Shark single-domain antibodies that recognize unique specific B cell antigen epitopes in the novel coronavirus surface spike protein S and their applications

Abstract

The present invention discloses a shark single-domain antibody and its application that recognizes a unique specific B cell antigen epitope (LHRSYLTPGDSSSGWTAG) in the surface spike protein S of the new coronavirus (SARS-CoV2). The nucleotide sequence of the shark single-domain antibody is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2. The shark single-domain antibody of the present invention has strong specificity, high sensitivity and good accuracy because it recognizes the unique B cell antigen epitope in the spike protein S of the new coronavirus (SARS-CoV2). It has been proven to be useful for detection such as enzyme-linked immunosorbent assay (ELISA), protein immunoblotting (WB) and cell immunofluorescence (IF).

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a shark single-domain antibody that recognizes a unique specific B cell antigen epitope in the surface spike protein S of the novel coronavirus (SARS-CoV2) and its application. Background Art

[0002] Coronaviruses are a class of viruses with enveloped genomes and linear, single-stranded, positive-sense RNA. Coronaviruses that have been able to cause human disease include HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, and the currently circulating novel coronavirus, SARS-CoV2. The spike protein (S) on the surface of coronaviruses is associated with the virus's ability to infect. It is the most important surface structural protein and the primary target for the host immune system to produce antibodies, including neutralizing antibodies, after infection. The nucleocapsid protein (N) inside coronavirus particles is also one of the main structural proteins of the virus. It has high immunogenicity and is expressed in large quantities during infection. Therefore, both the S and N proteins are SARS-CoV2 antigens and diagnostic targets. To date, there are three types of detection methods and kits for the novel coronavirus, SARS-CoV2, targeting nucleic acids, antibodies, and antigenic proteins, respectively. Among them, the corresponding specific antigen detection kits developed targeting the S protein or N protein of SARS-CoV2, when used in combination with qRT-PCR viral nucleic acid detection, can provide strong support for the prevention and control plan of early detection and early treatment of SARS-CoV2 virus.

[0003] Animals such as camels, sharks, skates, and stingrays naturally lack light chains and instead consist solely of heavy chain homodimers. This antibody, consisting of a single heavy chain variable region, is cloned and recombinantly expressed to produce a single-domain antibody (SdAb), the smallest unit currently available that can bind to a target antigen. Because its molecular weight is approximately one-tenth that of a conventional antibody and its crystal size is 2.5 nm wide and 4 nm long, it is referred to as a nanobody. Compared with traditional IgG conventional antibodies, nanoantibodies have many advantages: (1) their complementary determining regions form a convex ring structure, which can be embedded in the interior of the antigen molecule, recognizing antigen epitopes that traditional antibodies cannot bind to due to steric hindrance or hidden antigen epitopes, and have higher antigen binding capacity; (2) their relative molecular weight is small, and they can exert their functions without glycosylation modification, and have stronger tissue penetration; at the same time, they are easier to carry out protein engineering design, and can be used for low-cost large-scale rapid production using Escherichia coli or yeast expression systems, with an expression level of up to 10 mg / L; (3) they have better water solubility, thermal stability and anti-degradation ability, can withstand high temperatures of 60-90°C, can be stored at room temperature for several months without inactivation, and can still maintain high antigen binding capacity in the presence of extreme pH and pepsin. In summary, the above-mentioned single-domain nanoantibodies have the advantages of high antigen binding, high tolerance, high stability, high expression and short production cycle, and can be widely used in diagnosis and treatment. Shark antibody heavy chains consist of one variable region and five constant regions, known as IgNARs (Ig new antigen receptors). Recombinant expression of the shark antibody variable region (vNAR) yields fully functional antibody fragments known as shark single-domain antibodies. The bamboo shark (Chiloscylliumplagiosum) is a small shark, with an adult length of no more than one meter. This makes it easy to manipulate in various experiments and inexpensive to purchase and maintain, making it an excellent candidate for developing shark nanoantibody drugs. Summary of the Invention

[0004] The purpose of the present invention is to address the deficiencies of the existing technology and provide a shark single-domain antibody that recognizes a unique specific B cell antigen epitope in the surface spike protein S of the new coronavirus (SARS-CoV2), and its application in the detection of SARS-CoV2.

[0005] In order to achieve the above objectives, the technical solution of the present invention is to provide a shark single-domain antibody that recognizes a unique specific B cell antigen epitope in the surface spike protein S of the new coronavirus (SARS-CoV2), and the amino acid sequence of the shark single-domain antibody is shown in SEQ ID NO: 2.

