A Bupleurum cytochrome P450 oxidase gene and its application

Abstract

The present invention provides a cytochrome P450 oxidase gene and application of Bupleurum chinense, which is CYP716A41. The enzyme has been confirmed by catalytic experiments to have the function of catalyzing the biosynthesis intermediate of saikosaponin β-amyrin and producing erythrodiol and oleanolic acid in its C-28 multi-step oxidation. The present invention has achieved the heterologous production of erythrodiol, an intermediate in the synthesis of saikosaponin, by using the enzyme, and erythrodiol is an important synthetic intermediate of various C-28 hydroxylated oleanane-type saikosaponins and other C-28 hydroxylated site triterpenoids. The present invention further promotes the analysis of the biosynthetic pathway of saikosaponins and synthetic biology research, and has important research value for the synthesis and regulation of oleanane-type pentacyclic triterpenoids such as saikosaponins and the breeding of Bupleurum plants.

Description

Technical Field

[0001] The present invention relates to the technical field of biological genetic engineering, and in particular to a bupleurum cytochrome P450 oxidase gene and application thereof. Background Art

[0002] Saikosaponin, a triterpenoid compound, is the main active ingredient of the Bupleurum plant (Bupleurum L.) of the Apiaceae family. Saikosaponin a and Saikosaponin d are representative components. Saikosaponin is a pentacyclic triterpenoid compound. Studies have shown that saikosaponin has significant pharmacological effects such as antidepressant, anti-inflammatory, liver protection, anticancer, and immunomodulatory effects (Jiang N et al., Global traditional Chinese medicine, 2018, 11(5):796-800). It is the main active ingredient of the traditional Chinese medicine Bupleurum. The Chinese Pharmacopoeia stipulates that the total content of saikosaponin a and saikosaponin d in Bupleurum must not be less than 0.3%. Each bag of Bupleurum Drop Pills contains no less than 0.525 mg of Bupleurum in terms of saikosaponin a (C42H68O13). With the in-depth study of saikosaponin, saikosaponin will face a large demand. As a secondary metabolite, saikosaponins are present in relatively low concentrations in the Bupleurum chinense plant. Currently, the primary method for obtaining saikosaponins is extraction and isolation from the medicinal plant. Bupleurum chinense has a long growth cycle, and large-scale extraction and isolation are not environmentally friendly. By elucidating the biosynthetic pathways of saikosaponins and employing novel synthetic biology approaches for heterologous synthesis, it is hoped that a variety of saikosaponins can be obtained in large quantities and in an environmentally friendly manner.

[0003] At present, the genes of the upstream synthesis pathway of triterpenoid compounds in Bupleurum have been cloned and characterized, including squalene synthase BfSS1 (Kim YS et al., Planta, 2011, 233(2):343-55.). The key gene BcBAS1 for the synthesis of β-amyrin, the key parent nucleus of Bupleurum chinense, has been identified in tobacco (Mao Yanping et al., Identification and functional verification of β-amyrin synthase gene family members in Bupleurum chinense, Chinese Herbal Medicine, 2023, 54(11):3647-3654), but there are no relevant reports on the analysis of the downstream synthesis pathway of Bupleurum chinense and synthetic biology research. Among the 165 Bupleurum chinense saponins, 152 are oleanane-type Bupleurum chinense saponins produced from β-amyrin. Among the 151 oleanane-type Bupleurum chinense saponins, 101 are hydroxylated at the C-28 position ( Figure 1 This is the saikosaponin biosynthesis pathway deduced by the present invention), so further exploring the C-28 hydroxylase in saikosaponin biosynthesis and exploring its significance for the analysis of the saikosaponin biosynthesis pathway and its biological synthesis methods. Summary of the Invention

[0004] In order to further promote the analysis of the biosynthetic pathway of saikosaponins and synthetic biology research, the present invention is committed to exploring the key factors that catalyze the saikosaponin biosynthesis intermediate β-amyrin and further oxidize it in multiple steps at its C-28 position to produce erythrodiol and oleanolic acid, and then provide a bupleurum cytochrome P450 oxidase gene and application. The bupleurum cytochrome P450 oxidase gene is CYP716A41, which has important research value for the synthesis and regulation of oleanane-type pentacyclic triterpenoid compounds such as saikosaponins.

