Application of miR396-x in regulating anthocyanin content of purple bud tea
By expressing miR396-x in purple bud tea to inhibit CsMET1 and downregulate the methylation rate of CsSOT and CsF3'H1, the anthocyanin content of purple bud tea was increased, which solved the shortcomings of the existing technology in the regulation of anthocyanins in tea trees and provided a new method for tea tree breeding.
Patent Information
- Application Number
- CN202410999863.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-24
- Publication Date
- 2026-07-07
- Estimated Expiration
- 2044-07-24
AI Technical Summary
The existing technology has not yet conducted in-depth research on the regulation of anthocyanin content in tea trees by miR396, and there is a lack of effective regulation methods to increase the anthocyanin content of purple bud tea.
By expressing miR396-x or its precursor in purple bud tea as a target inhibitor, the expression of the DNA methyltransferase gene CsMET1 is downregulated, and the methylation rate of CsSOT and CsF3'H1 genes is reduced, thereby increasing the accumulation of anthocyanins.
By regulating the expression of miR396-x, the anthocyanin content in purple bud tea was significantly increased, providing a new direction for the breeding of new tea varieties and enhancing the tea tree's resistance to stress and pest control.
Smart Images

Figure BDA0004961261540000041 
Figure HDA0004961261550000011 
Figure HDA0004961261550000012
Abstract
Description
Technical Field
[0001] This invention relates to the application of miR396-x in regulating the anthocyanin content of purple bud tea, and belongs to the fields of botany and genetic technology. Background Technology
[0002] Recent research on tea plant microRNAs has made some progress. For example, some researchers have conducted whole-genome microRNA analysis on tea plants, discovering microRNAs, metabolites, degraders, and co-expression networks related to important flavor compounds in nine different tissues of the tea plant, revealing the relationship between the secondary metabolism of important flavor compounds and microRNAs. Transcriptome and microRNA association analysis of sun-withered oolong tea showed that sun-withering can regulate microRNAs to inhibit flavonoid synthesis and promote terpene synthesis, leading to flavor formation. Simultaneously, metabolome, transcriptome, small RNA, degraderome, and WGCNA analyses of tea buds at different locations in sun-withered oolong tea revealed... croRNA-TF may synergistically regulate the biosynthesis of flavor compounds in tea leaves with plant hormones. MicroRNA sequencing and metabolomics association analysis of different tissues in "Pingyang Tezao" tea revealed the presence of conserved microRNAs during bud development and quality formation. Phenylalanine ammonia-lyase (PAL) is regulated by miR477, which may play a negative regulatory role in tea disease infection by inhibiting PAL expression and enhancing the tea plant's disease adaptability. Association analysis of metabolomics, degradation mechanisms, small RNAs, and transcriptomes of leaf tissues from "Shucha Zao" tea in different seasons revealed a gene regulatory network involving microRNAs in the synthesis of terpenoids in different seasons. Most of these studies focus on omics analysis; the mechanisms of microRNA regulation in tea plants require further in-depth investigation.
[0003] Research on the molecular regulatory mechanisms controlling anthocyanin synthesis at the epigenetic level is still in its early stages. For example, current studies have confirmed that light-induced anthocyanin synthesis in apple peel is regulated by the methylation level of the MdMYB10 gene promoter region. Genomic methylation analysis of cultured potato cells shows that anthocyanin-producing potato cells have higher levels of methylation at certain genomic loci.
[0004] Existing technology CN 106676106 B discloses a miRNA that regulates seed shape, insect resistance, and salt tolerance in plants and its applications, revealing the relationship between the expression of miR396 or its precursor in gramineous plants and traits such as seed shape. It also shows that downregulating the expression of miR396 or its precursor in plants increases anthocyanin content. However, the effect of miR396 on anthocyanin content in tea plants has not yet been studied. Summary of the Invention
[0005] According to one aspect of the invention, the use of miR396-x or its precursor in regulating the anthocyanin content of purple bud tea is provided.
[0006] This invention discovers that among the 14 DNA methyltransferases in purple bud tea, the coding region of CsMET1 contains a target site for a small RNA molecule, miR396-x, associated with DNA methylation. miR396-x can act as a target inhibitor to suppress CsMET1 expression in purple bud tea. miR396-x can target the CsMET1 DNA methyltransferase gene in tea plants, which is responsible for maintaining DNA methylation levels, leading to a downregulation of CsMET1 expression. This, in turn, reduces the methylation rate of the CsSOT gene and CsF3'H1upstream_2k in purple bud tea, ultimately increasing anthocyanin accumulation. Using miR396-x in tea plant breeding can regulate anthocyanin accumulation in tea plants.
