Caenorhabditis elegans disease model, method for constructing the same and application thereof
By constructing a NOTCH2NLC GGC repeat amplification mutant transgenic model in Caenorhabditis elegans and inserting the NOTCH2NLC gene fragment using CRISPR-Cas9 technology, the problem of the lack of NIID animal models in the existing technology was solved, enabling efficient simulation of disease progression and drug screening, and promoting the development of NIID treatment strategies.
Patent Information
- Application Number
- CN202410736644.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-07
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2044-06-07
AI Technical Summary
Current technologies lack effective animal models to study intranuclear inclusion body disease (NIID) caused by NOTCH2NLC GGC repeat amplification mutations, and there is a lack of specific therapeutic drugs, making it difficult to understand the disease mechanism and develop treatment strategies.
A transgenic Caenorhabditis elegans model with NOTCH2NLC GGC repetitive amplification mutant was constructed. The human NOTCH2NLC gene fragment was inserted into the nematode using CRISPR-Cas9 technology. Homologous recombination repair technology was used to ensure the accuracy and stability of gene editing. C-NIID-1 and C-NIID-2 models were established to simulate the symptoms of human NIID disease.
It provides an efficient and low-cost research tool to rapidly simulate disease progression and screen drugs, improving research efficiency, reducing costs, promoting drug development for NIIDs, and alleviating the social and economic burden of the disease.
Smart Images

Figure CN118749495B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biomedical technology of animal model construction, and relates to a Caenorhabditis elegans disease model and a construction method and application thereof, in particular to a NOTCH2NLC gene GGC repeat expansion mutant transgenic nematode and a construction method and application thereof, and specifically relates to a NOTCH2NLC gene GGC repeat expansion mutant transgenic nematode C-NIID-1 and C-NIID-2 and a construction method and application thereof. BACKGROUND
[0002] Neuronal nuclear inclusion disease (NIID) is a group of rare and clinically diverse neurodegenerative diseases, and its pathological features include the formation of eosinophilic hyaluronic acid nuclear inclusion bodies in the central and peripheral nervous system and internal organs. At present, more than 95% of NIID in China is related to NOTCH2NLC GGC (human NOTCH2NLC (partial)) repeat expansion mutation. However, the specific mechanism of how NOTCH2NLC GGC repeat expansion mutation affects cell function and causes NIID is not fully understood, and there is a lack of specific treatment drugs, and it is urgent to develop new simple and efficient animal models to promote the research and development process of NIID pathogenesis and drugs.
[0003] In the field of biomedical research, the establishment of animal models is of great importance for understanding the mechanism of human diseases, development rules and developing treatment strategies. Nematodes (Caenorhabditis elegans) are considered a good model animal due to their high homology with human genes, short life cycle, clear genetic background, and easy genetic manipulation, etc. Especially, its simple neural system structure and various behavioral responses make it more widely used in the research of nervous system diseases, phenotype analysis and drug screening.
[0004] The present application overcomes the difficulty of cloning GGC repeat sequences, successfully expresses 100 GGC repeat sequences of human NOTCH2NLC gene in Caenorhabditis elegans, and shows similar behavioral disorders and premature aging symptoms as human NIID disease. This model is a good animal model for studying the pathogenesis of NOTCH2NLC GGC repeat sequences and drug screening. SUMMARY
[0005] Invention purposes: In order to overcome the deficiencies in the prior art, the present application provides a Caenorhabditis elegans model for neurodegenerative diseases and a construction method and application thereof, in particular, a NOTCH2NLC GGC repeat expansion mutation transgenic Caenorhabditis elegans C-NIID-1 and C-NIID-2 and a construction method and application thereof.
[0006] Technical solutions: In order to achieve the above-mentioned purposes, the technical solutions adopted by the present application are as follows:
[0007] The first purpose of the present application is to provide a model for neurodegenerative diseases, which comprises Caenorhabditis elegans, wherein a fragment of NOTCH2NLC GGC is overexpressed in vivo, and the sequence of the fragment is shown as SEQ ID NO. 1.
[0008] The second purpose of the present application is to provide a method for constructing a model of neurodegenerative diseases, wherein the model of neurodegenerative diseases is a Caenorhabditis elegans disease model, and the Caenorhabditis elegans disease model comprises a Caenorhabditis elegans C-NIID-1 disease model and / or a Caenorhabditis elegans C-NIID-2 disease model, wherein,
[0009] The construction steps of the Caenorhabditis elegans C-NIID-1 disease model comprise:
[0010] S1, a repair template plasmid containing NOTCH2NLC GGC is constructed, wherein the repair template plasmid contains a Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence and a recombination arm before and after an editing site, and the human NOTCH2NLC(partial) is the NOTCH2NLC GGC;
[0011] S2, an injection mixture is prepared by mixing an sgRNA plasmid, a repair template plasmid, a Cas9 plasmid and a transgenic marker plasmid (marker), and the injection mixture is injected into wild-type Caenorhabditis elegans to construct a Caenorhabditis elegans C-NIID-1 disease model;
[0012] The construction steps of the Caenorhabditis elegans C-NIID-2 disease model comprise:
[0013] The Caenorhabditis elegans C-NIID-1 disease model is crossed with an OH15262 otIs669 V nematode to obtain a new double mutant strain, which is the Caenorhabditis elegans C-NIID-2 disease model.
