Method for efficiently constructing large fragment deletion of zebrafish helt gene and application

By using the CRISPR/Cas9 system to design gRNAs targeting multiple specific sites in zebrafish and microinjecting them with Cas9 protein, a large fragment of the zebrafish helt gene was efficiently deleted. This solved the problem of constructing large gene deletion fragments that is difficult to achieve with traditional methods, established an Alzheimer's disease model, and improved gene editing efficiency and the feasibility of disease research.

CN118786959BActive Publication Date: 2026-06-26NANTONG TUMOR HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANTONG TUMOR HOSPITAL
Filing Date
2024-07-17
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Traditional methods are insufficient for efficiently constructing large gene deletions in zebrafish, especially deletions in the helt genome, and it is difficult to obtain the deletion structure of BHLH-SF protein, which limits the study of maternal factor function and the establishment of Alzheimer's disease models.

Method used

Using the CRISPR/Cas9 system, gRNAs targeting multiple specific targets were designed and microinjected into zebrafish fertilized eggs. By optimizing the target combination, efficient large fragment deletion was achieved, especially the deletion of the BHLH-SF protein structure, to construct an Alzheimer's disease model.

Benefits of technology

It achieved efficient deletion of large segments of the genome, improved gene editing efficiency, successfully constructed an animal model of Alzheimer's disease, provided a valuable model for studying diseases with large deletions of large segments of the genome, and demonstrated symptoms such as growth retardation and abnormal brain development, providing a new experimental platform for the study of organism growth and development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118786959B_ABST
    Figure CN118786959B_ABST
Patent Text Reader

Abstract

The application belongs to the field of molecular biology, and particularly relates to a method for efficiently constructing large fragment deletion of zebrafish helt gene and application. The method for efficiently constructing large fragment deletion of zebrafish helt gene is applied to constructing an animal model for treating and drug screening of Alzheimer disease caused by large fragment deletion of genome. The application also provides a method for efficiently constructing large fragment deletion of zebrafish helt gene. Through design of a target and a primer, a mutant with large fragment deletion of zebrafish helt gene is obtained. The CRISPR / Cas system is used to perform genome large fragment deletion in a zebrafish helt gene cluster. The length of the deleted genome fragment ranges from 1.4 kb, and the average efficiency reaches more than 60%, which greatly improves the efficiency of genome large fragment deletion.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to a method and application for efficiently constructing a large deletion of the helt gene in zebrafish. In particular, it utilizes the CRISPR system to perform large-fragment deletion of the genome in the zebrafish helt gene cluster and deletes the BHLH-SF protein structure for the first time, thereby efficiently constructing an animal model for studying Alzheimer's disease caused by large-fragment deletion of the genome. Background Technology

[0002] Disorders of maternal factor function are a significant cause of infertility and congenital malformations. In-depth analysis of maternal factor function can help reveal the causes of these birth defects and formulate effective countermeasures. In zebrafish, a large number of genes have significant maternal input, playing crucial roles in embryonic development. However, traditional genetic methods face many challenges in studying maternal gene function, including the excessively long time required to generate maternal mutants and the difficulty in obtaining mutant offspring due to homozygous lethal or infertile phenotypes.

[0003] The CRISPR / Cas9 system, as a powerful gene-editing tool, has been widely used in various organisms. However, when directly injecting Cas9RNPs into early zebrafish embryos for gene editing, the resulting mutations are mostly small insertions and deletions (indels), making it difficult to obtain large gene deletions. This limits its application in studying complex gene functions to some extent.

[0004] Traditional genetic methods for obtaining maternal mutants typically require repeated screening across multiple generations, taking months or even years. Direct injection of Cas9RNP into early zebrafish embryos produces a limited range of mutations, with large deletion-prone mutations being difficult to obtain.

