T cells for tumor therapy were prepared by reducing the content or activity of SARDH protein.
By reducing the expression of SARDH protein or gene in T cells, T cells for tumor treatment were prepared, which solved the problems of limited killing ability and drug resistance of T cells and improved the efficacy of tumor immunotherapy.
Patent Information
- Application Number
- CN202410899015.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-05
- Publication Date
- 2026-07-03
- Estimated Expiration
- 2044-07-05
AI Technical Summary
Among existing tumor immunotherapy methods, T cells have limited ability to kill tumor cells and suffer from drug resistance, which cannot meet the treatment needs of most patients.
T cells for tumor therapy can be prepared by reducing the content or activity of SARDH protein in T cells, reducing the expression level of the SARDH gene, or knocking out the SARDH gene, including methods such as using SARDH protein inhibitors, PROTAC degrading agents, RNAi technology, and gene editing.
It significantly improved the ability of T cells to kill tumor cells, reduced the possibility of tumor drug resistance, and enhanced the effect of tumor immunotherapy.
Smart Images

Figure BDA0004929957090000061 
Figure BDA0004929957090000071 
Figure BDA0004929957090000081
Abstract
Description
Technical Field
[0001] This invention relates to the field of tumor immunotherapy, specifically to the preparation of T cells for tumor treatment by reducing the content or activity of SARDH protein. Background Technology
[0002] Humanity has conducted extensive research to combat the health threat posed by cancer, resulting in the development of various novel treatments and drugs. Among these, immunotherapy has shown great promise, with Science magazine recognizing it as the scientific breakthrough of 2013. T cells are the main cellular component of the immune system that kills cancer cells, and numerous cell immunotherapies have been designed targeting T cells. These include TILs, CAR-T, and TCR-T, which enhance the immune system's ability to kill cancer cells and have achieved many groundbreaking clinical treatment results.
[0003] Furthermore, immune checkpoint blockade (ICB) therapy, which addresses T-cell exhaustion, was awarded the Nobel Prize in 2018. It works by blocking inhibitory signals from immune cells, allowing T cells to be better activated and thus enhancing their ability to attack cancer cells. Although this therapy has achieved many promising clinical results, the mechanisms of tumor immunity are highly complex, meaning only a small percentage of cancer patients benefit, and many develop drug resistance. New drug targets remain to be developed. Currently approved immune checkpoint blockade therapies primarily target a few targets such as CTLA-4 and PD-1 / PD-L1. Considering the high heterogeneity of tumors and individual variability, this cannot meet the large and complex treatment needs.
[0004] With the development of cancer research, people have gradually realized the important role of T cells in the occurrence and development of cancer, and the significant shaping effect of the unique metabolic environment inside tumors on the differentiation of T cell subclasses. For example, the hypoxic environment, insufficient nutrients, and accumulation of metabolic products such as lactic acid within tumors promote the exhaustion of T cells. Summary of the Invention
[0005] The technical problem this invention aims to solve is how to conduct tumor immunotherapy, and further, how to enhance the killing ability of T cells against tumor cells. Through pan-cancer big data research, this invention has discovered a metabolic gene, SARDH, that inhibits T cell function, and found that artificially interfering with the expression of this gene can improve the effectiveness of existing T cell therapies in controlling tumor growth.
[0006] To address the aforementioned technical problems, this invention first provides a method for preparing T cells for tumor treatment. The method includes: reducing the content or activity of SARDH protein in recipient T cells, or reducing the expression level of the SARDH gene in recipient T cells, or knocking out the SARDH gene in recipient T cells, to obtain target T cells for tumor treatment.
[0007] In the above method, the reduction of SARDH protein content or activity in receptor T cells can be achieved by treating the receptor T cells with SARDH protein inhibitors or degrading agents (such as the PROTAC system for degrading SARDH protein).
[0008] The reduction of SARDH gene expression in recipient T cells is achieved by introducing siRNA or shRNA targeting the SARDH gene into the recipient T cells via RNAi.
[0009] The knockout of the SARDH gene in the recipient T cells can be achieved by editing the SARDH gene in the recipient T cells using gene editing methods.
