Method and application of CsERF39 gene to improve resistance to citrus canker

Abstract

The invention discloses a method and application of a CsERF39 gene to improve resistance to citrus canker, and relates to the field of agricultural biological genes. The CsERF39 gene is applied to improve resistance to citrus canker, and the nucleotide sequence of the CsERF39 gene is shown in SEQ ID No. 1. The method of using the CsERF39 gene to improve resistance to citrus canker comprises the following steps: (1) cloning a citrus CsERF39 coding sequence; (2) constructing a CsERF39 overexpression vector; (3) transforming citrus with the CsERF39 overexpression vector, cultivating, and obtaining transgenic plants. The invention clones the citrus CsERF39 coding sequence, constructs an overexpression vector, and then transforms citrus, so that the degree of ulcer disease in the obtained transgenic plants can be reduced to 47.5% of that of existing citrus at most, which can significantly reduce the degree of ulcer disease and reduce the area of ​​lesions.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological genes, and in particular to a method and application of a CsERF39 gene to improve resistance to citrus canker. Background Art

[0002] Citrus is the largest fruit in southern my country and an important economic crop in the world. However, citrus canker has seriously hindered the healthy development of the citrus industry (Hu Junhua et al., 2015). Citrus canker is caused by Xanthomonas citrisubsp.citri (Xcc), which originated in India, Java and other places (Hu Junhua et al., 2015). The main citrus producing areas in Fujian, Hunan, Guangdong and other places in my country are seriously affected by citrus canker. The canker bacteria mainly infect citrus leaves, branches, fruits, etc., among which seedlings and young trees are more seriously affected (He Xiuling et al., 2007). Diseased trees will experience leaf fall, dead branches, weak tree vigor and fruit drop, which seriously affects the yield and quality of citrus. There are dozens of Rutaceae plants affected by citrus canker, most of which are economic cultivars. Studies have found that sweet orange is most susceptible to the disease, followed by sour orange and pomelo (Yuan et al., 1997; Li et al., 2013).

[0003] At present, comprehensive prevention and control strategies are usually adopted to control the damage of citrus canker, with chemical control as the main method and biological control as the auxiliary method. However, since chemical control measures are not environmentally friendly, they are very likely to cause environmental pollution, and require a lot of manpower and material resources, and biological control has poor effects and high costs, it is urgent to reduce the losses caused by canker by breeding new disease-resistant varieties (Chen Li et al., 2008; Zhu Xuemei et al., 2017). The long hybrid breeding cycle makes breeding efficiency low. With the rise of molecular biology, people began to study the pathogens themselves and the disease resistance of plants from the direction of disease-resistant genetic engineering. Genetic engineering methods have also been tried in the study of anti-ulcer disease (Duan Minjie et al., 2016; Jia Ruirui et al., 2017), and some transgenic materials resistant to canker disease have been obtained. For example, Chen Shanchun et al. obtained Jincheng, Xinhuicheng and Navelcheng orange lines that were resistant to citrus canker by carrying the antimicrobial peptide D gene of the silkworm (Chen Shanchun et al., 1996); the exogenous genes NLS, chit42, Xa21 and PthA were resistant to citrus canker after being transferred to Bingtangcheng, Ponkan and Sweet Orange (Mendes et al., 2010; Yang et al., 2011); CsBZIP40 is an important transcription factor that responds to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway (Li et al., 2017); the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more sensitive to canker (Li et al., 2014); CRISPR / Cas9 targeted knockout of the promoter of the citrus canker susceptibility gene CsLOB1 can obtain plants with improved resistance to citrus canker (Penget al., 2017).

[0004] Ethylene-responsive factor (ERF) transcription factors are one of the largest classes of transcription factors in eukaryotes (Zhang Qi et al., 2018), and play an important role in plant growth, development, and response to abiotic and biotic stresses. For example, poplar PtaERF003 has a positive effect on adventitious root and lateral root proliferation (Trupiano et al., 2013); overexpression of ZmEREBP60 in corn can improve the tolerance of transgenic plants to drought stress (Zhu et al., 2022); overexpression of StERF94 in potato enhances potato resistance to solanum wilt (Charfeddin et al., 2019). At present, there is no research and application of using ERFs to improve citrus resistance to citrus canker. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a new option for improving the resistance of citrus to canker disease, as the existing citrus has poor resistance to canker disease. The purpose is to provide a method and application of the CsERF39 gene to improve the resistance of citrus to canker disease, thereby solving the problem of poor resistance of citrus to canker disease.