[0014] A third objective of this invention is to provide the application of plasmids in constructing a Caenorhabditis elegans disease model, wherein the Caenorhabditis elegans disease model is as described above, and the gene sequence of the plasmid is shown in SEQ ID NO.2.
[0015] A fourth objective of this invention is to provide the application of a *C. elegans* disease model in screening drugs for neurodegenerative diseases, wherein the *C. elegans* disease model is as described above, and the neurodegenerative diseases include NIIDs.
[0016] This invention, through the construction of a transgenic nematode model with NOTCH2NLC GGC duplication amplification mutation, has the following key technical features:
[0017] Construction of recombinant plasmids for the human NOTCH2NLC gene: The NOTCH2NLC GGC sequence was cloned into pcDNA3.1 and fused to GFP. Mutations in repeat size, ATG start codon, or uN2C ORF were achieved via inverse PCR or oligonucleotide ligation to investigate the effects of different GGC repeat lengths on protein expression and cellular function. The upstream ORF of NOTCH2NLC fused to GFP, along with 100 optimized GGN repeat sequences, was cloned into pcDNA3-TetOn and pAAV2-CAG vectors. To ensure the stability of the repeat amplification, all plasmids containing GGC repeat sequences were transformed into STBL3 bacterial strain (Invitrogen). All constructs were confirmed by Sanger sequencing.
[0018] Construction of nematode expression plasmid: A nematode expression plasmid was constructed by enzyme digestion. The plasmid contains the Peft-3 promoter, a partial sequence of the human NOTCH2NLC gene (including the GGC repeat sequence) (human NOTCH2NLC(partial), as shown in SEQ ID NO.1), and unc-54 3'UTR, and is named Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR nematode expression plasmid. The nucleotide sequence is shown in SEQ ID NO.2.
[0019] Plasmid introduction: Using CRISPR-Cas9 technology, a highly efficient sgRNA site is selected and a corresponding repair template is designed to insert the target gene sequence into a specific genomic site in the nematode.
[0020] (4) The C-NIID-1 nematode model was created based on the N2 wild-type nematode background. The Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence was inserted into the cxTi10816 site of the nematode (located on chromosome IV, 1.41 + / - 0.001 cM from the chromosome endpoint) to simulate human NOTCH2 gene-related NIID disease.
[0021] (5) The C-NIID-2 nematode model uses OH15262 otIs669 V nematodes as a background, which contain fluorescent proteins that mark different neuronal colors. Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR
[0022] The nematode model (PHX8629) was hybridized with the OH15262 otIs669 V strain to obtain a new double mutant strain. This new strain, with the genotype PHX8630 sybIs8629[Peft-3-humanNOTCH2NLC(partial)-unc-54 3'UTR] IV; otIs669 V, carries genetic information from both parents, allowing for better simulation of human NOTCH2 gene-related NIID diseases.
[0023] Beneficial Effects: This patent application, by constructing a transgenic nematode model with NOTCH2NLC GGC repeat amplification mutation, has the following beneficial effects compared to previous technologies:
[0024] (1) Improved research efficiency: Traditional mammalian models suffer from high costs, long cycles, and complex operations when studying neurodegenerative diseases. Nematode models have a short lifespan (approximately 3-4 days), rapid reproduction, and are easy to genetically manipulate, allowing for the rapid acquisition of data from multiple generations. This significantly accelerates the establishment of disease models and drug screening, thus improving research efficiency.
[0025] (2) Reduced research costs: As a small model organism, the breeding cost of nematodes is much lower than that of mammalian models. In addition, gene editing technology for nematodes is relatively mature, and the introduction of the CRISPR-Cas9 system has further reduced the cost of gene manipulation.
[0026] (3) Enhancing the understanding of disease mechanisms: Through precise gene editing technology, this patent successfully simulated the human NOTCH2NLC GGC repeat amplification mutation, which is associated with a variety of neurodegenerative diseases. This model can provide intuitive information about the disease development process, help reveal the molecular mechanisms of the disease, and thus provide a scientific basis for the development of new treatments.
[0027] (4) Facilitating drug screening and the development of treatment strategies: The high-throughput screening capability of nematode models makes them an ideal platform for drug screening. Studies have shown that nematode models have high predictive value in drug screening for neurodegenerative diseases. In this way, potential drug candidates can be quickly identified, accelerating the drug development process.