[0010] Specifically, the sequence of the siRNA may be SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3;
[0011] The sequence of the shRNA may be as shown in SEQ ID No. 5.
[0012] This invention targets SARDH via RNAi, but does not limit the target site to the gene. Other methods that affect gene expression (such as CRISPRi) or use inhibitors to prevent its normal function are also within the scope of this invention.
[0013] In the above method, the recipient T cell can be a regular T cell, a TCR-T cell, or a CAR-T cell.
[0014] The method for preparing T cells for tumor treatment, whether used in the preparation of T cells for tumor treatment (such as TCR-T cells or CAR-T cells) or in the preparation of T cells with enhanced killing ability against cancer cells (such as TCR-T cells or CAR-T cells), is also within the scope of protection of this invention.
[0015] The present invention also provides a substance for preparing T cells for treating tumors, said substance containing (or having an active ingredient thereof) a substance that reduces the content or activity of SARDH protein, or a substance that reduces the expression level of SARDH gene, or a substance that knocks out SARDH gene.
[0016] The substance that reduces the content or activity of SARDH protein can be a SARDH protein inhibitor or degrader (such as the PROTAC system for degrading SARDH protein).
[0017] The substance that reduces the expression level of the SARDH gene may be a siRNA targeting the SARDH gene or a DNA recombinant vector capable of transcribing the siRNA, a shRNA targeting the SARDH gene or a DNA recombinant vector capable of transcribing the shRNA, a protein-RNA complex of the CRISPRi (gene repression / silencing) system, or a nucleic acid expression vector.
[0018] The substance that knocks out the SARDH gene can be a substance used for gene editing of the SARDH gene.
[0019] Specifically, the sequence of the siRNA may be as shown in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3;
[0020] The sequence of the shRNA may be as shown in SEQ ID No. 5.
[0021] The application of the substance used to prepare T cells for treating tumors in the preparation of T cells for treating tumors, or in the preparation of T cells with enhanced tumor-killing ability, is also within the scope of protection of this invention.
[0022] In this invention, the tumor may be a solid tumor or a non-solid tumor;
[0023] The tumor cells may be solid tumor cells or non-solid tumor cells.
[0024] In one embodiment of the present invention, the tumor cells are human malignant melanoma cells A375 cells.
[0025] In this invention, the SARDH gene GENE ID: 1757, updated on 3-Apr-2024; the SARDH protein genebank number: NP_001128179.1, PRI 04-APR-2024.
[0026] This invention is an optimization and modification based on TCR-T therapy. However, the effect of SARDH on improving T cell function does not depend on TCR. For example, reducing the expression of the SARDH gene in CD8+ T cells can also increase the expression of factors related to killing function. Therefore, this invention can be extended to all T cell-based therapies and is not limited to cancer treatment.
[0027] This invention discovers novel targets with significant innovative mechanisms of action. By reducing the content or activity of SARDH protein, decreasing the expression level of its encoding gene, or knocking out its encoding gene, the efficacy of T-cell immunotherapy can be further improved. This invention has the following advantages: 1. It effectively improves the efficacy of existing T-cell-based tumor immunotherapies (such as TCR-T); 2. Compared with targets of immunoblockade therapies such as PD-1 / PD-L1 and CTLA4, it does not rely on direct interaction between T cells and cancer cells, but rather affects the T cells themselves to exert their effects, thereby greatly reducing the possibility of cancer cell mutations leading to drug resistance. This invention starts with the metabolism of tumor-infiltrating T cells, providing a new perspective for revealing the mechanism by which T cells enter tumors and become exhausted.
[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description
[0029] Figure 1 Experimental results to reduce SARDH gene expression in T cells. The left figure shows the qPCR detection results of SARDH gene expression in T cells after siRNA transfection, where #1, #2, #3, and #4 represent SARDH-siRNA-1, SARDH-siRNA-2, SARDH-siRNA-3, and SARDH-siRNA-4, respectively. The right figure shows the detection results of SARDH content in T cells after lentivirus transformation. The top figure shows the Western blot detection results, and the bottom figure shows the quantitative analysis results.
