CS-1 and CS-2 showed electrophoretic bands around 1050 bp, while wild-type sweet potato and the negative control did not show any bands. This preliminarily confirms that the overexpression strain obtained in this invention... IbCSase Gene-positive sweet potato plants CS-1 and CS-2.

[0138] 2) RT-qPCR

[0139] RNA was extracted from positive transgenic sweet potato plants, reverse transcribed to obtain cDNA, and then subjected to RT-qPCR, with WT as a control.

[0140] Sweet potato actin (AY905538) was used as an internal control:

[0141] Actin- F: 5'-GCACCCTGTTCTTACCGA-3';

[0142] Actin- R: 5'-AGTAAGGTCACGTCCAGCAAGG-3'.

[0143] IbCSase The primer sequences are:

[0144] IbCSase -qRT-F: 5'- ATGTGTTGCTCGTATTGCGG -3';

[0145] IbCSase -qRT-R:5'-GAGGACACTCTCCCCTGGTT-3'.

[0146] The results are as follows Figure 2 As shown, the results indicate that IbCSase The expression level of [the substance] was significantly increased in sweet potato positive plants CS-1 and CS-2.

[0147] III. Overexpression IbCSaseIdentification of cadmium tolerance in positively transformed plants

[0148] 1. Overexpression IbCSase Cadmium tolerance identification of positively transformed plants in pots

[0149] Wild-type *Chestnut Fragrance* plants (WT) 90 days after planting were harvested from isolated fields, and two overexpression markers were obtained. IbCSase Stem segments (approximately 25 cm long, containing 3 nodes) from sweet potato plants CS-1 and CS-2 were transplanted into greenhouse transplanting boxes. After new leaves emerged from the stem segments, cadmium tolerance was assessed in pots. The potted plants were watered every other day with 200 mL of Hogrange solution containing 100 mM CdCl2 for 6 weeks.

[0150] The result after processing is as follows Figure 3 As shown in A and B, compared to the wild type, IbCSase The overexpressing plants grew better under heavy metal cadmium stress, while the wild-type plants grew worse, root growth was inhibited, leaves turned yellow and gradually withered and fell off, and their fresh weight and dry weight were significantly lower than those of the transgenic plants.

[0151] 2. Overexpression IbCSase Determination of cadmium content in positively transformed plants

[0152] The cadmium content in the samples was determined using microwave digestion-ICP method with HNO3-H2O2, following the method described in the reference: Liu, Hui; Sun, Xiulan. (2021). Determination of 18 elements in sweet potatoes by microwave digestion-ICP-MS. Grain and Feed Industry, 67-71. (The text also mentions cadmium-tolerant potted plants, but the context is unclear.) IbCSase Using dried samples of transgenic plants as materials, the study compared WT and two overexpressing genes. IbCSase The content of the heavy metal cadmium was determined in the positively transformed plants CS-1 and CS-2.

[0153] The results are as follows Figure 4 As shown, compared with wild-type plants, overexpression IbCSase The accumulation of cadmium was significantly reduced in positively transformed plants, indicating that... IbCSase Genes reduced the accumulation of cadmium in genetically modified sweet potatoes.

[0154] 3. Determination of cysteine ​​content

[0155] The cysteine ​​content assay kit (Suzhou Keming Biotechnology Co., Ltd., catalog number: CYS-1-W) was used to detect the cadmium-treated transcysteine ​​in step 1. IbCSase Cysteine ​​content in sweet potato plants. Wild-type sweet potato plant (Chestnut Fragrance) was used as a control (WT). The experiment was repeated three times, and the average result was taken.

[0156] Experimental results are as follows Figure 5 As shown, two overexpressed IbCSase The cysteine ​​content of the positively transformed plants CS-1 and CS-2 was significantly higher than that of the control plants.

[0157] The above results indicate that importing IbCSase Genes can enhance sweet potatoes' tolerance to the heavy metal cadmium.

[0158] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The use of a substance that increases the expression of a protein-coding gene or enhances the content of said protein in any of the following: U1) Application in cultivating plants with improved cadmium tolerance; U2) Application in the preparation of products that cultivate plants with improved cadmium tolerance; Application of U3 in reducing the content of the heavy metal cadmium in plants; U4) Application in improving the fresh and dry weight of plants under cadmium stress; The protein is derived from sweet potatoes ( Ipomoea batatas The protein is a protein with the amino acid sequence shown in SEQ ID No. 1; The plant in question is sweet potato; The substance is a biological material related to the protein, and the biological material is any one of B1) to B7) below: B1) The nucleic acid molecule that encodes the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); Wherein B1) the nucleic acid molecule is a cDNA molecule or DNA molecule whose coding sequence is from position 1 to position 978 of SEQ ID No.

2.

2. A method for improving cadmium tolerance in plants, characterized in that, This includes increasing the content of the protein described in claim 1 in the target plant, and / or the expression level of the gene encoding the protein described in claim 1, to regulate the plant's cadmium tolerance; the plant is sweet potato.

3. The method according to claim 2, characterized in that: The method of increasing the content of the protein described in claim 1 in the target plant, and / or the expression level of the gene encoding the protein described in claim 1, includes introducing the gene encoding the protein into the recipient plant to obtain a plant with higher cadmium tolerance than the recipient plant; the gene encoding the protein described in claim 1.

4. Methods for cultivating plants with altered cadmium tolerance, including: The expression level of the gene encoding the protein described in claim 1 in the target plant is increased, enhanced, and / or upregulated, or the content of the gene encoding the protein described in claim 1 is increased, to obtain a plant with improved cadmium tolerance; the plant is sweet potato.

Citation Information

Patent Citations

  • Transformed plant having heavy metal resistance and heavy metal scavenging ability

    JP2002253072A