[0007] According to another aspect of the present invention, the application of a product that can increase the expression level of miR396-x in purple bud tea leaves in increasing the anthocyanin content of purple bud tea is provided.
[0008] Regulating the expression level of miR396-x in purple bud tea leaves can regulate the accumulation of anthocyanins in purple bud tea.
[0009] In some embodiments, the product that can increase the expression level of miR396-x in purple bud tea leaves is an expression vector containing a nucleotide sequence of miR396-x or its precursor.
[0010] In some embodiments, the expression vector is a pCAMBIA1302 vector containing a nucleotide sequence of miR396-x or its precursor.
[0011] In some implementations, the purple bud tea variety is Hongfei.
[0012] According to another aspect of the present invention, a method for adjusting the anthocyanin content of purple bud tea using miR396-x is provided, comprising the following steps:
[0013] An expression vector was constructed using the precursor of miR396-x, pri-miR396-x, and transformed into Agrobacterium to infect purple tea leaves.
[0014] In some implementations, the infection time is 1 to 3 days.
[0015] In this invention, Agrobacterium-mediated infection and genetic transformation are difficult to demonstrate significant effects within a timeframe of less than 1 day (e.g., 12 hours).
[0016] According to another aspect of the present invention, a purple bud tea tree in which miR396-x was selected is provided.
[0017] miR396-X can regulate CsMET1, which maintains DNA methylation, and can help us to better understand the regulatory mechanism of DNA methylation in tea plants. This is of great significance for understanding processes such as gene expression, cell differentiation, and growth and development. At the same time, this also provides the possibility for developing new tea varieties that target DNA methylation regulation in the future, thereby improving the tea plant's resistance to stress and pests and diseases.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] This invention innovatively discovers that miR396-x can act as a target inhibitor in purple bud tea, downregulating the expression of the DNA methyltransferase gene CsMET1 in purple bud tea, thereby downregulating the methylation rate of the CsSOT gene and / or CsF3'H1 gene in purple bud tea, and thus increasing the anthocyanin content in purple bud tea, providing a new direction for the subsequent breeding of new tea varieties. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of the new shoots, dry tea leaves, and tea liquor of the "Hongfei" purple bud tea variety in this invention.
[0021] Figure 2 This is a graph showing the expression analysis of miR396-x and CsMET1 in the green buds (Hongfei-G) and purple buds (Hongfei-P) of the purple bud tea variety "Hongfei" in this invention.
[0022] Figure 3 This is a graph showing the change in CsMET1 expression level after purple bud tea leaves were infected with miR396-x as a target inhibitor in Example 1 of the present invention. Detailed Implementation
[0023] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following examples are all commercially available.
[0024] The research sample used in this example is the purple bud of the new purple bud tea variety "Hongfei". Specifically, it uses 3-4 tender leaves below the tip of the new shoot. These tender leaves are reddish-purple year-round, while the leaves below them are green, exhibiting stable heritability. After being processed into roasted green tea, the tea soup is pink (e.g., ...). Figure 1 It still retains a rich amount of anthocyanins.
[0025] Example 1
[0026] A method for regulating anthocyanin content in purple bud tea using miR396-x includes the following steps: constructing an expression vector using the miR396-x precursor pri-miR396-x, transforming Agrobacterium tumefaciens, and infecting Red Princess tea leaves;
[0027] Among them, the miR396-x precursor pri-miR396-x was artificially synthesized by RiboXingke Biotechnology Co., Ltd., and its sequence is as follows:
[0028] miR396-x(5'to 3'):UUCCACAGCUUUCUUGAACUU;
[0029] pri-miR396-x(5'to 3'): gtgcaagtcctgccatgcttTTCCACAGCTTTCTT GAACTTccatatctattgttcttaattttgtttctagaaatagatcaactgtggaagctcaagaaagctgtgggaagacatggcagttcaggacttc.