[0006] The present invention is achieved through the following technical solutions:

[0007] In one aspect, the present invention provides the use of CsERF39 gene in improving the resistance of citrus to ulcer disease. The nucleotide sequence of CsERF39 gene is shown in SEQ ID No.1.

[0008] As a possible design, the protein encoded by the above-mentioned CsERF39 gene is a citrus ethylene response factor.

[0009] On the other hand, the present invention also provides a method for improving the resistance of citrus to ulcer disease by using the CsERF39 gene, comprising the following steps:

[0010] (1) Cloning the coding sequence of citrus CsERF39;

[0011] (2) Construction of CsERF39 overexpression vector;

[0012] (3) Transform citrus with the CsERF39 overexpression vector and cultivate to obtain transgenic plants.

[0013] As a possible design, the method for cloning the citrus CsERF39 coding sequence in the above step (1) is: extracting citrus total RNA, reverse transcribing it into cDNA, using primers OE-CsERF39-F, OE-CsERF39-R and high-fidelity enzyme to perform PCR amplification and recover the CsERF39 coding sequence DNA fragment, wherein the primers OE-CsERF39-F and OE-CsERF39-R have the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

[0014] As a possible design, the method for constructing the CsERF39 overexpression vector in the above step (2) is: the CsERF39 coding sequence DNA fragment and the overexpression vector pLGNe are both recovered by double digestion with restriction endonucleases KpnⅠ and EcoRⅠ, and the CsERF39 coding sequence DNA fragment recovered by double digestion is connected to the pLGNe vector recovered by double digestion to construct the overexpression vector pLGNe-CsERF39.

[0015] As a possible design, the above-mentioned construction of the overexpression vector pLGNe-CsERF39 is specifically to transform Escherichia coli DH5α with the product of the CsERF39 coding sequence DNA fragment recovered by double enzyme digestion and the pLGNe vector recovered by double enzyme digestion, extract the plasmid of the positive clone, and obtain the overexpression vector pLGNe-CsERF39.

[0016] As a possible design, the method for transforming citrus with the CsERF39 overexpression vector in step (3) above is: the overexpression vector pLGNe-CsERF39 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

[0017] As a possible design, after cultivation in the above step (3), the genetically transformed explant cells are also identified by GUS staining, PCR identification and qRT-PCR analysis of CsERF39 expression; the transgenic plants are also evaluated for resistance, and it is determined that overexpression of CsERF39 improves resistance to citrus canker.

[0018] As a possible design, the primers for the above-mentioned PCR identification of transgenic plants are: ID-CsERF39-F and ID-CsERF39-R, ID-CsERF39-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsERF39-R is designed based on the terminal sequence of the CsERF39 gene. ID-CsERF39-F and ID-CsERF39-R have the nucleotide sequences shown in SEQ ID No.4 and SEQ ID No.5, respectively.

[0019] As a possible design, the primers for the above qRT-PCR analysis of CsERF39 expression are: RT-CsERF39-F and RT-CsERF39-R, and RT-CsERF39-F and RT-CsERF39-R have the nucleotide sequences shown in SEQ ID No.6 and SEQ ID No.7, respectively.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0021] The invention improves the resistance of citrus canker based on overexpression of CsERF39. By cloning the coding sequence of citrus CsERF39, constructing an overexpression vector, and then transforming citrus, the degree of citrus canker in the obtained transgenic plants can be reduced to 47.5% of the existing citrus at most, which can greatly improve the resistance of citrus to canker, significantly reduce the degree of citrus canker, reduce the area of ​​lesions, and does not require the application of any drugs. It is an efficient and green disease resistance technology, and also provides new ideas and methods for the research of citrus resistance genes, and provides new gene resources for the resistance improvement of citrus varieties and the breeding of new varieties with broad-spectrum disease resistance. Therefore, the invention is a potential bioengineering technology for improving the resistance of citrus canker, and has great value for molecular breeding of citrus resistance to canker. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0023] Figure 1 The bioinformatics characteristic diagram of CsERF39 of the embodiment of the present invention: A is the chromosome location of the citrus CsERF39 gene, bp represents base; B is the gene structure of citrus CsERF39, UTR represents non-coding region; C is the functional domain of citrus CsERF39, AP2 represents APETALA2 domain; D is the conserved domain of the citrus CsERF39 gene, aa represents amino acid;