[0005] Based on this, the present invention aims to provide a method and application for efficiently constructing a large deletion of the helt gene in zebrafish. Summary of the Invention

[0006] The purpose of this invention is to provide an efficient method and application for constructing a large deletion fragment of the helt gene in zebrafish. To address the low efficiency of large genomic deletion in existing technologies, the main objective of this invention is to provide an efficient method for constructing a helt genome large deletion mutant and, for the first time, to delete the BHLH-SF protein structure. Specifically, by using the CRISPR system to perform large genomic deletion in the zebrafish helt gene, the efficiency of large genomic deletion is significantly improved. Another objective of this invention is to provide, for the first time, an application in an animal model of Alzheimer's disease induced by the efficient construction of the helt genome large deletion mutant and the deletion of the BHLH-SF protein structure.

[0007] This invention also provides the application of the method for efficiently constructing a large deletion of the helt gene in zebrafish in the construction of animal models for the treatment and drug screening of Alzheimer's disease caused by large deletions in the genome.

[0008] Furthermore, the large genomic fragment is a BHLH-SF protein structure.

[0009] This invention also provides the application of the method for efficiently constructing a large deletion of the zebrafish helt gene in the genome of vertebrates.

[0010] This invention provides a method for efficiently constructing a large deletion fragment of the helt gene in zebrafish, comprising the following steps:

[0011] S1. Design at least two specific target sites at both ends of the gene fragment to be deleted; use the gRNA backbone plasmid as a template to perform PCR amplification to obtain PCR products; purify and transcribe to obtain a number of gRNAs; then microinject the obtained gRNAs and Cas9 protein into the one-cell stage fertilized eggs of the treated object, respectively.

[0012] S2. Genomic samples were extracted from embryonic eggs of the target organism, and PCR amplification was performed using knockout target detection primers to obtain PCR products. The obtained PCR products were Sanger sequenced. Several optimal target combinations and separate combinations were formed from the specific CRISPR target points at both ends of the gene fragment to be deleted. The optimal target combinations were selected and microinjected into one-cell stage fertilized eggs of the target organism. Genomic samples were extracted from embryonic eggs of the target organism, and PCR amplification was performed using double outer primers. The samples were then cultured stably to obtain a mutant with a large deletion of the helt gene in zebrafish.

[0013] Furthermore, the target sequence is shown in the table below:

[0014] Target Name Sequence 5-3 Target site 1 TGAGAAGAGCTGACCGGAGG Target site 2 GACTGAGAAGAGCTGACCGG Target site 3 AGTCTGAAGCGTCTGGAAAG Target site 4 ACGCGCACACTCGATGCTCT Target site 5 CATCGCTGGGTAGGCGAGCG Target site 6 CCGCTGTGCTGAGACATCGC Target site 7 TGTGTAAGCTGAAGGCATTG

[0015] Furthermore, the sequences of the amplification primers are shown in the table below:

[0016] Specific primers sequence Forward primer (F) GTGGAACAGAAAGGGACG Reverse primer (R) GTGTATGCTGCAAATGAAAT

[0017] Furthermore, the final concentration of the gRNA is 120-160 ng / μL, the final concentration of the Cas9 protein is 400 ng / μL, and the injection volume is 1 nL.

[0018] Furthermore, the method for efficiently constructing a large deletion of the zebrafish helt gene simultaneously satisfies the following:

[0019] The efficiency of large-fragment deletion of the genome of the treated object is positively correlated with the mutagenicity of its single specific CRISPR target; compared with microinjection of no less than two specific CRISPR targets at the same time, the efficiency of large-fragment deletion of the genome by microinjection of the optimal target combination with high mutagenicity is high.

[0020] Furthermore, the method described above for efficiently constructing large fragment deletions in the zebrafish helt gene cluster involves the following steps:

[0021] (1) Identify the target sequence for gene knockout in the helt gene cluster of zebrafish. Under the condition that it meets the requirements of the CRISPR PAM region, design no less than 3 specific CRISPRs at both ends of the gene fragment to be deleted.