[0006] The present invention also provides a gene encoding the shark single-domain antibody described above.

[0007] Furthermore, the nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0008] The present invention also provides a vector comprising the above gene.

[0009] The present invention also provides a use of the above-mentioned shark single-domain antibody in the preparation of a kit for detecting the new coronavirus SARS-CoV2.

[0010] Furthermore, in the application, the detection methods include enzyme-linked immunosorbent assay (ELISA), western blotting (WB) and cell immunofluorescence (IF).

[0011] The present invention also provides a kit for detecting the novel coronavirus SARS-CoV2, comprising the above-mentioned shark single-domain antibody.

[0012] Preferably, the kit is an ELISA detection kit or an immunochromatographic diagnostic kit using immunochromatographic test strips.

[0013] The beneficial effects of the present invention are as follows:

[0014] The shark single-domain antibody of the present invention has strong specificity, high sensitivity and good accuracy because it recognizes the unique B cell antigen epitope in the spike protein S of the new coronavirus (SARS-CoV2). It can be used in the kit of a fully automatic immunoassay analyzer and can also be used in immunochromatographic test strips to detect the spike protein S and virus particles on the surface of SARS-CoV2, which is beneficial for large-scale SARS-CoV2 antigen detection and epidemiological surveys. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the SDS-PAGE electrophoresis diagram of the shark single-domain antibody T1 in Example 2; M: protein marker.

[0016] Figure 2 The shark single-domain antibody T1 in Example 4 was used for protein immunoblotting (WB) to detect the S1 subunit of the recombinantly expressed 7 coronavirus spike proteins S; M: protein marker, 1 to 7 are the recombinantly expressed and purified 7 coronavirus spike protein S1 subunits, including SARS-CoV2, SARS-CoV, MERS-CoV, HCoV-OC43, HCoV-NL63, HCoV-HKU1, HCoV-OC43, and HCoV-229E. DETAILED DESCRIPTION

[0017] The present invention targets a unique B cell antigen epitope (LHRSYLTPGDSSSGWTAG) contained in the SARS-CoV2 spike protein S, the amino acid sequence of which remains constant in all currently known novel coronavirus strains. A shark single-domain antibody derived from the striped bamboo shark has been developed and obtained that recognizes this antigen epitope.

[0018] The following are preferred embodiments of the present invention. The examples are intended to illustrate the present invention rather than to limit the present invention. Within the spirit of the present invention and the scope of protection of the claims, any modifications and changes made by a person skilled in the art based on the present invention fall within the scope of protection of the present invention. Experimental methods in the examples of the present invention where specific conditions are not specified are generally based on conventional conditions; unless otherwise specified, all reagents and consumables used are commercially available products.

[0019] Example 1: Screening of shark single-domain antibodies targeting unique specific B cell antigen epitopes in the surface spike protein S of the new coronavirus (SARS-CoV2)

[0020] (1) Immunization of the striped bamboo shark and isolation of peripheral blood lymphocytes

[0021] The unique B cell antigen epitope in the NTD region of the surface spike protein S of the new coronavirus (SARS-CoV2) determined in previous work was selected, and an artificially synthesized peptide (LHRSYLTPGDSSSGWTAG) was coupled to the carrier protein KLH at the C-terminus. During immunization, it was mixed with an equal volume of fish saline at a dose of 5ug / kg and injected subcutaneously at multiple points on the back of adult striped bamboo sharks. Immunization was performed once every 14 days. 14 days after the completion of the sixth antigen immunization, 5mL of tail vein blood was collected from the striped bamboo shark using an anticoagulant sodium heparin vacuum blood collection tube. The above 5 mL of blood was equally divided into 5 15 mL centrifuge tubes, and 10 times the volume of physiological saline of the blood sample was added to each tube for dilution, and the tubes were slowly mixed; the diluted blood sample was aspirated onto the surface of the separation liquid, and centrifuged at 300 g / min for 30 min; after centrifugation, the lymphocytes appeared as grayish-white ribbons, located between the light yellow plasma layer and the transparent separation liquid layer. The lymphocytes were carefully aspirated with a pipette into another 15 mL centrifuge tube, and 10 mL of PBS buffer was added for resuspending and washing, and the tubes were centrifuged at 350 g / min for 10 min. This process was repeated 3 times to collect the peripheral blood lymphocytes of the immune striped bamboo shark.