[0024] Figure 2 The electrophoresis diagram of PCR amplification of the CsERF39 gene clone of the embodiment of the present invention: CDS represents the CsERF39 coding sequence; M represents the DNA molecular weight standard (the same below);

[0025] Figure 3 This is a diagram of the structure of the overexpression vector of CsERF39 plant in the embodiment of the present invention: GUS represents the β-glucosidase gene; CaMV35S represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the opine synthase gene terminator;

[0026] Figure 4 This is a flow chart of citrus genetic transformation according to an embodiment of the present invention;

[0027] Figure 5GUS staining diagram of transgenic plants of the present invention: OE39-1, OE39-2, OE39-3, OE39-4 represent transgenic plants, WT represents wild-type Wanjin Orange plant, + represents plasmid pLGNe-CsERF39 (the same below);

[0028] Figure 6 This is a PCR identification diagram of a transgenic plant according to an embodiment of the present invention;

[0029] Figure 7 This is a graph showing the expression of CsERF39 in the transgenic plants of the present invention: ** indicates a significant difference compared with WT (P<0.01) (the same below);

[0030] Figure 8 The phenotype diagram of the transgenic plant of the embodiment of the present invention;

[0031] Fig. 9 This is a symptom diagram of the transgenic plant leaves inoculated with ulcer bacteria 10 days after the embodiment of the present invention;

[0032] Fig.10 This is a statistical diagram of the size of lesions on the leaves of the transgenic plants according to the embodiment of the present invention after being inoculated with canker bacteria 10 days later;

[0033] Fig.11 This is a statistical graph of the disease index of the transgenic plant leaves in an embodiment of the present invention 10 days after inoculation of ulcer bacteria. DETAILED DESCRIPTION

[0034] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0035] It should be noted that: the embodiment of the present invention uses Wanjin orange as the test object. In practical applications, the method can also be used to improve the resistance of other citrus varieties to ulcer disease.

[0036] Example 1

[0037] Bioinformatics Analysis of Citrus CsERF39 Gene

[0038] The citrus CsERF39 gene is located between 753267bp and 754745bp on chromosome 5 of citrus. The chromosome is 50202760bp in length, and the CDS sequence is 789bp in length, encoding 262 amino acids. Analysis of the protein sequence showed that there is an obvious AP2 structural functional domain (refer to Figure 1 ).

[0039] The nucleotide sequence of the CsERF39 gene SEQ ID NO: 1 (the CDS sequence of CsERF39, from ATG to the stop codon) is as follows:

[0040] ATGGCAAAAAATATCAACAACATAAACGAAAATGCTTCTCTAGACATTTTGCGGAGCTCATCCAATTCTGCGGCCGGGGGTGCAGCCAGTAGTAGTTCCTCCAGTTCATGTTCAGAGAGTCCAACCAAGAAGCCGTCAAATAATATTAATATTAATTGCCGTAGAGAGAAGAAGAAAGCCCAAAATGGCAAGCATCGGACCTGCAGTAGTACCGGCTGCTGCTATAGAGGAGTACGTATGCGTAGTTGGGGCAAATGGGTTTCTGAAATTCGCGAGCCCAGAAAAAAATCAAGAATATGGCTTGGTACTTACCCTATTCCTGAAATGGCGGCTCGAGCTCATGATGTTGCCGCTTTAGCCATCAAAGGCCGCTCCGCTTTCCTCAATTTCCCACTACTCGCTCATCAACTTCCAAGTCCCCTCTCCAAATCTCCCAAGGACATTCAAGCCGCCGCTGCCGAGGCCGCAGCCGCATTTCAAGCCGAGCCCGATCCCCTGCAGCTTCCCCATGTTCGTGTACTCTCTTCTTCGTCAAACTCAAACACTACTACTGGTACCACCAGTTTATTATCATCGGATAGTACCAACGTGAACACGCAAGAATTGACAAGCTCTCCTAATGATTCCCTTCATCTTCATCATCGGGACGATGACGATGCTTTCTTTGACCTCCCTGATCTCTTCATCAATGGCTCTGATCATCTAGGTGGTGGCTTTTGCAGCTACTTATCGACGTCAGTCGACACTGGGTTCAGGCTCGAGGAGCCATTCTTGTGGGAGTATCAGTAG

[0041] Example 2

[0042] Cloning of the citrus CsERF39 coding sequence

[0043] 1. RNA extraction and cDNA synthesis

[0044] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured by a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A).