[0028] (5) Social and economic impacts: Neurodegenerative diseases impose a heavy burden on patients' families and society. This patent, by providing a new research tool, can help accelerate the development of new therapies, potentially alleviating the social and economic impacts of these diseases. It is estimated that each year earlier an effective treatment is developed could save billions of dollars in healthcare costs. Attached Figure Description
[0029] Figure 1: Schematic diagram of NIID transgenic nematode model construction.
[0030] Figure 2: Secondary verification of the Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence. Figure 3 Secondary verification of OH15262 otIs669 V.
[0031] Figure 4: Survival rate detection of transgenic nematodes.
[0032] Figure 5: Differences in the motility (contact behavior) of transgenic nematodes, comparing the N2 group (control group) and the C-NIID1 group.
[0033] Figure 6: Western blot analysis of differences in uN2CpolyG protein expression among the three groups.
[0034] Figure 7: Immunofluorescence detection of GFP marker protein (uN2CpolyG protein aggregates) in C-NIID-1 group nematodes. Figure 8. Positive probiotic strains screened using the C-NIID-1 nematode model can revert to pathogenic NOTCH2NLC.
[0035] The influence of proteins on gene expression regulation. (A) Transcriptome analysis of the C-NIID-1 nematode strain and the control nematode strain; (B)
[0036] Transcriptome analysis of positive probiotic strains selected by feeding C-NIID-1 nematodes and control nematodes after feeding them with control strains. Detailed Implementation
[0037] This patent utilizes CRISPR-Cas9 technology to construct a nematode strain in *C. elegans* expressing the human NOTCH2NLC gene GGC repeat amplification sequence, solving several key problems of existing technologies in simulating and studying neurodegenerative diseases:
[0038] (1) The first NIID nematode disease model was constructed: Nematodes are a good model for studying the genetic mechanisms of nervous system diseases. The construction of the NIID nematode model is of great significance for the study of this disease.
[0039] (2) It overcomes the problem of constructing GGC repetitive sequence plasmids.
[0040] In the field of genetic engineering, constructing plasmids containing specific repetitive sequences is a technical challenge. This patent requires the precise construction of a plasmid containing 100 GGC repeats of the NOTCH2NLC gene. The main technical challenges in this process include:
[0041] ① Precise synthesis of repetitive sequences: The synthesis of GGC repetitive sequences requires high precision to ensure that they match the target gene sequence perfectly and to avoid introducing non-target mutations or errors.
[0042] ② Plasmid stability: Plasmids containing long repetitive sequences may exhibit instability in the host, which may lead to errors or loss of repetitive sequences during plasmid replication.
[0043] ③ Technical issues related to the stable and efficient expression of the human NOTCH2NLC gene in Nematodes.
[0044] ④ The technical issue of how to screen and identify NOTCH2NLC GGC repeat sequences after importing them.
[0045] In the NIID nematode model generated by this patent, 100 GGC repeat sequences of the human NOTCH2NLC gene were successfully transferred into nematodes and stably expressed in the nematodes, while producing a neurodegenerative phenotype consistent with human symptoms.
[0046] On one hand, the present invention proposes a model for neurodegenerative diseases comprising Caenorhabditis elegans, which overexpresses a fragment of NOTCH2NLC GGC in vivo, the sequence of which is shown in SEQ ID NO.1.
[0047] Optionally, in one embodiment of the invention, the neurodegenerative disease includes NIID.
[0048] On the other hand, this invention proposes a method for constructing a model of neurodegenerative diseases, wherein the model of neurodegenerative diseases is a *C. elegans* disease model, and the *C. elegans* disease model includes a *C. elegans* C-NIID-1 disease model and / or a *C. elegans* C-NIID-2 disease model, wherein...
[0049] The steps for constructing the *C. elegans* C-NIID-1 disease model include:
[0050] S1. Construct a repair template plasmid containing NOTCH2NLC GGC. The repair template plasmid contains the Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence and recombinant arms before and after the editing site. The humanNOTCH2NLC(partial) is the NOTCH2NLC GGC.
[0051] S2. Mix the sgRNA plasmid, repair template plasmid, Cas9 plasmid and transgenic marker plasmid to prepare an injection mixture, and inject it into wild-type Caenorhabditis elegans to construct a Caenorhabditis elegans C-NIID-1 disease model.
[0052] The steps for constructing the *C. elegans* C-NIID-2 disease model include:
[0053] The *C. elegans* C-NIID-1 disease model was hybridized with *OH15262 otIs669 V* nematode to obtain a new double mutant strain, which is the *C. elegans* C-NIID-2 disease model.