[0005] In order to achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0006] In a first aspect, the present invention provides a Bupleurum cytochrome P450 oxidase gene, wherein the Bupleurum cytochrome P450 oxidase gene is from Chuanchai No. 2, and the CDS region nucleotides and CDS region nucleotide reverse complementary sequences of the Bupleurum cytochrome P450 oxidase gene are shown as SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0007] In a second aspect, the present invention provides a Bupleurum cytochrome P450 oxidase gene, the Bupleurum cytochrome P450 oxidase gene is from Chuanbei Chai No. 1, and the CDS region nucleotides and CDS region nucleotide reverse complementary sequences of the Bupleurum cytochrome P450 oxidase gene are shown as SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0008] In a third aspect, the present invention provides amino acids encoding the Bupleurum cytochrome P450 oxidase gene described in the first aspect, wherein the amino acids have a sequence shown in SEQ ID NO: 1.

[0009] In a fourth aspect, the present invention provides amino acids encoding the Bupleurum cytochrome P450 oxidase gene of the second aspect, wherein the amino acids have the sequence shown in SEQ ID NO: 4. In a fifth aspect, the present invention provides an expression vector comprising the Bupleurum cytochrome P450 oxidase gene of the first or second aspect.

[0010] In a sixth aspect, the present invention provides a recombinant host cell comprising the Bupleurum cytochrome P450 oxidase gene described in the first or second aspect, or the expression vector described in the fifth aspect.

[0011] Preferably, the cell is selected from the group consisting of bacteria, fungal cells, insect cells, mammalian cells or plant cells.

[0012] In the seventh aspect, the present invention provides the use of the Bupleurum cytochrome P450 oxidase gene described in the first or second aspect, the amino acid described in the third or fourth aspect, the expression vector described in the fifth aspect, or the recombinant host cell described in the sixth aspect in catalyzing the hydroxylation reaction at the C-28 position of β-amyrin and / or catalyzing the carboxylation reaction at the C-28 position of erythrodiol.

[0013] In an eighth aspect, the present invention provides the use of the Bupleurum cytochrome P450 oxidase gene described in the first or second aspect, or the amino acid described in the third or fourth aspect, or the expression vector described in the fifth aspect, or the recombinant host cell described in the sixth aspect in synthesizing erythrodiol and / or oleanolic acid and / or oleanane-type Bupleurum saponins.

[0014] In the ninth aspect, the present invention provides the use of the Bupleurum cytochrome P450 oxidase gene described in the first or second aspect, the amino acid described in the third or fourth aspect, the expression vector described in the fifth aspect, or the recombinant host cell described in the sixth aspect in Bupleurum plant breeding.

[0015] Compared with the prior art, the present invention has the following beneficial effects: the present invention provides a Bupleurum cytochrome P450 oxidase gene CYP716A41, which has been confirmed by catalytic experiments to have the function of catalyzing the biosynthesis intermediate β-amyrin of saikosaponins and producing erythrodiol and oleanolic acid at its C-28 position through multi-step oxidation. The present invention uses this enzyme to achieve heterologous production of erythrodiol, a saikosaponin synthesis intermediate, and erythrodiol is an important synthetic intermediate for various C-28 hydroxylated oleanane-type saikosaponins and other C-28 hydroxylated triterpenoids. The present invention further promotes the analysis of the saikosaponin biosynthesis pathway and synthetic biology research, and has important research value for the synthesis and regulation of oleanane-type pentacyclic triterpenoids such as saikosaponins, as well as for Bupleurum plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0017] Figure 1 The figure is a derivation diagram of the saikosaponin biosynthesis pathway of the present invention.

[0018] Figure 2The contents of 10 major saikosaponins in the roots and leaves of Sichuan Chai No. 2 and Sichuan Chai No. 1 at mature stage in Example 1 of the present invention are shown in Figure a: saponin content in Bupleurum root; Figure b: saponin content in Bupleurum leaf; CC2: Sichuan Chai No. 2; CBC1: Sichuan Chai No. 1; SSA: saikosaponin a; SSB2: saikosaponin b2; SSB3: saikosaponin b3; SSB4: saikosaponin b4; SSC: saikosaponin c; SSD: saikosaponin d; SSE: saikosaponin e; SSF: saikosaponin f; SSK: saikosaponin k; SSAC: 6"-O-acetylsaponin a.