[0022] (2) Construction of shark nanoantibody library

[0023] To extract total RNA from blood lymphocytes: Add 1 mL of Triple Reagent to a centrifuge tube containing lymphocytes, sonicate for 30 seconds, add 1 / 5 volume of chloroform, incubate at room temperature for 5 minutes, and centrifuge at 12,000 rpm, 42°C, for 15 minutes. Carefully transfer the supernatant to another centrifuge tube, add an equal volume of isopropanol, mix thoroughly, and incubate at room temperature for 20 minutes. Centrifuge at 12,000 rpm, 42°C, for 5 minutes. Slowly aspirate the supernatant, wash with 75% ethanol, and centrifuge at 12,000 rpm, 42°C, for 5 minutes. Carefully discard the supernatant, air-dry the RNA pellet, and dissolve it in DEPC-free water. Measure the RNA concentration using a nucleic acid analyzer. Simultaneously, perform electrophoresis on a 1% agarose gel to verify the RNA quality. Finally, dissolve the total RNA to 1 μg / μL for later use.

[0024] Reverse transcription to obtain cDNA: Add 5ug total RNA and 1uL of Oligo (dT) (10uM) to a 0.2mL PCR tube on ice and mix well. Heat at 65°C for 10 minutes and immediately return to ice. Add the following reactants to the above PCR tube: 8uL of 5×M-Mμlv Reaction Buffer, 5uL of dNTP Mixture (10mM), 1uL of M-Mμlv Reverse Transcriptase and 20uL of DEPC water to a total volume of 40uL. Mix well and centrifuge slightly. Immediately incubate at 37°C for 90 minutes to synthesize the first-strand cDNA. Heat at 65°C for 5 minutes to terminate the reaction.

[0025] PCR amplification of the vNAR gene of the bamboo shark: nested PCR (i.e., using the first-round PCR product for the second-round PCR) was used, where the primers used in the first-round PCR were: upstream primer (F1)

[0026] ATGAATATTTTCTTGTTTTCGGGCC (SEQ ID NO: 3), downstream primer (R1)

[0027] ATAGTATCCGCTAATTAGACAAA (SEQ ID NO: 4); the primers used in the second round of PCR were: upstream primer (F1') CGTGGCCCAGGCGGCCGGGCCCCCTGGTTACCAAATGT (SEQ ID NO: 5), downstream primer (R1') CGTGGCCCAGGCGGCCGGGCCCTTTGCCAGGTTTCACAGTCAG (SEQ ID NO: 6); after two rounds of PCR amplification, the striped bamboo shark single-domain antibody vNAR gene was obtained.

[0028] Ligation with vector to construct phage library: After the second round of PCR products were subjected to agarose gel electrophoresis, the vNAR fragment (about 500 bp) was excised and purified. The purified VNAR fragment and pComb3XSS vector were then digested with SfiI endonuclease, purified, and ligated. The ligated products were added to E. coli XL1-Blue competent cells for electroporation. Immediately after electroporation, 1 mL of SOCG medium was added and cultured at 37°C, 180 rpm, for 60 min. The cultured bacterial solution was diluted in a gradient of 1:10, 1:100, and 1:1000 and then coated on an ampicillin-resistant SOC plate. The plate was cultured at 37°C overnight. The number of colonies on the plate was counted and the library capacity (>10 7 cfu / mL). The remaining cultured bacterial solution after transformation was divided into centrifuge tubes, sterilized glycerol was added (to a final concentration of 15%), and stored at -70°C. This is the primary shark nanobody library.

[0029] (3) Phage display and screening of shark nanoantibody libraries

[0030] Take a primary shark nanoantibody library, add 250ml 2xYT medium, culture at 37℃ and 250rpm until OD600 reaches about 0.6, add helper phage VCSM13 at moi = 20:1, and culture at 37℃ and 220rpm for 1h; collect the precipitate by centrifugation at 4℃ and 3000rpm, add 500ml 2xYT medium to the precipitate, and culture at 37℃ overnight; centrifuge at 4℃ and 10000rpm to take the supernatant, add 1 / 5 volume PEG / Nacl to precipitate phage, collect the precipitate by centrifugation at 12000rpm, suspend the phage precipitate with 2mL PBS, filter with 0.45μm filter membrane, and store at 4℃ for subsequent screening of shark nanoantibodies.

[0031] Immunotubes were coated with the peptide LHRSYLTPGDSSSGWTAG and blocked with 3% BSA. The phage supernatant obtained above was mixed with PBS in a 2:3 (mass) ratio and added to the immunotubes. The mixture was incubated for 1 hour. After washing with PBS, the host bacteria XL1-Blue (OD600 = 0.6) was added and incubated with shaking at 37°C for 1 hour for elution and collection of the bacterial solution. This completed the first round of screening and obtained the primary antibody library. The above steps were repeated, and the phage elution solution obtained from each round of screening was amplified and cultured as the library for the next round of screening. The coating amount of the antigen peptide S9 was gradually reduced. After 5 rounds of screening, the obtained bacterial solution was divided into EP tubes, and the remaining bacterial solution was added to sterile glycerol and stored at -70°C and labeled as the fifth-level shark nanoantibody library.