[0022] gRNA target sequence;

[0023] (2) Design amplification primers based on the specific CRISPR gRNA target sequence designed in step (1);

[0024] (3) Using the gRNA backbone plasmid as a template, PCR amplification was performed using primer T7-gRNAtarget as the forward primer and gRNA reverse primer to obtain PCR products;

[0025] (4) The PCR product obtained in step (3) is purified and transcribed in vitro to obtain gRNA;

[0026] (5) The gRNA and Cas9 protein obtained in step (4) were microinjected into one-cell stage fertilized eggs of zebrafish;

[0027] (6) Select zebrafish eggs from the 48h embryonic period in step (5) to extract the genome, and use knockout target detection primers to perform PCR amplification to obtain PCR products;

[0028] (7) The PCR products obtained in step (6) were subjected to agarose gel electrophoresis and sequencing analysis to determine the knockout status.

[0029] (8) Select one group of specific CRISPR targets from the specific CRISPR targets at both ends of the gene fragment to be deleted to form the optimal target combination.

[0030] (9) The optimal target combination obtained in step (8) was microinjected into the one-cell stage fertilized eggs of zebrafish;

[0031] (10) Select zebrafish eggs from the 48h embryonic period of zebrafish in step (9) to extract the genome, and then perform double outer primer PCR amplification and agarose gel electrophoresis in sequence. Stable culture yields a zebrafish genome large fragment deletion Alzheimer's mutant.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0033] 1. This invention pioneered the identification and screening of helt-gRNAs with exceptional mutation capabilities and innovatively removed the BHLH-SF protein structure. Subsequently, we carefully selected a highly efficient combination of gRNAs and precisely introduced them into one-cell zebrafish fertilized eggs via microinjection, achieving highly efficient large-fragment genome editing using CRISPR technology. This process ensures that the efficiency of large-fragment deletion is directly positively correlated with the specific mutagenicity of a single CRISPR target; and compared to other genome editing methods, the microinjection strategy using the optimal target combination exhibits higher mutagenicity and large-fragment deletion efficacy.

[0034] 2. This invention focuses on multi-site precise editing of the zebrafish genome. By carefully designing gRNAs targeting specific sites, we successfully injected a pair of gRNAs targeting specific genes in conjunction with the Cas9 protein into one-cell stage embryonic cells. Utilizing the powerful capabilities of the CRISPR / Cas9 system, we achieved deletion of a large 1.4kb genomic fragment within the zebrafish helt gene cluster, with an average editing efficiency exceeding 50%, significantly improving the efficiency and feasibility of this type of editing.

[0035] 3. The technology of this invention not only achieves efficient gene segment deletion in the helt gene cluster of zebrafish, but also, for the first time, constructs an Alzheimer's disease model by deleting the BHLH-SF protein structure. These zebrafish mutants carrying large genomic deletions serve as valuable animal models for in-depth investigation of the pathological mechanisms of diseases related to large genomic deletions. Most importantly, this invention is the first to successfully obtain BHLH-SF protein deletion mutants in a zebrafish system. These mutants exhibit Alzheimer's disease-like symptoms, including growth retardation, abnormal brain and tail development, etc., opening up new perspectives and experimental platforms for the study of growth and development in fish and even more organisms. Attached Figure Description

[0036] To more clearly illustrate the technical solutions of the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of this application and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0037] Figure 1 This is a schematic diagram illustrating the pattern of large-fragment deletion in the zebrafish helt gene cluster in the embodiment.

[0038] Figure 2 and Figure 3 These are sgRNA-PCR / sgRNA-RNA electrophoresis images of the helt genes s1, 2, 3, 4, 5, 6, and 7 in the examples; where... Figure 2 This is an electrophoresis image of sgRNA-PCR. Figure 3 This is an electrophoresis diagram of sgRNA transcribed in vitro.

[0039] Figure 4 This is an F0-PCR sequencing diagram of the helt gene after injection of s1, s23, s4, s56, and s7 in the example.