[0019] Figure 3 This is the analysis of the differentially expressed CYP450 gene family in Bupleurum chinense leaves in Example 1 of the present invention.

[0020] Figure 4 This is an agarose gel electrophoresis diagram of the CYP716A41 gene clone in Example 2 of the present invention (L1: Trans2K DNA Marker; L2: CYP716A41 gene band).

[0021] Figure 5 This is the plasmid map of pEAQ-CYP716A41 in Example 3 of the present invention.

[0022] Figure 6 This is the functional characterization of CYP716A41 in tobacco in Example 3 of the present invention, wherein Figure A is the TIC total ion current diagram of the sample and standard detected by GC-MS, and Figure B is a comparison diagram of the mass spectrum corresponding to the compound (black peak) and the mass spectrum of the standard (red peak); in Figure A, 1, 2, and 3 are β-amyrin, erythrodiol, and oleanolic acid, respectively.

[0023] Figure 7 This is the characterization of the in vivo enzyme activity of CYP716A41 in tobacco in Example 4 of the present invention. DETAILED DESCRIPTION

[0024] The present invention is further described below with reference to specific examples. These examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Unless otherwise specified in the following examples, conventional experimental methods or methods recommended by the manufacturer are generally used. In addition, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention. The preferred embodiments and materials described herein are merely exemplary for demonstrating gene function in the present invention.

[0025] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, which are intended to explain the present invention rather than to limit it.

[0026] The radix bupleuri used in the following examples was sourced from Longshan Farm of Southwest University of Science and Technology and is available to the public from the Biomedical Innovation and Utilization Laboratory of Southwest University of Science and Technology.

[0027] RNAprep Pure Plant kit used in the embodiments of the present invention, One-Step gDNARemoval and cDNA Synthesis SuperMix, SalI and NotI restriction enzymes, Seamless Cloning and Assembly Kit, Trans2K DNA Marker, Escherichia coli competent cells, universal DNA purification and recovery kit, saikosaponin standard, 2×Rapid Taq Master Mix, GV3101 Agrobacterium competent cells, β-amyrin, erythrodiol, oleanolic acid, coprotriol, and trimethylsilyl imidazole / pyridine reagent are all commercially available products.

[0028] Example 1

[0029] This example conducts gene mining of Bupleurum CYP716A41, specifically as follows:

[0030] Step 1. Harvest the root and leaf tissues of mature Chuanchai No. 2 (Chuan Renyao 2023001) and Chuanbei Chai No. 1, quickly freeze them in liquid nitrogen and store them in an ultra-low temperature freezer at -80°C. Three biological replicates were set for each sample. Weigh 0.25g of sample into a 2mL centrifuge tube, grind it with liquid nitrogen, and then vortex with 1.25mL of pre-frozen 80% methanol containing 0.1% formic acid (Thermo, USA) for 10 minutes. Incubate the sample on ice for 5 minutes and then centrifuge it in a refrigerated centrifuge (Thermo, USA) at 4°C for 10 minutes at 8000 rpm. Dilute with mass spectrometry grade water to a methanol concentration of 53% in the sample. Subsequently, 500μL of the sample solution was transferred to a fresh Eppendorf tube and centrifuged for 10 minutes at 8000 rpm and 4°C. The external standard method was used to quantify saikosaponin a (SSA), saikosaponin b2 (SSB2), saikosaponin b3 (SSB3), saikosaponin b4 (SSB4), saikosaponin c (SSC), saikosaponin d (SSD), saikosaponin e (SSE), saikosaponin f (SSF), saikosaponin k (SSK), and 6"-O-acetylsaponin a (SSAC) in the samples. The saikosaponin standard reference substance was prepared with methanol to a stock solution with a concentration of 2.0 mg / mL, and a standard curve was prepared by serial dilution.