[0054] Optionally, in one embodiment of the present invention, in step S1, the gene sequence of NOTCH2NLC GGC is shown in SEQ ID NO.1. Optionally, in one embodiment of the present invention, in step S1, the gene sequence of the repair template plasmid is shown in SEQ ID NO.2. The repair template plasmid of the present invention contains the Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence and recombination arms before and after the editing site. The repair template is a DNA template used to guide cells to perform precise repair through homologous recombination repair (HDR) after DNA double-strand breaks. The repair template plasmid is designed according to the experimental purpose, and the sequence Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR, as shown in SEQ ID NO.2, is inserted at the cxTi10816 site in the pSL1190 plasmid. Optionally, in one embodiment of the present invention, in step S1, the plasmid construction method includes the following specific steps:
[0055] Plasmid construction: The NOTCH2NLC GGC sequence was cloned into a plasmid vector and fused to green fluorescent protein GFP to construct the plasmid containing the Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence (SEQ ID NO.2). The plasmid vector includes pcDNA3.1.
[0056] Optionally, in one embodiment of the present invention, in step S2, the sequence of the sgRNA plasmid is:
[0057] sgRNA positive chain:
[0058] 5'-ATTGCAAATCTAAATGTTT-N19 / N20-GTTTTAGAGCTAGAAATAGC-3';
[0059] sgRNA antisense strand:
[0060] 5'-GCTATTTCTAGCTCTAAAAC-N19 / N20-RC-AAACATTTAGATTTGCAAT -3'. sgRNA (small guide RNA) plasmids are vectors used to express sgRNA. In the CRISPR-Cas9 system, sgRNA acts as a guide, directing the Cas9 protein to specifically recognize and bind to the target DNA sequence. This invention selects suitable PAM sites and designs and constructs sgRNA plasmids, which are built by Shangyuan Biotechnology. We ensure that the target sequence conforms to the G / A(N)19NGG pattern, where G / A(N)19 represents a 20-nucleotide sequence capable of recognizing homologous double-stranded DNA in the genome, and NGG is the essential protospacer-associated motif (PAM). Cas9 plasmids are vectors used to express the Cas9 protein. Cas9 is a nuclease that binds to sgRNA to form a complex, precisely recognizing the target DNA sequence under the guidance of sgRNA and cleaving the double-stranded DNA at specific sites, producing double-strand breaks. This breakage can activate the cell's DNA repair mechanism. C-NIID-1 worms achieve gene knock-in through homologous recombination repair (HDR). The sgRNA plasmid provides guide RNA, the Cas9 plasmid provides the cutting enzyme, and the repair template provides the precise sequence information needed to repair the DNA breakage. In this way, CRISPR-Cas9 technology can achieve efficient and precise genome editing. The transgenic marker plasmid is the reporter plasmid (Psur-5::GFP). The reporter plasmid's function is to facilitate the selection of transgenic F1 worms based on its fluorescence after injection. This reporter plasmid is discarded during the subsequent selection process, ensuring that only the required precise insertion is achieved in the selected worms. Optionally, in one embodiment of the invention, the construction method includes constructing an sgRNA plasmid and a repair template plasmid, specifically: cloning the sgRNA sequence and the repair template plasmid into plasmid vectors suitable for nematode expression. Further optionally, in one embodiment of the invention, in step S1, the repair template plasmid includes any vector suitable for nematodes. In some examples of this invention, the carrier used is pSL1190.
[0061] Optionally, in one embodiment of the present invention, in step S2, the sgRNA plasmid, repair template plasmid, Cas9 plasmid and transgenic marker are mixed in a molar ratio of 100:50:100:5 to prepare an injection mixture.
[0062] Optionally, in one embodiment of the present invention, the transgenic marker plasmid includes an antibiotic resistance gene. The reporter plasmid used to create the C-NIID-1 nematode is fluorescent. Its function is to facilitate the selection of transgenic F1 nematodes based on the fluorescence of the reporter plasmid after injection. During the subsequent selection process, the reporter plasmid is discarded, ensuring that only the required precise insertion is achieved in the selected nematodes. Furthermore, all plasmids used are Ampicillin resistant.
[0063] Optionally, in one embodiment of the present invention, the injection refers to microinjection, specifically including: injecting the injection mixture into the gonads of wild-type Caenorhabditis elegans containing a high-efficiency sgRNA sequence.
[0064] Optionally, in one embodiment of the present invention, the method further includes:
[0065] S3. Screening for heterozygous nematodes;
[0066] S4. Screening for homozygous nematodes that stably overexpress the sequence shown in SEQ ID NO.1, which constitutes the *C. elegans* C-NIID-1 disease model. Further optionally, in one embodiment of the present invention, step S3 specifically includes the following steps:
[0067] S31. Screening for transgenic marker plasmids: Individuals containing transgenic marker plasmids are screened from the F1 generation nematodes and plated. These individuals will be used for subsequent screening and verification.