[0040] Figure 5 This is a tail-cutting PCR sequencing diagram three months after F0 following the mixed injection of the optimal target sites s1 and s7 of the helt gene in the example.

[0041] Figure 6 The above-mentioned CRISPR-mediated zebrafish genome in the embodiments Figure 2 F0 offspring F1 embryos showed large fragment deletions in agarose gel electrophoresis images.

[0042] Figure 7 The above-mentioned CRISPR-mediated zebrafish genome in the embodiments Figure 2 F0 offspring F1 showed large missing segments in their tail fins (agarose gel electrophoresis image).

[0043] Figure 8 yes Figure 3 Sequencing results of small band electrophoresis images.

[0044] Figure 9 This is the deletion result of the optimal target of the helt gene in the example.

[0045] Figure 10 The example shows the appearance phenotype of 65d zebrafish with 1.4k deletion of the helt gene.

[0046] Figure 11 This is a comparison of the mRNA transcription levels of beta-amyloid precursor protein b (appb) and presenilin 1 (psen 1) in the brain of mutant zebrafish in this example. Detailed Implementation

[0047] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0048] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0049] Example

[0050] This invention provides a method for efficiently constructing a large deletion fragment of the helt gene in zebrafish, as detailed below:

[0051] The wild-type zebrafish used in this experiment were type AB. All mutant strains were created by the inventor and raised according to standard procedures. Experimental conditions included: complete zebrafish breeding equipment; a recirculating water system treated with UV radiation and aeration; a water temperature of 28.5℃; and pH and conductivity within normal ranges. Lighting was strictly controlled, with 10 hours of darkness and 14 hours of light daily. The zebrafish mated and spawned in a dedicated spawning tank. Collected zebrafish eggs were placed in a 28.5℃ constant-temperature incubator. Hatching typically began after about 48 hours. Before hatching, the water was changed twice daily, and dead eggs were removed. After hatching, the water was changed daily. Paramecium was introduced after 5 days, and brine shrimp after 20 days. After about one month, the fish were introduced into the recirculating system and separated into different tanks after one and a half months, with attention paid to sex differentiation.

[0052] It should be noted that the gRNA backbone plasmid used is from the literature: Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in Africantrypanosomes. Rico E, Jeacock L, Kovarova J, Horn D. Sci Rep. 2018 May 21; 8(1):7960. doi:10.1038 / s41598-018-26303-w.10.1038 / s41598-018-26303-wPubMed29785042.

[0053] The experimental reagents are shown in Table 1:

[0054] reagents Source and item number Taq enzyme Vazyme, P213-03 MAXIscript T7 invitrogen, 00688273 mMESSAGEmMACHINE T7ULTRAkit invitrogen, AM1345 GenCrispr NLS-Cas9-NLS Nuclease GenScript, Z03389-100

[0055] In this embodiment, the steps for constructing a mutant with a large deletion of the zebrafish helt gene include:

[0056] 1. gRNA synthesis

[0057] (1) Target design

[0058] The zebrafish gene sequence was searched on the Ensembl website, and a suitable gRNA was found on the ZIFIT website. After the gRNA was designed, its specificity was first tested using BLAST on the NCBI website, and then sent to the company for synthesis of target primers. The target sequence information is shown in Table 2. The T7 promoter sequence TAATACGACTCACTATA was added to the 5' end, and the gRNA backbone reverse primer sequence GTTTTAGAGCTAGAAAT was added to the 3' end. The primers were then sent to the company for synthesis.

[0059] Table 2

[0060]

[0061]

[0062] (2) Design detection primers

[0063] The detection primers contain target sites at both ends. The upstream detection primer is located before the upstream target site, and the downstream detection primer is located after the downstream target site. The PCR amplification of the wild-type product is 2262 bp in length. The primers were synthesized at Anhui General Biotechnology Co., Ltd., and the primer information is shown in Table 3.