[0045] 2. PCR Amplification of CsERF39 Coding Sequence

[0046] The CsERF39 coding sequence was amplified from citrus cDNA using primers OE-CsERF39-F (SEQ ID No. 2), OE-CsERF39-R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTARMaxDNAPolymerase (TaKaRa, CAT: R045Q) to obtain a DNA fragment with a length of 789 bp (refer to Figure 2 ), the amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsERF39 gene (SEQ ID No. 1). Under ultraviolet light, a clean blade was used to cut out the agarose gel block containing the target fragment, and a kit (BioFlux, CAT: BSC02M1) was used to recover the DNA fragment.

[0047] PCR amplification program: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0048] The nucleotide sequence of primer OE-CsERF39-F, SEQ ID No. 2, is as follows:

[0049] GGTACCATGGCAAAAAATATCAACAACATAAACG

[0050] The nucleotide sequence of primer OE-CsERF39-R is shown in SEQ ID No.3:

[0051] GAATTCCTACTGATACTCCCACAAGAATGGC

[0052] Example 3

[0053] Construction of CsERF39 overexpression vector

[0054] The CsERF39 coding sequence DNA fragment and the overexpression vector pLGNe were double digested with restriction endonucleases KpnⅠ and EcoRⅠ (ThermoFisher), recovered from the gel and ligated overnight at 16°C using T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsERF39 overexpression vector pLGNe-CsERF39 (refer to Figure 3 ).

[0055] Example 4

[0056] Genetic transformation of citrus with CsERF39 overexpression vector

[0057] according to Figure 4 The process shown in the figure is used for citrus genetic transformation. The specific operations are as follows:

[0058] 1. Obtaining epicotyls of citrus seedlings

[0059] Fresh citrus fruits were washed and surface disinfected with 70% alcohol. The seeds were taken out under sterile conditions, the seed coats were peeled off, and the seeds were germinated on seed germination medium. The seeds were cultured in the dark at 28°C for 2 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were taken under sterile conditions and cut into 1 cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0060] 2. Transformation of Agrobacterium with Overexpression Vector

[0061] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, blow and mix, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the pre-dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, blow and mix with a pipette, transfer to a sterile centrifuge tube, and shake and culture at 260 r / min and 28°C for 60 minutes; centrifuge the bacterial solution at 10000 r / min for 1 minute, discard the supernatant (about 100 μL of resuspended bacteria remain), resuspend and apply, and invert and dark culture at 28°C for 2 days; after the growth of plaques, use primers OE-CsERF39-F (SEQ ID No.2) and OE-CsERF39-R (SEQ PCR verification was performed on single colonies (ID No. 3).

[0062] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0063] 3. Preparation of Agrobacterium tumefaciens

[0064] Before transfection, streak the Agrobacterium (containing the pLGNe-CsERF39 vector) for transfection on LB solid medium containing 50 mg / L kanamycin; pick a single colony and inoculate it into 25 mL LB liquid medium containing the same antibiotics, and culture it at 28°C with shaking overnight; dilute the bacterial solution to OD=0.1 and continue to culture it to OD=0.5, centrifuge it at 5000r / min for 10 min, discard the supernatant, and resuspend it in MS liquid medium at pH 5.4 for transfection.

[0065] 4. Transformation of Citrus Epicotyls

[0066] Soak the citrus epicotyl stem segments in Agrobacterium solution for 13 minutes and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 26°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark conditions, subculture every two weeks, and then identify them by GUS staining.

[0067] 5. Seedling Culture of Transformants

[0068] When the seedlings grow to more than 1 cm, they are cut and grafted onto late orange seedlings in sterile test tubes and cultured in seedling medium; when the seedlings grow to about 5 cm, they are grafted onto citrus aurantium seedlings and cultured in a 28°C greenhouse.