[0068] S32. Screening for heterozygotes: After the F1 generation of nematodes produces the F2 generation of nematodes, the F2 generation nematodes in each plate are lysed and used as templates. The F2 generation nematodes are then screened by PCR to preliminarily determine the existence of heterozygotes. These heterozygotes are then sequenced to verify whether the editing of the target gene was successful.
[0069] Further, optionally, in one embodiment of the present invention, step S4 specifically includes the following steps:
[0070] S41. Screening for homozygotes: The verified heterozygous nematodes are cultured separately, and after the progeny grows up, PCR screening is performed again to find homozygotes.
[0071] S42. Secondary Validation: The identified homozygous nematodes are subjected to secondary validation by being cultured separately, plated in 8-16 plates, and their progeny nematodes are lysed to serve as templates. PCR is used for secondary validation, and the nematodes are sequenced again to confirm the final sequence and ensure the accuracy of gene editing. Furthermore, this invention proposes the application of plasmids in constructing a *C. elegans* disease model, as described above, with the plasmid's gene sequence shown in SEQ ID NO. 2. Additionally, this invention proposes the application of the *C. elegans* disease model in screening drugs for neurodegenerative diseases, as described above, where the neurodegenerative diseases include NIIDs.
[0072] The present invention will be further described below with reference to the accompanying drawings and embodiments. The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the specific material ratios, process conditions, and results described in the embodiments are for illustrative purposes only and should not, and will not, limit the present invention as described in detail in the claims.
[0073] In the embodiments of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the embodiments of the present invention, unless specifically specified, the technical means used are conventional means well known to those skilled in the art.
[0074] Wild-type Caenorhabditis elegans N2 and Caenorhabditis elegans OH15262 otIs669 V were selected as biological experimental materials and purchased from the Caenorhabditis Genetics Center (CGC). See: https: / / cgc.umn.edu / strain / OH15262.
[0075] Example 1
[0076] As shown in Figure 1, the implementation method for constructing the NOTCH2NLC GGC repeat amplification mutant transgenic nematode involved in this patent is to construct a NIID transgenic nematode model using CRISPR-Cas9 technology, as detailed below:
[0077] Transgenic lines with specific genes were constructed in *C. elegans* using CRISPR-Cas9 technology. Double mutant lines were obtained through hybridization, and the gene sequences of the nematode model were validated. The key technical steps of this process are as follows:
[0078] (1) Plasmid construction: The NOTCH2NLCGGC sequence (as shown in SEQ ID NO.1) was cloned into the plasmid vector pcDNA3.1 and fused to the green fluorescent protein GFP to construct the plasmid.
[0079] (2) Selecting an sgRNA site: Select an efficient sgRNA site with no off-target risk. This site will be used to guide the Cas9 enzyme to precisely cut the target gene sequence.
[0080] (3) Design of repair template plasmid: Design a repair template plasmid according to the experimental purpose so that the Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence can be inserted at the cxTi10816 site. Construction of sgRNA plasmid and repair template: The sgRNA sequence and repair template plasmid are cloned into plasmid vectors suitable for nematode expression.
[0081] (4) Prepare the injection mixture: Mix the sgRNA plasmid, repair template plasmid, Cas9 plasmid and transgenic marker plasmid (such as antibiotic resistance gene) in a certain proportion to prepare the injection mixture.
[0082] (5) Microinjection: The mixture was injected into the gonads of a background strain (N2 wild-type nematode) containing a high-efficiency sgRNA site at the cxTi10816 site, which is the P0 generation nematode.
[0083] (6) Screening for transgenic markers: Individuals containing transgenic marker plasmids are screened from the F1 generation nematodes and plated. These individuals will be used for subsequent screening and verification.
[0084] (7) Screening for heterozygotes: After the F1 generation of nematodes produces the F2 generation of nematodes, the F2 generation nematodes (around L4) in each plate are lysed and used as templates. The F2 generation nematodes are then screened by PCR to preliminarily determine the presence of heterozygotes. These heterozygotes are then sequenced to verify whether the editing of the target gene was successful.
[0085] (8) Screening for homozygotes: The verified heterozygous nematodes are cultured separately, and after the offspring grow up, they are screened again by PCR to find homozygotes.
[0086] (9) Secondary verification: The homozygous nematodes were cultured separately, divided into 8-16 plates, and their progeny nematodes were lysed to use as templates for secondary verification by PCR. The nematodes were then sequenced again to confirm the final sequence and ensure the accuracy of gene editing.
[0087] (10) Hybridization to create double mutant lines: A nematode with a single copy of Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR (named PHX8629 sybIs8629[Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR] (C-NIID-1)) was hybridized with another nematode carrying a different mutation or marker (OH15262 otIs669 V) to create a double mutant line (named PHX8630 sybIs8629[Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR] IV; otIs669 V (C-NIID-2)).