[0030] Figure 2 To detect the expression of cytokines and effector factors related to cell killing function after the SARDH gene expression was reduced in CD8+ T cells, a subclass of T cells that directly exert a killing effect.
[0031] Figure 3 The results show the ability of TCR-T cells to kill target cells.
[0032] Figure 4 This shows the changes in tumor volume. The arrows indicate the TCR-T cell injection time. Detailed Implementation
[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.
[0034] The constitutive MART-1-expressing A375 cell line in the following examples was obtained by transfecting the melanoma cell line A375 with lentiviruses. 27-35 The cell, named A375 in the literature “Yanling Liang et al., Single-Cell Transcriptomics Reveals Killing Mechanisms of AntitumorCytotoxicCD4+TCR-T Cells, Frontiers in Immunology, July 2022, Volume 13”. MART-1 The public may obtain the biological material from the applicant. The biological material is only for repeating the relevant experiments of the present invention and may not be used for other purposes.
[0035] T2 cell line: T2(174x CEM.T2), ATCC, Cat#CRL-1992.
[0036] NSG immunodeficient mice: Shanghai Southern Model Biotechnology Co., Ltd., Cat#NM-NSG-001.
[0037] Example 1: Reducing SARDH gene expression in T cells can improve the therapeutic effect of T cells on tumors.
[0038] 1. Acquisition of T cells
[0039] Peripheral blood mononuclear cells (PBMCs) were obtained from human peripheral blood samples collected at Shanghai Zhaxin Hospital using the Ficoll-Hypaque density gradient centrifugation method. Then, EasySep... TM The Human CD3+ T Cell Isolation Kit (STEMCELL Technologies, Cat#17951) obtains T cells using magnetic bead sorting.
[0040] To avoid immune rejection, the obtained T cells were HLA-typed to obtain HLA-A*0201 T cells. MART-1-recognizing TCR-T cells were then obtained by transfecting HLA-A*0201 T cells with the vector plasmid DMF5, which recognizes a specific TCR sequence for MART-1, via lentiviral transfection. The specific steps for lentiviral preparation are as follows:
[0041] By synthesizing a TCR fragment, the DNA fragment between the BamHI and EcoRI recognition sequences of the lentiviral vector plasmid pRRLSIN.cPPT.PGK-GFP.WPRE was replaced with this TCR fragment to obtain the recombinant plasmid DMF5. This recombinant plasmid, along with the lentiviral packaging plasmids PsPAX2 (Addgene), pMD2.G (Addgene), and Lenti-X, were then used to generate the recombinant plasmid. TM Lentiviral virus was obtained by packaging 293T cell line.
[0042] The sequence of the TCR fragment is as follows:
[0043]
[0044] 2. Decreased SARDH gene expression leads to T cell acquisition.
[0045] Building upon existing T-cell-based therapies, we can reduce the expression level of the SARDH gene through methods such as RNAi.
[0046] 2.1 siRNA transfection
[0047] Taking TCR-T therapy as an example, siRNA transfection was used to introduce siRNA targeting the SARDH gene into TCR-T cells expressing MART-1 recognition obtained in step 1, thereby reducing the level of transcribed RNA. Using Entranster™-R4000 (Engreen Biosystems, Cat#4000-3), four siRNAs targeting the SARDH gene at different sites, along with a non-targeting control siRNA (NT) without a target in the genome, were administered at a dosage of 1.67 μg / 102 6 The cells were transfected into TCR-T cells expressing MART-1 recognition at specific ratios. The sequences of the siRNAs used are as follows:
[0048] NT: 5'-AAUUCUCCGAACGUGUCACGU-3';
[0049] SARDH-siRNA-1: 5′-CAAGAACUACUCCGUCGUCUU-3′;
[0050] SARDH-siRNA-2: 5'-CAAGAGGGUGAAGGGAAUCUA-3' (SEQ ID No. 1);
[0051] SARDH-siRNA-3: 5'-GCAAGGCGUAUGGUGUGGAAU-3' (SEQ ID No. 2);
[0052] SARDH-siRNA-4: 5'-GCUUCAACAGCGCAGGAAUGA-3' (SEQ ID No. 3).