[0064] Table 3

[0065] Specific primers sequence Forward primer (F) GTGGAACAGAAAGGGACG Reverse primer (R) GTGTATGCTGCAAATGAAAT

[0066] (3) Synthesis of gRNA in vitro transcription template

[0067] a. Using the gRNA backbone plasmid as a template, perform PCR reaction with the forward primers and gRNA reverse primers corresponding to the target sites in Table 2.

[0068] b. PCR reaction conditions are as follows: pre-denaturation 94℃, 3 min; denaturation 94℃, 15 s; annealing 56℃, 15 s; extension 72℃, 3 s; 35 cycles; then 72℃, 5 min; finally incubated at 4 degrees Celsius.

[0069] c. Detect PCR products by 120V, 20min, and 2% agarose gel electrophoresis (Gel EP). The bands should be slightly longer than the 100bp marker band. Figure 2 As shown.

[0070] d. First, purify the DNA using the ANYGEN DNA purification kit, then dissolve and elute it with RNase-free water.

[0071] e. Take 1 μL of solution and use a Nanodrop spectrophotometer to detect the concentration.

[0072] (4) In vitro transcription

[0073] Under RNase-Free conditions, the above-mentioned PCR purified products were transcribed in vitro to obtain gRNA. The transcription system was based on the instructions of the in vitro transcription kit, as shown in Table 4, with T7enzyme mix added last. The reaction conditions were: 37°C water bath, 120 min; then 1 μL of TURBO DNase was added, and the mixture was incubated at 37°C for 15 min.

[0074] Table 4

[0075]

[0076] (5) Precipitate and purify gRNA

[0077] After in vitro transcription, the gRNA was purified using a co-precipitation method with sodium acetate and ethanol. The steps were as follows:

[0078] a. Add 10 μL of 5M sodium acetate to the above reaction product, then add 300 μL of 100% ethanol; store in a -80°C refrigerator for 2-12 hours (overnight processing is acceptable).

[0079] b. Centrifuge at 4℃, 12000rpm for 30min, then pour off or remove the supernatant with a pipette.

[0080] c. Use a pipette to draw pre-cooled 70% ethanol to wash the precipitate, and gently agitate it to suspend it. Then, at 4°C...

[0081] Centrifuge at 12000 rpm for 10 minutes, remove the supernatant, and repeat this step once to remove impurities. Then air dry in a clean bench at room temperature for 1 minute.

[0082] d. Dissolve in 15 μL of RNase-free water.

[0083] e. Nanodrop assay for concentration; 150V, 15min, 1% agarose gel electrophoresis for quality of synthesis. Figure 3 As shown.

[0084] 2. Microinjection

[0085] Cas9 protein and gRNA were pre-mixed into a solution at a certain ratio, with a final concentration of 120-160 ng / μL for gRNA and 400 ng / μL for Cas9 protein. The solution was injected into the animal pole of zebrafish embryos at the 1-cell stage. 1 nL was injected, and the solution could be detected after 48 hours. A portion of uninjected fish eggs was left as a control at the time of injection.

[0086] 3. The effectiveness of Sanger sequencing in detecting target sites

[0087] After microinjection into zebrafish embryos, a number of normally developing early embryos are selected to test for mutations in their helt gene, in order to confirm in advance whether the selected target site is effective and whether the microinjection operation is standardized.

[0088] 4. Extracting the zebrafish genome

[0089] Forty-eight hours after fertilization, wild-type (control) and post-injection embryos were collected into 1.5 mL Eppendorf tubes (5 embryos per tube). Genomic DNA was extracted using the following method: 400 μL of cell lysis buffer and 2 μL of proteinase K were added to the Eppendorf tubes containing the embryos. The tubes were incubated at 55°C for at least 2 hours (they were gently inverted and mixed every half hour to ensure complete lysis). After lysis, the tubes were shaken thoroughly, and an equal volume (400 μL) of pre-cooled isopropanol was added. The tubes were inverted and mixed thoroughly. The tubes were centrifuged at 12000×g for 10 min at 4°C, and the supernatant was discarded. 500 μL of 75% ethanol was added, and the tubes were centrifuged at 12000×g for 5 min at 4°C. The supernatant was discarded, and the tubes were air-dried at room temperature for 20 min. 60-100 μL of deionized water was added, and the tubes were thoroughly mixed by pipetting.