[0088] (11) Verify the editing and insertion of the target gene:
[0089] 1. Verification of the Peft-3-human NOTCH2NLC(partial)-unc-54 3'UTR sequence. Wells 1-8 are eight cloned C-NIID-2-PHX8630 progeny. Results are attached. Figure 2 As shown in the figure, the OH15262 strain had no product (no band); the PHX8629 strain had 2042 bp, of which:
[0090] Primer 1 for the sybIs8629 allele:
[0091] sybIs8629-out-s:GGACTTCTCATCTTCATCGCT;
[0092] sybIs8629-mid-a:GCGGACGGTAGAGAGAATAA
[0093] Predicted size of OH15262: no band
[0094] Predicted size of PHX8629: 2042bp
[0095] PCR annealing temperature: 61°C
[0096] Table 1 PCR reaction components
[0097] Reaction components Volume The PCR volume 10 ul Worm lysate 0.5 ul CWBIO 2*Taq Mastermix 5 ul Primer sybIs8629-out-s (100uM) 0.05 ul Primer sybIs8629-mid-a (100uM) 0.05 ul ddH2O 4.4 ul Total 20 ul
[0098] Table 2 PCR reaction components
[0099]
[0100] ②Verification of OH15262 otIs669 V: Wells 1-8 are eight cloned C-NIID-2-PHX8630 progeny. Results are attached. Figure 3 As shown in the figure, the OH15262 strain has a product count of 1163 bp; the PHX8629 strain has no product (no band).
[0101] Primer 2 for the otIs669 allele:
[0102] otIs669-seq-s: TACCTTCATCAACCACCC;
[0103] otIs669-seq-a: CCCAGACGTGCGAAGAAATA
[0104] Predicted size of OH15262: 1163bp
[0105] Predicted size of PHX8629: no band
[0106] PCR annealing temperature: 61℃
[0107] Table 3 PCR reaction components
[0108] Reaction components Volume The PCR volume 10 ul Worm lysate 0.5 ul CWBIO 2*Taq Mastermix 5 ul Primer otIs669-seq-s(100uM) 0.05 ul Primer otIs669-seq-a (100uM) 0.05 ul ddH2O 4.4 ul Total 20 ul
[0109] Table 4 PCR reaction components
[0110]
[0111] (12) Behavioral testing and survival analysis: Motility, social behavior, learning and memory behaviors were measured in NIID group nematodes and control group nematodes. 100 synchronized Day 1 NIID group nematodes and control group nematodes were randomly selected and evenly distributed into 10 NGM culture media and cultured at 20°C. The survival rate of nematodes was tested in 5 media: nematodes were transferred to new culture dishes at the same time every day, and the survival status of nematodes was tested (nematodes were considered dead when their pharynx stopped moving or they did not move when touched with a needle); the social contact behavior and motility (average contact time, average number of contacts, average number of inputs and outputs) of nematodes in the other 5 media were tested using nematode behavior analysis software (wormstudio).
[0112] For a detailed survival rate analysis, please see the appendix. Figure 4 As shown in the figure, the survival rate of transgenic nematodes shows a consistent trend at different time points.
[0113] Behavioral tests are detailed in Table 5 and Appendix. Figure 5 As shown in the figure, the transgenic nematodes and N2 (control group) showed significant differences in motor function tests.
[0114] Table 5 Behavioral test results
[0115] VideoName TotalFrames FPS Resolution AverageContactTime AverageInOutNumber N2(1).mp4 4685 25 1280,960 49.68181818181818 5.3977272727272725 N2(2).mp4 4634 25 1280,960 54.73684210526316 9.552631578947368 N2(3).mp4 4841 25 1280,960 84.81632653061224 5.244897959183674 ZUB02 (1).mp4 4677 25 1280,960 112.32432432432432 2.225225225225225 ZUB02 (2).mp4 4408 25 1280,960 130.7311827956989 0.3655913978494624 ZUB02 (3).mp4 5098 25 1280,960 184.08695652173913 0.1956521739130435
[0116] (13) Western blot analysis of uN2CpolyG protein expression in nematodes: soluble and insoluble protein lysis buffers were prepared. Day 1 adult nematode tissues were lysed using the soluble protein lysis buffer, and the lysis buffers were ultracentrifuged to separate the supernatant and precipitate. The supernatant contained soluble oligomers, and the precipitate contained insoluble protein aggregates. The insoluble protein lysis buffer was added back to the precipitate, and after resuspending thoroughly, the precipitate was centrifuged. The supernatant contained the insoluble protein aggregates. The protein concentration was determined using the BCA method, and the protein solution was diluted with SDS loading buffer. The protein was subjected to electrophoresis-transfer-immunoblotting-staining treatment before image analysis.
[0117] The results are attached. Figure 6 As shown in the figure, NIID-stable Caenorhabditis elegans was constructed and screened using the CRISPR-Cas9 system. Western blot was used to verify the expression of uN2CpolyG protein in the NIID-stable Caenorhabditis elegans model. Compared with the control N2 group, the C-NIID1 group, and the C-NIID2 group, the expression level of uN2CpolyG protein in the experimental group was significantly increased.