[0053] Forty-eight hours after transfection, transfected T cells were collected, mRNA was extracted and reverse transcribed, and the transcription level of SARDH in the cells was detected by qPCR (using the housekeeping gene GAPDH as an internal control). The primers for identification are as follows:
[0054] SARDH-F: 5′-CGCATCCAGGGCATTCAGAAC-3′;
[0055] SARDH-R: 5′-AAGATGGGGTTGGCCTCATAG-3′;
[0056] GAPDH-F: 5′-ACAACTTTGGTATCGTGGAAGG-3′;
[0057] GAPDH-R: 5′-GCCATCACGCCACAGTTTC-3′.
[0058] The results are as follows Figure 1 As shown in the middle left figure, SARDH-siRNA-2, SARDH-siRNA-3, and SARDH-siRNA-4 can significantly reduce the expression level of the SARDH gene.
[0059] 2.2 Lentiviral transfection
[0060] The inventors further used lentiviral transfection to transform the shRNA vector interfering with SARDH expression into the MART-1-recognizing TCR-T cells obtained in step 1, thereby reducing the level of translated protein. Given that SARDH-siRNA-4 has the highest efficiency in inhibiting SARDH expression, an shRNA vector was designed based on this sequence and delivered to T cells using lentiviral transformation to achieve a permanent reduction in SARDH expression. The steps are as follows:
[0061] Construction of recombinant vectors:
[0062] The sequence of the recombinant vector for reducing SARDH expression was prepared as shown in SEQ ID No. 4. Positions 2896-2944 of SEQ ID No. 4 are the DNA sequence for transcribing shRNA, which is used to transcribe the shRNA for reducing SARDH expression shown in SEQ ID No. 5.
[0063] A control vector was prepared by replacing the DNA fragment shown at positions 2896-2944 of SEQ ID No. 4 in the above recombinant vector with the DNA fragment shown in the following sequence:
[0064] GAATTCTCCGAACGTGTCACGTTCAAGAGACGTGACACGTTCGGAGAATT.
[0065] SEQ ID No. 4 (Recombinant vector for reducing SARDH expression; the underlined part is the DNA sequence for expressing shRNA):
[0066]
[0067]
[0068]
[0069]
[0070] SEQ ID No. 5 (shRNA for reducing SARDH expression):
[0071]
[0072] Acquisition of lentiviruses:
[0073] 1) Prepare Lenti-X in advance TM 293T cell line (Takara BioCat#632180), cultured in DMEM + 10% FBS, 1% Glutamax, 1% penicillin-streptomycin. Cells were examined under a microscope. Cell coverage at the bottom of the culture plate should be approximately 80-90%, with uniform distribution.
[0074] 2) One hour before transfection, remove the cell plate, remove the original cell culture medium, add 9 mL of Opti-MEM culture medium, and return the cells to the incubator.
[0075] 3) Take 1 mL of Opti-MEM medium, add 10 μg of the target vector (recombinant vector or control vector used to reduce SARDH expression), 10 μg of pCMV-dR8.9 packaging plasmid (Addgene), and 1 μg of pCMV-VSV-G plasmid, then add 21 μL of X-tremeGENE transfection reagent. TM HP DNA Transfection Reagent (Merck Cat#6366236001), mix gently with a pipette.
[0076] 4) Incubate at room temperature for 20 minutes to allow the DNA and transfection reagent to fully combine and form a transfection complex.
[0077] 5) Add the DNA-transfection reagent complex obtained in step 4) evenly dropwise into the cell culture plates from step 2), 1 mL per plate. Shake the culture plates back and forth to mix, then return them to a 5% CO2 incubator.
[0078] 6) After 8 hours, remove the cell supernatant and replace it with 10 mL of DMEM complete culture medium.
[0079] 7) Return the cells to the incubator and continue culturing for 2 days (36-48 hours).