[0031] Samples were treated with ExionLC RM AD (SCIEX, USA) and Analyses were performed using a 6500+ mass spectrometer (SCIEX, USA) in negative ion mode (ESI-). The chromatographic column was an ACQUITY UPLC BEH C18 (150 mm × 3.0 mm, 1.7 μm, Waters). The injection volume was 0.5 μL, and the liquid phase gradient elution parameters were as shown in Table 1:

[0032] Table 1 Gradient elution parameters

[0033]

[0034] Mass data acquisition was performed using the following parameters: ion spray voltage -4500 V, curtain gas pressure of 30 psi, ion source gas 1 and ion source gas 2 pressures of 55 psi each, and a turbo spray temperature of 600°C. HPLC-MS / MS data files were integrated and peak corrected using SCIEX OS version 1.4. Key parameters were set as follows: signal-to-noise ratio, 10; minimum peak height, 500; and Gaussian smoothing width, 3. Peak areas represent the relative abundance of the corresponding substances.

[0035] In step 3, total RNA was extracted from the four Bupleurum chinense tissue samples (Chuanchai No. 2 and Chuanbeichai No. 1) stored at -80°C using an RNAextraction kit (TIANGEN, China) according to the kit instructions. The extracted RNA was quantified and quality-tested using Nanodrop and Qubit (Agilent, USA), and RNA sequencing was performed by an external company (Novogene, China). The transcriptome sequencing results were combined with the saponin metabolism assay results to identify candidate CYP450 genes.

[0036] In step 4, the selected CYP450 candidate genes were identified as gene families using the Arabidopsis thaliana CYP450s family classification data (https: / / phytozome-next.jgi.doe.gov / ) as a reference. IQ-TREE (2.1.4beta) software was used for maximum likelihood cluster analysis, using the GTRGAMMA model and a bootstrap setting of 1000. The constructed phylogenetic tree was visualized on the ITOL website (https: / / itol.embl.de / ).

[0037] The results are as follows Figure 2As shown in Figure 2, the contents of 8 major saikosaponins in the leaves of Chuanchai No. 2 were significantly higher than those in Chuanbei Chai No. 1 (Figure b), and the contents of 6 major saikosaponins in the roots of Chuanchai No. 2 were significantly higher than those in Chuanbei Chai No. 1 (Figure a). Based on this, 53 CYP450 genes with higher expression levels in the leaves of Chuanchai No. 2 than in Chuanbei Chai No. 1 and expressed in the roots of both Bupleurum chinense were screened out from the transcriptome sequencing results. The identification results of these CYP450s gene families are shown in Figure 2. Figure 3 As shown. These genes belong to 6 CYP450 subfamilies. Among them, 11 genes in the CYP85 family can be further divided into 5 subfamilies. BC_032098 belongs to the CYP716 subfamily in the CYP85 family. Literature shows that members of the CYP716 family are the main contributors to the diversity of triterpenoid biosynthesis in dicotyledons (Miettinen, K et al., The ancient CYP716 family is a major contributor to the diversification of eudicot triterpenoid biosynthesis. Nat Communication 8, 14153 (2017)). Therefore, this gene was selected for subsequent research. The gene was submitted to the International P450 Nomenclature Committee (Nelson's nomenclature) (http: / / drnelson.uthsc.edu / cytochromeP450.html) for naming, and BC_032098 was named CYP716A41.

[0038] Example 2

[0039] This example clones the CYP716A41 gene of Chuanchai No. 2 and Chuanbeichai No. 1, as follows:

[0040] Step 1: Use RNAprep Pure Plant kit (Quanshijin) to extract total RNA from Bupleurum chinense No. 1 and Bupleurum chinense No. 2 plants according to the kit instructions.

[0041] Step 2, then use One-Step gDNA Removal and cDNA Synthesis SuperMix (Full Gold) Reverse Transcription Kit was used to reverse transcribe total RNA to obtain cDNA according to the kit instructions. The reverse transcription system is shown in Table 2 below:

[0042] Table 2 Reverse transcription system

[0043]

[0044]

[0045] Take 1 μL of the obtained cDNA solution and use 1% agarose gel to detect the reverse transcription effect, and store the remaining solution in a -20°C refrigerator.