[0118] (14) Immunofluorescence detection of uN2CpolyG protein expression in nematodes: The nematodes to be tested were washed repeatedly with M9 buffer, allowed to settle naturally for 3 minutes, and the supernatant was aspirated to remove impurities. Agarose slides were prepared, and the nematodes to be tested were placed on the agarose slides. The nematodes were anesthetized, and a single nematode was observed and photographed using an inverted fluorescence microscope.
[0119] The results are attached. Figure 7 As shown in the figure, the expression of exogenous fluorescent protein in the NIID stable transgenic nematode model was verified by immunofluorescence t-test, indicating that the NIID transgenic nematode model was successfully established, and C-NIID1 can be used for subsequent experiments. The method for constructing the NOTCH2NLC gene GGC repeat amplification mutant transgenic nematode model involved in this patent has a wide range of practical applications, mainly including:
[0120] 1. Study on the pathogenic role of NOTCH2NLC protein: Xiu used the stable expression of NOTCH2NLC pathogenic protein in nematodes to study the correspondence between NOTCH2NLC pathogenic protein expression and biological phenotype, which helps to understand the development and progression of the disease.
[0121] 2. New Drug Development and Screening: Using this transgenic nematode model, drug screening can be conducted through behavioral tests and survival rate analysis to identify and evaluate potential therapeutic compounds. Specific gene mutations in the model provide targets for drug action, helping to accelerate the new drug development process.
[0122] The present invention will be further described below with reference to the accompanying drawings and embodiments. The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the specific material ratios, process conditions, and results described in the embodiments are for illustrative purposes only and should not, and will not, limit the present invention as described in detail in the claims.
[0123] Test Example 1 Study on the pathogenic role of NOTCH2NLC protein: Stable expression of the NOTCH2NLC pathogenic protein in nematodes. The pathogenic protein NOTCH2NLC was expressed using C-NIID-1 and C-NIID-2 of *C. elegans* obtained in Examples 1 and 2, respectively. The specific methods are as follows:
[0124] Western blotting revealed that the pathogenic protein of NOTCH2NLC was highly expressed in C-NIID-1 and C-NIID-2. Figure 6 Nematodes expressing high levels of this pathogenic protein exhibit reduced motility, decreased social interaction, and premature aging. Human patients carrying this pathogenic gene also show shortened lifespan and motor dysfunction. Figures 4-5 This invention demonstrates that the nematode model constructed in this invention can express the NOTCH2NLC pathogenic protein, enabling the study of the regulatory mechanism by which the NOTCH2NLC pathogenic protein leads to disease development, and contributing to the understanding of disease development and progression.
[0125] Test Example 2 New drug development and screening
[0126] This invention also proposes a method for determining whether a test compound has disease-treating activity against the NOTCH2NLC pathogenic protein: nematodes are simple to operate, their motility and lifespan indicators are easy to detect and large-scale culture is convenient, and they can be used as indicators for drug screening.
[0127] (i) Mutations in the NOTCH2NLC protein can easily lead to neurological diseases, and intervention studies based on the gut-brain axis for neurological diseases have become a research hotspot in recent years. In this study, 26 gene knockout probiotic strains were fed to the C-NIID-1 model. One of them significantly improved the motility (number of head swings) of the C-NIID-1 model nematodes, and nearly restored it to normal levels (Table 6).
[0128] Table 6. Motility of C-NIID-1 model nematodes
[0129] Genetically engineered bacteria Improvement in motility P value Standard deviation pal 92.21% <0.001 14.40 yghZ 37.98% <0.01 23.60 folM 31.93% <0.05 23.71 rseB 23.87% >0.05 29.10 ybjP 22.56% >0.05 23.67 yeeN 21.80% >0.05 17.58 norW 19.82% >0.05 17.49 yaaW 18.32% >0.05 28.99 wcaK 18.85% >0.05 24.58 yeeR 16.84% >0.05 25.97 ybhG 13.95% >0.05 16.87 hlpA 8.24% >0.05 28.94 ycjT 8.23% >0.05 11.83 fimD 6.68% >0.05 28.07 yrfA 6.05% >0.05 16.31 yhbP 5.84% >0.05 19.52 blc 3.02% >0.05 26.21 bcsE 1.58% >0.05 19.40 yggT -3.73% >0.05 23.97 nudH -5.68% >0.05 27.84 dcuR -8.59% >0.05 23.21 yedX -11.08% >0.05 21.18 wzc -13.69% >0.05 13.55 djlA -15.58% >0.05 29.80 yggG -16.40% >0.05 19.29 yaeJ -20.11% >0.05 14.65
[0130] (ii) The gene expression of the C-NIID-1 model transformed with NOTCH2NLC protein was significantly altered compared with the control nematode. However, after feeding with probiotic strains that improved symptoms, the differentially expressed genes in the transcriptome of the nematode were significantly reduced compared with the control nematode, indicating that the probiotic strain inhibited the regulatory effect of NOTCH2NLC protein on the nematode transcriptome. Figure 8 );
[0131] The above results, using probiotics as an example, show that this model can be used to screen probiotics or drugs targeting NOTCH2NLC.