[0080] 8) Collect all the supernatant and aliquot it into 50mL centrifuge tubes.
[0081] 9) Centrifuge at 4℃, 500×g for 10 minutes to remove detached cells and large cell debris to obtain lentivirus or control lentivirus for reducing SARDH expression.
[0082] Lentiviral transformation of T cells: Lentiviral virus used to reduce SARDH expression or control lentivirus was added to the TCR-T cells expressing MART-1 obtained in step 1 for lentiviral infection. After completion, T cells were collected to obtain T cells with reduced SARDH expression (denoted as shSARDH-TCR-T cells) and control T cells (denoted as shNT-TCR-T cells).
[0083] SARDH expression level detection: RIPA lysis was used to obtain proteins in shSARDH-TCR-T cells and shNT-TCR-T cells, and then Western blot was used to determine changes in SARDH expression levels. The antibodies used were SARDH antibody (ThermoFisher Scientific, Cat#PA5-97225) and GAPDH antibody (internal control, Cell Signaling Technology, Cat#2118S).
[0084] The results are as follows Figure 1 As shown in the middle right figure, the content of SARDH protein in T cells was significantly reduced after transformation with lentiviruses that reduced SARDH expression.
[0085] 3. The effect of decreased SARDH expression on factors related to cytotoxic function in CD8+ T cells.
[0086] Peripheral blood mononuclear cells (PBMCs) were obtained from human peripheral blood samples collected at Shanghai Zhaxin Hospital using Ficoll-Hypaque density gradient centrifugation. CD8+ T cells, a subclass of ordinary T cells capable of direct cytotoxicity, were identified by flow cytometry antibody staining and flow cytometry to determine the expression of factors related to cytotoxic function and their relationship with SARDH. The detection indicators included the cytokines interferon-gamma (IFN-γ), cytotoxic factor-α (TNF-α), and granzyme B (GzmB). The flow cytometry antibodies used were: APC anti-human CD8 Antibody (BioLegend, Cat#344722), FITC anti-human IFN-γ Antibody (BioLegend, Cat#502506), PE anti-human TNF-α Antibody (BioLegend, Cat#502909), Granzyme B Monoclonal Antibody (GB12), and PE (ThermoFisher Scientific, Cat#MHGB04).
[0087] The experimental results are shown in Figure 2 The study found that reducing SARDH expression can increase the expression of IFN-γ, TNF-α, and GzmB in CD8+ T cells, thereby enhancing the killing ability of T cells.
[0088] 4. Detection of the ability of TCR-T cells to kill target cells
[0089] In vitro experiments demonstrated that reducing SARDH expression can enhance the ability of TCR-T cells to kill target cells. In TCR-T cells expressing MART-1, SARDH expression levels were reduced using shRNA. The resulting TCR-T cells (i.e., shSARDH-TCR-T cells and shNT-TCR-T cells from step 2) were then co-cultured with target cells. The number of target cells was measured after 24 hours to determine whether the killing ability of TCR-T cells had changed. Two types of target cells were used: the A375 cell line constitutively expressing MART-1 and the T2 cell line.
[0090] Detection of killing effect of constitutively MART-1-expressing A375 cell line: A375 cell line constitutively expressing MART-1 was collected in HIPP-T009 medium at a concentration of 5 × 10^5 cells / mL to obtain a target suspension. For relative quantitative analysis, AccuCheck counting beads (ThermoFisher Scientific) were uniformly added to the target cell suspension. Subsequently, TCR-T cells (shSARDH-TCR-T cells or shNT-TCR-T cells) were added to the suspension at a 1:1 ratio to the target cells, and incubated in a 5% CO2 incubator. "HLA-A*0201 T cells" from step 1, under the same culture conditions, were used as a control instead of "TCR-T cells".