[0046] Step 3, finally, full-length gene cloning and product purification:

[0047] According to the full-length cDNA sequence of the CYP450 gene in the transcriptome, specific primers for full-length cloning (F: GAGCTTGCTAGATGATGATGTA (SEQ ID NO: 7), R: TCAATCTATGGTTTGTGAGGAA (SEQ ID NO: 8)) were designed and used. FastPfu PCR SuperMix (-dye) (all-gold) was used for PCR reaction. The reaction system was as follows:

[0048] PCR reaction conditions: 95°C for 2 minutes; 35 cycles of 95°C for 20 seconds, 51°C for 20 seconds, and 72°C for 30 seconds; 72°C for 5 minutes; hold at 4°C. After the reaction is complete, 5 μL of the reaction product is taken, added with 1 μL of 6× Loading Buffer, and subjected to 1.0% agarose gel electrophoresis (160V, approximately 20 minutes). After the target band is correctly located, 0.8% agarose gel electrophoresis (160V, approximately 20 minutes) is used to fully separate the DNA and excise the target band. The agarose gel electrophoresis results for the CYP716A41 gene clone are shown in Figure 1. Figure 4 shown.

[0049] The target gene was recovered and purified according to the operating manual of the universal DNA purification and recovery kit (Tiangen). The target gene was CYP716A41. Among them, the amino acid sequence of the CDS region, the nucleic acid sequence of the CDS region, and the reverse complementary sequence of the nucleic acid sequence of the CDS region of the CYP716A41 gene of Chuanchai No. 2 are shown in SEQ ID NO: 1 to SEQ ID NO: 3, respectively, and the amino acid sequence of the CDS region, the nucleic acid sequence of the CDS region, and the reverse complementary sequence of the nucleic acid sequence of the CDS region of the CYP716A41 gene of Chuanbeichai No. 1 are shown in SEQ ID NO: 4 to SEQ ID NO: 6, respectively (Table 3).

[0050] Table 3. CDS amino acid, nucleic acid and reverse complementary sequences of CYP716A41 of Chuanchai No. 2 and Chuanbeichai No. 1

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057] Example 3

[0058] The CYP716A41 gene was functionally identified as follows:

[0059] (1) Construction of pEAQ-CYP716A41 vector

[0060] Based on the CYP716A41 sequence, homology arm primers were designed (Table 4).

[0061] Table 4 Homology arm primer sequences

[0062]

[0063] Using the CYP716A41 gene fragment collected in Example 2 as a template, reagents were added to a PCR tube according to the reaction system in Table 5 below:

[0064] Table 5 Reaction system

[0065]

[0066] PCR reaction conditions: 98°C for 3 min; 34 cycles of 98°C for 10 s, 58°C for 5 s, and 72°C for 30 s; 72°C for 1 min; hold at 4°C. After the reaction, 5 μL of the reaction product was added to 1 μL of 6× Loading Buffer and subjected to 1.0% agarose gel electrophoresis (160 V, approximately 20 min). After confirming the correct position of the target band, DNA was purified using 0.8% agarose gel electrophoresis (160 V, approximately 20 min) and a gel extraction kit.

[0067] Linear vector preparation: Use SalI and NotI enzymes (Full Gold) to double-digest the plant binary transient expression vector pEAQ-HT-DEST1 to obtain a linear vector. Add the following reagents to the PCR tube according to the reaction system in Table 6:

[0068] Table 6 Reaction system

[0069]

[0070] The reaction conditions were 37°C for 15 minutes and 65°C for 20 minutes. After the reaction, 5 μL of the reaction product was added with 1 μL of 6× Loading Buffer and subjected to 1.0% agarose gel electrophoresis (160V, 20 minutes). After the target band was correctly positioned, DNA was purified using 0.8% agarose gel electrophoresis (160V, 20 minutes) and a gel extraction kit.