[0090] 5. PCR amplification of the target sequence

[0091] After extracting genomic DNA, primer sequences were designed using Primer Premier 5.0 software based on a genomic region approximately 2262 bp upstream and downstream of the CRISPR target site to amplify the target DNA fragment. The PCR reaction system (20 μL) is shown in Table 5.

[0092] Table 5 PCR reaction system:

[0093] <![CDATA[ddH2O]]> 7μL 2×Rapid Taq Master Mix 10μL Primer F, 10uM 1μL Primer R, 10µM 1μL Extracted DNA (10 ng / μL) 1μL Total volume 20μL

[0094] After vortexing and mixing, the amplification reaction was performed on a PCR instrument. The reaction conditions were: pre-denaturation at 94℃ for 2 min, followed by 34 cycles of (denaturation at 94℃ for 15 s, annealing at 52℃ for 15 s, extension at 72℃ for 7 s), and then 72℃ for 2 min. After the reaction, the PCR products were centrifuged, and 1 μL of the sample was spotted onto a 2.0% agarose gel for electrophoresis to check if the PCR product size was correct. Sanger sequencing (F0) of the PCR products revealed changes in the gene sequence based on the peak pattern, and cloning revealed the presence of multiple non-frameshift mutations.

[0095] 6. The results of the helt s1-7 sequencing experiment are as follows: Figure 4 As shown.

[0096] 7. Fragment deletion results

[0097] First, based on the above screening, s1 and s7 were identified, and therefore, s1 and s7 fragments were selected for knockout. After injecting s1 and s7, the fish were raised for 3 months, and genomic DNA was extracted from the tail fin of one fish. Then, a gene extraction kit was used to amplify the DNA using a PCR instrument.

[0098] The amplification reaction conditions were: pre-denaturation at 94℃ for 2 min, (denaturation at 94℃ for 15 s, annealing at 52℃ for 15 s, extension at 72℃ for 30 s), 34 cycles, followed by 72℃ for 2 min.

[0099] The PCR product was sequenced by Sanger (F0), such as Figure 5 As shown: Using Sequence Scanner v1.0 software, overlapping peaks can be seen at s1 and s7, indicating the presence of a mutation sequence.

[0100] The results of screening 8 F1 tail-cut electrophoresis bands after injection are as follows: WT band: 2262bp, mutant band: approximately 800bp, as shown in the figure. The probability of large fragments exceeds 60%. Figure 7 As shown.

[0101] 8. Obtain the F1 generation of heritable zebrafish mutants.

[0102] The F0 generation of zebrafish mutants was identified through a series of screenings. Then, the F0 generation mutants were crossed with wild-type zebrafish to obtain F1 generation embryos, which were cultured at 28°C. The survival rate of the F1 generation was observed in the early stage.

[0103] Two days after fertilization, 10 embryos from each mutant F1 generation were collected for mutation heritability identification. Genomic DNA was extracted from five embryos per tube, and then PCR amplification was performed on embryos with mutations below 2262 bp. Figure 6 To determine whether this large fragment mutation can be inherited by the F1 generation.

[0104] F1 embryos were cultured for three months, and tail fins were clipped for identification. PCR-agarose gel electrophoresis was used to determine the presence of individuals with large deletions. Mutant individuals should have PCR amplification values ​​below 2262 bp. Figure 7 As shown: the mutant zebrafish individuals exhibited dual bands, one WT band and one mut band. The mut band was excised and sequenced using gel-Sanger sequencing, and the DNA fragments of its single peak were analyzed using Sequence Scanner v1.0 software. Figure 8 The result shows a clean single peak of mutation, indicating the presence of a mutation type.