[0091] Detection of T2 cell line killing: T2 cells were collected at the same concentration in IMDM medium (serum-free) and then cultured overnight with 10 μg / mL peptide (LAGIGILTV, a key peptide recognized by MART-1) to promote peptide loading on the cell surface. The medium was then changed to HIPP-T009 to obtain a target suspension. For relative quantitative analysis, AccuCheck counting beads (ThermoFisher Scientific) were uniformly added to the target cell suspension. TCR-T cells (shSARDH-TCR-T cells or shNT-TCR-T cells) were then added at a 1:1 ratio to the target cells and incubated in a 5% CO2 incubator. A control was prepared using step 1 without the addition of the "key peptide recognized by MART-1" under the same culture conditions.
[0092] After incubating target cells with TCR-T cells for at least 6 hours, flow cytometry was used to determine the killing efficiency, which was calculated using the following formula: [1-([TC]e / [beads]e) / ([TC]c / [beads]c)]×100%. [TC]e and [beads]e represent the number of target cells and microbeads in the experimental group, respectively, while [TC]c and [beads]c represent the number in the control group.
[0093] result( Figure 3 The results showed that, compared with the control group, reduced SARDH expression enhanced the ability of TCR-T cells to kill target cells, and the difference reached a significant level after 24 hours of co-culturing TCR-T cells and target cells.
[0094] 5. Reduce the impact of SARDH-expressing TCR-T cells on tumor growth.
[0095] 5×106 One constitutively MART-1-expressing A375 cell was resuspended in PBS to a volume of 50 μL, then 50 μL of matrix gel was added, mixed thoroughly, and injected subcutaneously into the right hind limb dorsal region of NSG immunodeficient mice. After approximately 12 days, the subcutaneous tumor grew to about 50 mm. 3 The shSARDH-TCR-T cells obtained in step 2 were injected via the tail vein at a dose of 3 × 10⁻⁶. 6 Cells were resuspended in PBS to an injection volume of 100 μL.
[0096] Following the above method, “shSARDH-TCR-T cells” were replaced with “shNT-TCR-T cells” as a control group.
[0097] Then, shSARDH-TCR-T cells (or shNT-TCR-T cells) were injected via the tail vein every 7 days until the tumor in the control group grew to approximately 1500 mm. 3 .
[0098] The results are as follows Figure 4 As shown, compared with the control group, reduced SARDH expression enhanced the ability of TCR-T cells to control tumor growth, meaning that TCR-T cells with reduced SARDH expression can be used to treat tumors.
[0099] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A method for preparing T cells for tumor treatment, including: Reduce the expression level of the SARDH gene in recipient T cells to obtain target T cells for tumor treatment; The T cells have the ability to kill cancer cells; The reduction of SARDH gene expression in recipient T cells is achieved by introducing siRNA or shRNA targeting the SARDH gene into the recipient T cells using the RNAi method. The sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; The sequence of the shRNA is shown in SEQ ID No.
5.
2. The method according to claim 1, characterized in that: The tumor can be a solid tumor or a non-solid tumor.
3. The method according to claim 1, characterized in that: The recipient T cells are TCR-T cells or CAR-T cells.
4. The use of the method according to any one of claims 1-3 in the preparation of T cells for the treatment of tumors.
5. The application of the method according to any one of claims 1-3 in the preparation of T cells with enhanced killing ability against cancer cells.
6. Application of substances that reduce SARDH gene expression in the preparation of T cells for tumor treatment; The substance that reduces the expression level of the SARDH gene is a siRNA that targets the SARDH gene or a DNA recombinant vector that can transcribe the siRNA, or a shRNA that targets the SARDH gene or a DNA recombinant vector that can transcribe the shRNA. The sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; The sequence of the shRNA is shown in SEQ ID No.
5.
7. Application of substances that reduce the expression level of the SARDH gene in the preparation of T cells with enhanced tumor cell killing ability; wherein the substance that reduces the expression level of the SARDH gene is a siRNA that targets the SARDH gene or a DNA recombinant vector that can transcribe the siRNA, or a shRNA that targets the SARDH gene or a DNA recombinant vector that can transcribe the shRNA. The sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; The sequence of the shRNA is shown in SEQ ID No.
5.
8. The application according to claim 4, 6, or 7, characterized in that: The tumor may be a solid tumor or a non-solid tumor; The tumor cells can be solid tumor cells or non-solid tumor cells.