[0071] The target fragment CYP716A41 and the linear vector were connected into a ring, and the seamless splicing method (homologous recombination principle) was used. -Basic Seamless Cloning and Assembly Kit (Quanshijin) was used to construct the eukaryotic expression vector pEAQ-CYP716A41. The concentrations of the target gene fragment and the vector fragment were detected by a nucleic acid quantifier, and the target fragment and the vector fragment were prepared into a reaction system at a molar ratio of 2:1. After adding an equal volume of 2×Basic Assembly Mix, the mixture was thoroughly mixed and reacted at 50°C for 15 minutes. The reaction solution was mixed with 50 μL TransTI Escherichia coli cloning competent cells, allowed to stand on ice for 30 minutes, heat-shocked in a 42°C water bath for 30 seconds, allowed to stand on ice for 2 minutes, and 500 μL LB liquid culture medium without antibiotics was added. The mixture was incubated at 37°C and 200 rpm for 1 hour. After centrifugation at 4600g for 1 minute, 100 μL of the supernatant was retained to resuspend the bacteria and evenly spread on a plate containing 50 mg·L -1 The cells were cultured in the dark at 37°C for 16 hours on LB solid medium containing kanamycin. After colony screening, the bacterial culture was cultured at 37°C, 200 rpm, and in the dark for about 3-4 hours as a template. Positive clones were verified using primers PEAQ-F (CGAACTTGGAGAAAGATTGT, SEQ ID NO: 11) and PEAQ-R (CGCTCACCAAACATAGAAA, SEQ ID NO: 12). The bacterial culture containing the target band was sequenced to obtain the pEAQ-CYP716A41 eukaryotic expression vector. The plasmid map is shown in Figure 1. Figure 5 shown.

[0072] The same method was used to construct tHMGR and BcBAS1 into the SalI and XhoI sites of the pEAQ-CYP716A41 eukaryotic expression vector pEAQ, resulting in the pEAQ-tHMGR and pEAQ-BcBAS1 eukaryotic expression vectors. tHMGR is a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase gene (HMG-CoA) from Paris polyphylla (Yin X et al., Metabolic Engineering, 2023; 76: 232–246). BcBAS1 is a β-amyrin synthase gene from Bupleurum chinense (Mao Yanping et al., Identification and functional validation of β-amyrin synthase gene family members from Bupleurum chinense, Chinese Herbal Medicine, 2023, 54(11): 3647-3654).

[0073] (2) Transformation of Agrobacterium tumefaciens

[0074] Slightly thaw the GV3101 Agrobacterium competent cells stored at -80°C in the palm of your hand. When they are half-thawed, quickly place them in ice water.

[0075] Mix 100 μL of competent cells with 1 μg of plasmid DNA and mix thoroughly by tapping the bottom of the tube. Next, place the mixture in an ice bath for 5 minutes, transfer it to liquid nitrogen for 5 minutes, incubate it in a 37°C water bath for 5 minutes, and finally return it to the ice bath for 5 minutes.

[0076] 500 μL of antibiotic-free LB liquid medium was added to the centrifuge tube, and then cultured in a shaking incubator at 28° C. for 2 hours.

[0077] Collect the bacteria by centrifugation at 6000 rpm for one minute, take about 100 μL of the supernatant, gently pipette to resuspend the bacteria, spread it on an LB plate containing the corresponding antibiotics, and place it upside down in a 28°C incubator for 2-3 days.

[0078] Randomly pick a single colony, place it in 1 mL of LB liquid medium, and culture it at 30°C with shaking at 200 rpm for 36-48 h;

[0079] Positive strain test: Take 1 μL of bacterial solution and perform positive clone PCR reaction to detect whether the plasmid has been successfully transformed into GV3101 Agrobacterium. Add the following reaction system to the PCR tube according to Table 7:

[0080] Table 7 Reaction system

[0081] name Addition volume (μL) 2× Rapid Taq Master Mix 10 bacterial liquid 1 PEAQ-F 1 PEAQ-R 1 ddH2O 7

[0082] The reaction procedure was 95°C for 3 min, followed by 35 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 0.5 min, followed by 72°C for 5 min, and then a 4°C stop. After the reaction, 8 μL of the reaction product was subjected to 1.0% agarose gel electrophoresis (180 V, approximately 10 min) using Trans2K DNA Marker (Full Gold) to detect the presence of the target band.

[0083] (3) Tobacco transient expression

[0084] Agrobacterium was added to 50 mL of LB liquid culture medium containing 50 μg / mL kanamycin, 50 μg / mL gentamicin, and 25 μg / mL rifampicin, and then cultured on a shaker at 200 rpm for 36 hours.

[0085] 50 mL centrifuge tubes containing Agrobacterium cells transformed with pEAQ-tHMGR, pEAQ-BcBAS1 and pEAQ-CYP716A41 vectors were centrifuged at 5000 rpm for 10 minutes in a 50 mL refrigerated centrifuge.