[0105] Sequence comparison analysis using Vector NTI 10 software was performed by comparing sequences under peak plots. Figure 9The sequence alignment of the fragments amplified by PCR with the helt genomic DNA-WT database showed that the mut band sequence had a 1.4kb DNA fragment missing, indicating that sgrna at the s1 and s7 target sites generated a highly efficient DNA-delete event.

[0106] This step involves screening for male and female F1 generations with the same genotype to provide a basis for obtaining homozygous mutant F2 generations. After knocking out helt in zebrafish, the development of homozygous F2 embryos was observed to be tailless and with extremely delayed body development up to 65 days. Figure 10 ).

[0107] 9. Alzheimer's disease-related gene qPCR testing

[0108] The transcriptional levels of AD-related genes were significantly increased in mutant zebrafish brains compared to normal controls (P<0.05), specifically the mRNA transcription levels of beta-amyloid precursor protein b (appb) and presenilin 1 (psen 1). Figure 11 As shown.

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention; those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention; and all technical solutions and improvements that do not depart from the spirit and scope of the present invention should be covered within the scope of the claims of the present invention.

Claims

1. A method for efficiently constructing a large deletion fragment of the zebrafish helt gene, characterized in that, The method described herein is used to construct an animal model for the treatment and drug screening of Alzheimer's disease caused by large deletions of genomic fragments, wherein the large genomic fragment is the BHLH-SF protein structure, and the method is used for large deletions of gene fragments within the vertebrate genome. The steps include: S1, designing at least two specific target sites at both ends of the gene fragment to be deleted; designing amplification primers based on the target site sequences; using a gRNA backbone plasmid as a template, performing PCR amplification to obtain PCR products; purifying and transcribing to obtain a number of gRNAs; subsequently, microinjecting the obtained gRNAs and Cas9 protein into one-cell stage fertilized eggs of the treated subjects. S2. Genomic samples were extracted from embryonic eggs of the target organism, and PCR amplification was performed using knockout target detection primers to obtain PCR products. The obtained PCR products were then Sanger sequenced. Several optimal target combinations and individual combinations were formed from the specific CRISPR target sites at both ends of the gene fragment to be deleted. The optimal target combinations were selected and microinjected into one-cell stage fertilized eggs of the target organism. Genomic samples were extracted from embryonic eggs of the target organism, amplified by double outer primers, and cultured stably to obtain a large fragment deletion mutant of the zebrafish helt gene. The target sequences are as follows: Target Name Sequence 5-3: Target Site 1 TGAGAAGAGCTGACCGGAGG, Target Site 2 GACTGAGAAGAGCTGACCGG, Target Site 3 AGTCTGAAGCGTCTGGAAAG, Target Site 4 ACGCGCACACTCGATGCTCT, Target Site 5 CATCGCTGGGTAGGCGAGCG, Target Site 6 CCGCTGTGCTGAGACATCGC, Target Site 7 TGTGTAAGCTGAAGGCATTG.

2. The method for efficiently constructing a large deletion fragment of the zebrafish helt gene according to claim 1, characterized in that, The sequences of the amplification primers are as follows: Specific primer sequences: Forward primer (F) GTGGAACAGAAAGGGACG Reverse primer (R) GGTATGCTGCAAATGAAAT.

3. The method for efficiently constructing a large deletion fragment of the zebrafish helt gene according to claim 1, characterized in that, The final concentration of the gRNA is 120-160 ng / μL, the final concentration of the Cas9 protein is 400 ng / μL, and the injection volume is 1 nL.

Citation Information

Patent Citations

  • Preparation of zebra fish with ApoE gene deletion

    CN112695034A

  • Method for efficiently constructing genome large fragment deletion mutant and application

    CN115074390A

  • Manipulation of tissue of organ type using the notch pathway

    US20040242482A1