[0032] (4) Phage-ELISA identification of positive monoclonals in shark nanoantibody library

[0033] Take a level five shark nanobody library, add 2xYT medium and culture at 30℃ for 1h, spread on a plate, and culture at 30℃ overnight; randomly select 50 clones from the plate and inoculate them into 400uL 2xYT medium for activation (at the same time, inoculate them on the plate for seed preservation), culture at 30℃ with shaking until OD600 = 0.6, add VCSM13 helper phage, culture at 250rpm overnight, centrifuge at 4℃ and 4000rpm for 20min, and keep the supernatant.

[0034] The antigen polypeptide LHRSYLTPGDSSSGWTAG was coated on a 96-well plate at 0.5 μg / mL and 100 μL / well, incubated at 37°C for 1 h, the coating solution was discarded, the plate was washed with PBS, 3% BSA was added and blocked at room temperature for 2 h, the phage supernatant obtained above was added, the plate was incubated at 37°C for 2 h, HRP-labeled anti-M13 enzyme-labeled secondary antibody (1:5000 dilution) was added after washing with PBS, the plate was incubated at 37°C for 1 h, 100 μL TBM color development solution was added after washing with PBS, the plate was developed in the dark for 30 min, 100 μL 2M H2SO4 stop solution was added, and the OD value (450 nm) was measured by a microplate reader.

[0035] (5) Sequence analysis of phage-positive clones

[0036] The top 10 clones with the highest OD readings from the phage-ELISA assay were selected and the corresponding positive clones were isolated from the culture plates. After overnight culture in 2xYT medium, nucleotide sequence analysis was performed to determine the VNAR genotype of the positive clones. After eliminating duplicates, a single positive clone was obtained, designated T01. The nucleotide sequence of T01 is shown in SEQ ID NO:1, and the amino acid sequence of T01 is shown in SEQ ID NO:2.

[0037] Example 2: Recombinant expression and purification of shark single domain antibodies in Escherichia coli

[0038] Construction of a prokaryotic expression plasmid for shark single-domain antibodies: Based on the above sequencing results, a DNA fragment was synthesized after codon optimization. An Nco I restriction site (including the start codon) was introduced at the N-terminus, followed by a His tag, a Myc tag, a stop codon, and an Xho I restriction site at the C-terminus. After double restriction digestion, the fragment was cloned into the E. coli expression plasmid pET-28a(+). The recombinant plasmids were transformed into competent E. coli HB101 cells, positive clones were screened, and the recombinant plasmids were extracted. Restriction enzyme digestion and nucleotide sequence analysis of the inserted fragment were performed to confirm the fragment's accuracy.

[0039] Recombinant expression, purification and identification of shark single-domain antibodies: The correctly identified recombinant plasmids were transformed into Escherichia coli BL21 (DE3) competent cells, positive clones were screened and liquid cultured, cultured at 37°C and 200rpm until OD600 reached about 0.6, IPTG with a final concentration of 1mM was added to induce the expression of the recombinant protein, and the E. coli cells were collected by low-temperature centrifugation at 37°C and 200rpm for 4 hours. After adding an appropriate amount of PBS, the cells were ultrasonically broken, and the supernatant and precipitate were collected after low-temperature centrifugation at 10,000rpm. The expression form of the recombinant single-domain antibody was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The recombinant nanoantibody was purified using the His·Bind protein purification kit, and the reactivity of the recombinant single-domain antibody with the specific antibody (ie, anti-His antibody) was confirmed by protein immunoblotting (WB) detection technology. The results of SDS-PAGE electrophoresis are as follows. Figure 1 As shown, the protein purity of the obtained recombinant single-domain antibody T01 was >95%.