[0069] The culture medium used in this embodiment is as follows:

[0070] Seed germination medium: MS + 30g / L sucrose + 2.5g / L Gelrite, PH 5.8.

[0071] Co-culture medium: MS+2mg / L BA+0.5mg / L IAA+1mg / L 2,4–D+100μmolAS+30g / L sucrose+2.5g / L Gelrite, PH 5.8.

[0072] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0073] Seedling medium: MS + 30g / L sucrose, PH 5.8.

[0074] Example 5

[0075] Verification of CsERF39 overexpressing transgenic plants

[0076] 1. GUS staining identification of transgenic plants

[0077] The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed blue color, while the leaf discs of the WT plants did not show color (refer to Figure 5 ).

[0078] 2. PCR Identification of Transgenic Plants

[0079] 100 mg of transgenic plant leaves were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsERF39 coding sequence in the citrus genome. The detection primers were ID-CsERF39-F (SEQ ID No. 4) and ID-CsERF39-R (SEQ ID No. 5). A 1189 bp amplified fragment was obtained from the positive plants, while no amplification was obtained from the WT plants (refer to Figure 6 ).

[0080] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0081] The nucleotide sequence of primer ID-CsERF39-F, SEQ ID No. 4, is as follows:

[0082] TCGTTGAAGATGCCTCTGCCGACAG

[0083] The nucleotide sequence of primer ID-CsERF39-R is shown below:

[0084] CTACTGATACTCCCACAAGAATGGC

[0085] 3. qRT-PCR Analysis of Transgenic Plants

[0086] Total RNA (Aidelai, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScriptRT Master Mix (TaKaRa, CAT: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsERF39-F (SEQ ID No.6) and RT-CsERF39-R (SEQ ID No.7). The 2-△△Ct method was used to calculate the relative expression level of the CsERF39 gene in transgenic plants: the water-treated sample was defined as the reference factor, that is, its CsERF39 expression level was 1, and then the multiple 2-△△Ct of the gene expression relative to the reference factor in the transgenic citrus was calculated as its relative expression level. The results showed that the CsERF39 gene was expressed at a high level in the transgenic plants compared with the wild-type plants, and the highest was more than 64 times that of the control (reference Figure 7 ).

[0087] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0088] The nucleotide sequence of primer RT-CsERF39-F is shown in SEQ ID No.6:

[0089] TACGTATGCGTAGTTGGGGC

[0090] The nucleotide sequence of primer RT-CsERF39-R is shown in SEQ ID No.7:

[0091] CCTTTGATGGCTAAAGCGGC

[0092] 4. Phenotypic observation of transgenic plants

[0093] The phenotypes of the four transgenic plants were observed and analyzed, and no obvious abnormalities were found in their appearance and growth (refer to Figure 8 ). This indicates that overexpression of the CsERF39 gene did not have a significant effect on the phenotype and development of the plant.

[0094] Example 6

[0095] Resistance evaluation of CsERF39 overexpressing transgenic plants

[0096] The mature leaves of transgenic plants were washed, disinfected with 75% alcohol, rinsed with sterile water, and placed on a clean bench; the leaves were punctured with a needle at the center of the vein, and the ulcer pathogen solution was spotted with a pipette, with 1 μL (1X 105 CFU / mL) spotted in each pinhole; the leaves were cultured in a 28°C constant temperature and light incubator (16 h light / 8 h dark); the leaves were photographed 10 days after the bacteria were spotted, and the lesion area was counted using Image J V1.47 software.

[0097] The disease condition is divided into grades 0-7 according to the area of ​​lesions, with the letter R representing the area of ​​lesions, grade 0 (R≤0.25mm2), grade 1 (0.25mm2<R≤0.5mm2), grade 2 (0.5mm2<R≤0.75mm2), grade 3 (0.75mm2<R≤1mm2), grade 4 (1.0mm2<R≤1.25mm2), grade 5 (1.25mm2<R≤1.5mm2), grade 6 (1.5mm2<R≤1.75mm2), grade 7 (R>1.75mm2); the disease index is calculated according to the formula: DI=100XΣ[number of lesions at each grade X corresponding grade value] / (total number of lesions X maximum grade).