[0086] After centrifugation, discard the supernatant, add 10 mL of tobacco infecting solution, and vortex to resuspend. Place the centrifuge tube in the centrifuge again and centrifuge under the above conditions.

[0087] After centrifugation, the supernatant was discarded and 10 mL of tobacco infection solution was added again and vortexed to resuspend.

[0088] The OD value of the shaken bacterial solution was measured at 600 nm on a UV spectrophotometer.

[0089] Four controls were set up: tHMGR (containing only Agrobacterium transformed with the pEAQ-tHMGR vector), tHMGR+BcBAS1 (containing Agrobacterium transformed with both the pEAQ-tHMGR vector and the pEAQ-BcBAS1 vector), tHMGR+CYP716A41 (containing Agrobacterium transformed with both the pEAQ-tHMGR vector and the pEAQ-CYP716A41 vector), and tHMGR+BcBAS1+CYP716A41 (containing Agrobacterium transformed with the pEAQ-tHMGR vector, the pEAQ-BcBAS1 vector, and the pEAQ-CYP716A41 vector). When infecting with Agrobacterium, the OD value of each bacterial solution was required to be 0.2. Therefore, when combining different bacterial solutions, the OD value of each Agrobacterium in the solution was maintained at 0.2. Tobacco inoculation solution was used for dilution. Use a syringe needle to pierce the underside of a tobacco leaf and inject the bacterial solution into the leaf. Ensure the entire leaf is completely covered. Each plant serves as a biological replicate, meaning each control group corresponds to three tobacco plants. Harvest the leaves after 6 days and prepare tobacco samples for GC-MS analysis.

[0090] (4) Tobacco sample preparation

[0091] 10 mg of freeze-dried tobacco leaf sample was weighed and then saponified in 1 mL of saponification reagent (10% [w / v] KOH, 90% [v / v] ethanol) containing 10 μg / mL coprotriol (Sigma-Aldrich) (internal standard) and heated at 75 ° C for 1 hour. The lid was then opened and the sample was heated for another hour to evaporate the ethanol. 0.5 mL of ethyl acetate was added to the resulting product and vortexed. 0.5 mL of water was then added and vortexed again. The solution was then centrifuged to facilitate the separation of ethyl acetate and water. 50 μL of ethyl acetate solution was dried with N2 and derivatized at 70 ° C for 30 minutes using 50 μL of trimethylsilyl imidazole / pyridine reagent (Sigma-Aldrich).

[0092] (5) GC-MS detection of metabolites

[0093] The reaction solution was analyzed using a GCMS-QP2020 instrument (Shimadzu) equipped with a SH-Rxi-5Sil MS capillary column (30 m × 0.25 mm × 0.25 μm, Shimadzu), with the electron energy set to 70 eV. The reactants obtained in step (4) were placed in an incubation chamber at an initial temperature of 180°C for 1 minute. The temperature was then increased to 20°C min -1The temperature was raised from 180°C to 280°C at a rate of 5°C min-1 and held for 5 minutes. Subsequently, the temperature was raised from 280°C to 300°C at a rate of 5°C min-1. Metabolite quantification was performed using an external standard method after correction by comparing the peak areas of the metabolites with those of the internal standard fecal sterol using peak area measurement.

[0094] The results are as follows Figure 6 As shown, compared to the control group expressing only the tHMGR gene, no new product was detected in the experimental group co-expressing CC2-CYP716A41. Co-expression of the tHMGR and BcBAS1 genes produced a new compound 1 at 14.6 minutes. The peak time of compound 1 coincided with that of a β-amyrin standard. Comparison of the mass spectrometry results between the two identified compound 1 as β-amyrin.

[0095] Under the conditions of tHMGR+BcBAS1 gene expression, co-expression of the CC2-CYP716A41 gene produced two new compounds, 2 and 3. Compound 2 exhibited the same peak elution time as a standard sample of erythrodiol. Comparison of the mass spectrometry results between the two identified compound 2 as erythrodiol. Compound 3 exhibited the same peak elution time as a standard sample of oleanolic acid. Comparison of the mass spectrometry results between the two identified compound 3 as oleanolic acid. The structural difference between erythrodiol and oleanolic acid lies at the C28 position: erythrodiol has a hydroxyl group, while oleanolic acid has a carboxyl group, which can be easily oxidized to a carboxyl group. Therefore, CYP716A41 can catalyze the production of erythrodiol from β-amyrin and further catalyze the oxidation of erythrodiol to oleanolic acid.