[0040] Example 3: Recombinant single-domain antibody T01 was used for indirect enzyme-linked immunosorbent assay (ELISA) to detect the NTD region of recombinantly expressed SARS-CoV2 spike protein S

[0041] Recombinantly expressed and purified SARS-CoV2 NTD protein was coated as a capture antigen in a 96-well microtiter plate at 5 μg / ml and 100 μl / well, and incubated overnight at 4°C. After washing the plate with PBST, 1% BSA was added at 200 μl / well and blocked at 37°C for 1 hour. After washing the plate three times with PBST, an appropriately diluted recombinant single-domain antibody, T01, was added as the primary antibody and incubated at 37°C for 1 hour. After washing the plate five times with PBST, an appropriately diluted horseradish peroxidase (HRP)-labeled mouse anti-Myc tag antibody was added and incubated at 37°C for 1 hour. After washing the plate five times with PBST, TMB chromogenic substrate was added at 100 μl / well and the reaction was allowed to proceed for 15 minutes. The reaction was terminated by adding 50 μl of 2 mol / L sulfuric acid stop solution, and the OD value of each well was read at 450 nm on a microtiter plate reader. The results showed that the OD value of the SARS-CoV2 NTD protein-coated wells was 2.864, which was significantly higher than the OD value of the control PBS-coated wells of 0.051, indicating that the recombinant single-domain antibody T01 can be used for indirect enzyme-linked immunosorbent assay (ELISA) to specifically detect the NTD region of the recombinantly expressed SARS-CoV2 spike protein S.

[0042] Example 4: Use of recombinant single-domain antibody T01 for Western blot hybridization (WB) to detect the S1 subunit of the recombinantly expressed spike protein S of seven coronaviruses

[0043] One microgram of the S1 subunit of the recombinantly expressed and purified SARS-CoV2, SARS-CoV, MERS-CoV, HCoV-OC43, HCoV-NL63, HCoV-HKU1, HCoV-OC43, and HCoV-229E human coronavirus spike protein S was separated by SDS-PAGE, electrotransferred to a PDVF membrane, and blocked with 5% BSA for 2 hours. Western blotting was then performed using the recombinant single-domain antibody T01 as the primary antibody and HRP-labeled mouse anti-Myc tag antibody as the secondary antibody. The results showed that the monoclonal antibody could specifically recognize the S1 subunit of the SARS-COV2 spike protein S, and had no cross-reaction with the S1 subunit of the other six coronavirus spike proteins ( Figure 2 ).

[0044] Example 5: Recombinant single-domain antibody T01 for cell immunofluorescence (IF) detection

[0045] The recombinant plasmid pCDNA3.1-HnCoV-S encoding the full-length SARS-CoV2 spike protein S and the control plasmid pCDNA3.1 were diluted and mixed with Lip2000 with OPTI-MEM. After standing at room temperature for 20 minutes, the mixture was added to HEK293 cells cultured on the slides in a 6-well plate, gently shaken to mix, and then placed in a 37°C, 5% CO2 incubator for incubation for 48 hours. Then the culture medium was discarded, the cell slides were rinsed three times with PBS at 37°C, fixed with 4% paraformaldehyde preheated at 37°C for 15 minutes, and rinsed three times with PBS; incubated with 0.2% TritonX-100 (diluted in PBS) at room temperature for 15 minutes, and rinsed three times with PBS; the cell slides were blocked with PBS containing 10% goat serum for 30 minutes; recombinant single-domain antibody T01 was added as the primary antibody for incubation at 4°C for 14 hours, rinsed three times with PBS, and allowed to stand for 5 minutes each time; Alexa Flour 647-labeled mouse anti-Myc tag antibody was used as the secondary antibody, diluted 1:500 in 1% BSA in PBS, incubated at room temperature for 2 hours, rinsed three times with PBS, and allowed to stand for 5 minutes each time; the slides were fixed on a slide with anti-fluorescence mounting fluid, and observed under a confocal microscope. The results showed that cells transfected with the recombinant plasmid showed specific fluorescence signals, while blank cells and cells transfected with the control plasmid showed no specific fluorescence signals, indicating that the recombinant single-domain antibody T01 can be used for cell immunofluorescence (IF) detection and specifically recognize the SARS-COV2 spike protein S expressed in cells.

Claims

1. A shark single-domain antibody that recognizes a unique specific B cell antigen epitope in the surface spike protein S of the new coronavirus, characterized in that: The amino acid sequence of the shark single domain antibody is shown in SEQ ID NO:

2.

2. A gene encoding the shark single-domain antibody according to claim 1.

3. The gene according to claim 2, wherein The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

4. A carrier, characterized in that Comprising the gene according to claim 2 or 3.

5. Use of the shark single-domain antibody according to claim 1 in the preparation of a kit for detecting the new coronavirus SARS-CoV2.

6. The use according to claim 5, characterized in that Detection methods include enzyme-linked immunosorbent assay, western blot hybridization and cell immunofluorescence.

7. A kit for detecting the novel coronavirus SARS-CoV2, characterized in that: Comprising the shark single-domain antibody according to claim 1.

Images