[0132] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for constructing a model of neurodegenerative diseases, characterized in that, The neurodegenerative disease model is a *C. elegans* disease model, which includes a *C. elegans* C-NIID-1 disease model and / or a *C. elegans* C-NIID-2 disease model, wherein... The steps for constructing the *C. elegans* C-NIID-1 disease model include: S1. Construct a repair template plasmid containing NOTCH2NLC GGC. The repair template plasmid contains the Peft-3-humanNOTCH2NLC(partial)-unc-54 3'UTR sequence and recombination arms before and after the editing site. The humanNOTCH2NLC(partial) is NOTCH2NLC GGC. The gene sequence of the NOTCH2NLC GGC is shown in SEQ ID NO.1, and the gene sequence of the repair template plasmid is shown in SEQ ID NO.2; S2. Prepare an injection mixture by mixing sgRNA plasmid, repair template plasmid, Cas9 plasmid and transgenic marker plasmid, and inject it into wild-type Caenorhabditis elegans to construct a C-NIID-1 disease model of Caenorhabditis elegans. S3. Screening for heterozygous nematodes; S4. Screening homozygous nematodes that stably overexpress the sequence shown in SEQ ID NO.1, which is the Caenorhabditis elegans C-NIID-1 disease model; The steps for constructing the *C. elegans* C-NIID-2 disease model include: The *C. elegans* C-NIID-1 disease model was hybridized with *OH15262 otIs669 V* nematode to obtain a new double mutant strain, which is the *C. elegans* C-NIID-2 disease model.
2. The method according to claim 1, characterized in that, In step S1, the method for constructing the repair template plasmid includes the following specific steps: Plasmid construction: The NOTCH2NLC GGC sequence was cloned into the plasmid vector pcDNA3.1 and fused to the green fluorescent protein GFP to construct the plasmid.
3. The method according to claim 1, characterized in that, In step S2, the sgRNA plasmid, repair template plasmid, Cas9 plasmid and transgenic marker plasmid are mixed in a molar ratio of 100:50:100:5 to prepare an injection mixture; The sequence of the sgRNA plasmid is as follows: sgRNA positive chain: 5'-ATTGCAAATCTAAATGTTT-N19 / N20-GTTTTAGAGCTAGAAATAGC-3'; sgRNA antisense strand: 5'-GCTATTTCTAGCTCTAAAAC-N19 / N20-RC-AAACATTTAGATTTGCAAT -3'; The transgenic marker plasmid includes an antibiotic resistance gene. The injection refers to microinjection, specifically including: injecting the injection mixture into the gonads of wild-type Caenorhabditis elegans.
4. The method according to claim 1, characterized in that, Step S3 specifically includes the following steps: S31. Screening for transgenic markers: Individuals containing transgenic markers are screened from the F1 generation nematodes and plated. These individuals will be used for subsequent screening and verification. S32. Screening for heterozygotes: After the F1 generation of nematodes produces the F2 generation of nematodes, the F2 generation nematodes in each plate are lysed and used as templates. The F2 generation nematodes are screened by PCR to preliminarily determine the existence of heterozygotes. Then, these heterozygotes are sequenced to verify whether the editing of the target gene is successful. Step S4 specifically includes the following steps: S41. Screening for homozygotes: The verified heterozygous nematodes are cultured separately, and after the offspring grow up, PCR screening is performed again to find homozygotes. S42. Secondary Validation: The homozygous nematodes found are subjected to secondary validation by being cultured separately, divided into 8-16 plates, and their progeny nematodes are lysed to serve as templates. The nematodes are then sequenced again to confirm the final sequence and ensure the accuracy of gene editing.
5. The application of plasmids in constructing a disease model of *C. elegans*, characterized in that... The Caenorhabditis elegans disease model is a model constructed by the method described in claim 1, and the gene sequence of the plasmid is shown in SEQ ID NO.
2.
6. The application of the *C. elegans* disease model in screening drugs for neurodegenerative diseases, characterized in that... The Caenorhabditis elegans disease model is a model constructed by the method described in claim 1, and the neurodegenerative disease includes NIID.
Citation Information
Patent Citations
NOTCH2NLC gene GGC repeated amplification mutation transgenic mouse as well as construction method and application thereof
CN115851833A
Transgenic nematode model of triplet repeat neurological diseases
WO1999002652A1