[0030] The method for constructing an expression vector using the miR396-x precursor pri-miR396-x includes the following steps:
[0031] 1. Vector linearization: The pCAMBIA1302 vector was linearized by digestion with NcoI and SpeI restriction endonucleases;
[0032] 2. Fragment acquisition: Design of homologous recombination primers;
[0033] Upstream primer: CACGGGGGACTCTTGACCATGGGTGCAAGTCCTGCCATGCTTTTCCACAGCTTTCTTGAA;
[0034] Downstream primer: TGTTCTTAATTTTGTTTTCTAGAAATAGATCAACTGTGGAAGCTCAAGAAAGCTGTGGGA;
[0035] Insert fragments with homologous arms were obtained by PCR amplification;
[0036] 3. Recombination reaction: The linearized vector and the insert fragment were mixed in a certain proportion using the Vazyme Clonexpress kit, and the recombination reaction was carried out under the catalysis of recombinase.
[0037] Transformation into competent cells: The recombinant vector is transformed into Escherichia coli DH5α for further screening and culture;
[0038] 4. Screening and verification: Successful recombinant clones were screened from transformed cells using kanamycin resistance markers, and the correctness of the recombinant fragments was verified by PCR, restriction enzyme digestion, and sequencing.
[0039] Infected and control areas were collected at 12 h, 1 d, 2 d, and 3 d post-infection. CsMET1 expression levels were analyzed using qPCR.
[0040] qPCR upstream primer sequence: TCCCTCCTCCTCTGGCATTT;
[0041] qPCR downstream primer sequence: CAACTATCTACCGCTTTT.
[0042] like Figure 3 As shown, the expression level of CsMET1 was similar to that of the control at 12 h post-infection, and was significantly downregulated from 1 to 3 days, proving that miR396-x has a regulatory effect on CsMET1.
[0043] The methylation rate changes of green buds and purple buds in the purple bud tea variety "Hongfei" were detected by high-throughput bisulfite-treated DNA sequencing technology. The methylation rate changes of CsSOT gene and CsF3'H1 gene were analyzed, and the results are shown in Table 1.
[0044] Table 1. Data on methylation rate changes of CsSOT and CsF3'H1 genes in purple bud tea.
[0045]
[0046] Note: In Table 1 above, " / " indicates no significant change.
[0047] As shown in Table 1 above, the methylation rate of the CHH methylation sequence type in the upstream sequence of the CsSOT gene decreased by 32.52%. Although the methylation rate of the CHG type increased, the methylation rate of the upstream sequence fragment of the CsSOT gene still showed a downward trend. At the same time, the methylation rates of the C, CHG, and CHH methylation sequences in the upstream sequence of the CsF3'H1 gene all decreased significantly. In summary, the expression of miR396-x downregulates the expression of CsMET1 in the Hongfei purple bud tea variety, thereby downregulating the methylation rate of the CsSOT gene and / or the CsF3'H1 gene in purple bud tea, and thus increasing the anthocyanin content in purple bud tea.
[0048] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.
Claims
1. The application of miR396-x or its precursor in increasing the anthocyanin content of purple bud tea, wherein the nucleotide sequence of miR396-x is shown in SEQ ID No. 1, the nucleotide sequence of the precursor pri-miR396-x is shown in SEQ ID No. 2, and the purple bud tea variety is Hongfei.
2. The application of a product that can increase the expression level of miR396-x in purple bud tea leaves in increasing the anthocyanin content of purple bud tea, wherein the product that can increase the expression level of miR396-x in purple bud tea leaves is an expression vector containing the nucleotide sequence of miR396-x or its precursor, wherein the nucleotide sequence of miR396-x is shown in SEQ ID No. 1, and the nucleotide sequence of the precursor of miR396-x, pri-miR396-x, is shown in SEQ ID No. 2, and the purple bud tea variety is Hongfei.
3. The application according to claim 2, characterized in that, The expression vector is a pCAMBIA1302 vector containing a nucleotide sequence of miR396-x or its precursor.
4. A method for increasing the anthocyanin content of purple bud tea using miR396-x, characterized in that, Includes the following steps: An expression vector was constructed using the precursor of miR396-x, pri-miR396-x, and transformed into Agrobacterium tumefaciens to infect purple tea leaves. The purple bud tea variety is Hongfei, the nucleotide sequence of miR396-x is shown in SEQ ID No. 1, and the nucleotide sequence of the precursor of miR396-x, pri-miR396-x, is shown in SEQ ID No.
2.
5. The method according to claim 4, characterized in that, The infection time is 1 to 3 days.
Citation Information
Patent Citations
miRNAs that regulate seed shape, insect resistance, and salt tolerance in plants and their applications
CN106676106B