[0098] The results showed that 10 days after inoculation with the ulcer pathogen, the overexpression plants and the WT plants grafted at the same time developed disease to varying degrees, and there were certain differences in the size of the lesions (refer to Fig. 9 ). According to statistics, the lesion area of ​​transgenic plants was significantly smaller than that of wild-type controls, which was 51.3%-58.1% of the controls (refer to Fig.10 The disease index of transgenic plants was significantly lower than that of wild-type controls, ranging from 47.5% to 54.2% of the controls (refer to Fig.11 ). It can be seen that overexpression of CsERF39 can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus bacterial canker.

[0099] It can be seen that overexpression of CsERF39 can greatly reduce the lesion area of ​​ulcer disease and alleviate the severity of ulcer disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for citrus ulcer disease resistance molecular breeding.

[0100] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of CsERF39 gene in improving resistance of citrus to ulcer disease, characterized in that: The nucleotide sequence of the CsERF39 gene is shown in SEQ ID No.

1.

2. The use of the CsERF39 gene according to claim 1 in improving the resistance of citrus to ulcer disease, characterized in that: The protein encoded by the CsERF39 gene is a citrus ethylene response factor.

3. A method for improving citrus resistance to ulcer disease by using CsERF39 gene, characterized in that: The steps include: (1) Clone the coding sequence of citrus CsERF39, the coding sequence of citrus CsERF39 is shown in the nucleotide sequence SEQ ID NO: 1; (2) Construction of CsERF39 overexpression vector; (3) Transform citrus with the CsERF39 overexpression vector and cultivate to obtain transgenic plants.

4. The method for improving citrus resistance to ulcer disease by using the CsERF39 gene according to claim 3, characterized in that: The method for cloning the citrus CsERF39 coding sequence in step (1) is: extracting citrus total RNA, reverse transcribing it into cDNA, using primers OE-CsERF39-F, OE-CsERF39-R and a high-fidelity enzyme to perform PCR amplification and recover the CsERF39 coding sequence DNA fragment, wherein the primers OE-CsERF39-F and OE-CsERF39-R have the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.

5. The method for improving citrus resistance to ulcer disease by using CsERF39 gene according to claim 3, characterized in that: The method for constructing the CsERF39 overexpression vector in step (2) is as follows: the CsERF39 coding sequence DNA fragment and the overexpression vector pLGNe are both double-digested with restriction endonucleases KpnⅠ and EcoRⅠ to be recovered, and the CsERF39 coding sequence DNA fragment recovered by double-digestion is connected to the pLGNe vector recovered by double-digestion to construct the overexpression vector pLGNe-CsERF39.

6. The method for improving citrus resistance to ulcer disease by using CsERF39 gene according to claim 5, characterized in that: The overexpression vector pLGNe-CsERF39 is constructed by connecting the CsERF39 coding sequence DNA fragment recovered by double enzyme digestion to the pLGNe vector recovered by double enzyme digestion, transforming the product into Escherichia coli DH5α, extracting the plasmid of the positive clone, and obtaining the overexpression vector pLGNe-CsERF39.

7. The method for improving citrus resistance to ulcer disease by expressing CsERF39 gene according to claim 3, characterized in that: Step (3) The method for transforming citrus with the CsERF39 overexpression vector is as follows: the overexpression vector pLGNe-CsERF39 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens.

8. The method for improving citrus resistance to ulcer disease by using CsERF39 gene according to claim 3, characterized in that: In step (3), after cultivation, the genetically transformed explant cells were further subjected to GUS staining identification, PCR identification and qRT-PCR analysis to determine the expression level of CsERF39; the transgenic plants were also evaluated for resistance, and it was determined that overexpression of CsERF39 improved resistance to citrus canker.

9. The method for improving citrus resistance to ulcer disease by using CsERF39 gene according to claim 8, characterized in that: The primers for PCR identification of transgenic plants are: ID-CsERF39-F and ID-CsERF39-R, and the ID-CsERF39-F and ID-CsERF39-R have the nucleotide sequences shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.

10. The method for improving citrus resistance to ulcer disease by using CsERF39 gene according to claim 8, characterized in that: The primers for analyzing the expression of CsERF39 by qRT-PCR are: RT-CsERF39-F and RT-CsERF39-R, and the RT-CsERF39-F and RT-CsERF39-R have the nucleotide sequences shown in SEQ ID No. 6 and SEQ ID No. 7, respectively.

Images