[0096] Example 4

[0097] The catalytic efficiency of CYP716A41 obtained in Example 2 was identified as follows:

[0098] CYP716A41 of Chuanbeichai No. 1 and Chuanbeichai No. 2 was cloned and constructed into the pEAQ vector according to the methods of Examples 2 and 3. At the same time, the gene CYP716A75 with similar modification function reported in the literature (Moses T, Pollier J, Faizal A, Apers S, Pieters L, Thevelein JM, Geelen D, Goossens A. Unraveling the triterpenoid saponin biosynthesis of the African shrub Maesa lanceolata. Mol Plant. 2015 Jan; 8(1): 122-35.) was also synthesized and constructed into the pEAQ vector according to the method of Example 3. Subsequently, according to the method of Example 3, CYP716A41 and CYP716A75 of Chuanbei Bupleurum No. 1 and Chuanbei Bupleurum No. 2 were respectively transformed into GV3101 Agrobacterium, and then co-infected with Agrobacterium containing tHMGR and BcBAS1 into tobacco for heterologous expression. GC-MS samples were prepared for detection to compare the catalytic efficiency of CYP716A41 and CYP716A75 of the two genotypes of Bupleurum in producing erythrodiol.

[0099] The results showed that ( Figure 7 ), CYP716A41 of Chuanchai No. 2 produced significantly more erythrodiol in tobacco leaves than CYP716A41 and CYP716A75 of Chuanbeichai No. 1, reaching 9.45±0.15 mg of erythrodiol per gram of tobacco leaf (dry weight).

[0100] In summary, the present invention confirms that CYP716A41 is involved in the synthesis of erythrodiol, which, through subsequent post-modification by CYP450 enzymes and UGT enzymes, can produce various C-28 hydroxylated oleanane-type saikosaponins and other C-28 hydroxylated triterpenoids. Therefore, the CYP716A41 of the present invention further promotes the analysis of the saikosaponin biosynthetic pathway and synthetic biology research, and has important research value for the synthesis and regulation of oleanane-type pentacyclic triterpenoids such as saikosaponins. In addition, the Bupleurum cytochrome P450 oxidase gene CYP716A41 and recombinant host cells containing this gene are expected to be applied to Bupleurum plant breeding.

[0101] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. A use of a Bupleurum cytochrome P450 oxidase gene in catalyzing the C-28 hydroxylation reaction of β-amyrin, wherein the Bupleurum cytochrome P450 oxidase gene is from Chuanchai No. 2, and the CDS region nucleotide sequence and the CDS region nucleotide reverse complement sequence of the Bupleurum cytochrome P450 oxidase gene are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

2. A use of a Bupleurum cytochrome P450 oxidase gene in catalyzing the C-28 hydroxylation reaction of β-amyrin, wherein the Bupleurum cytochrome P450 oxidase gene is from Chuanbei Chai No. 1, and the CDS region nucleotide sequence and the CDS region nucleotide reverse complement sequence of the Bupleurum cytochrome P450 oxidase gene are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

3. Use of the protein encoded by the Bupleurum cytochrome P450 oxidase gene of claim 1 in catalyzing the hydroxylation reaction of β-amyrin at the C-28 position, wherein the protein has the amino acid sequence shown in SEQ ID NO:

1.

4. Use of the protein encoded by the Bupleurum cytochrome P450 oxidase gene according to claim 2 in catalyzing the hydroxylation reaction of β-amyrin at the C-28 position, wherein the protein has the amino acid sequence shown in SEQ ID NO:

4.

5. Use of an expression vector containing the Bupleurum cytochrome P450 oxidase gene according to claim 1 or 2 in catalyzing the hydroxylation reaction of β-amyrin at the C-28 position.

6. Use of a recombinant host cell comprising the Bupleurum cytochrome P450 oxidase gene according to claim 1 or 2, or the expression vector according to claim 5, in catalyzing the C-28 hydroxylation reaction of β-amyrin, wherein the cell is a bacterial cell or a fungal cell.

7. Use of the Bupleurum cytochrome P450 oxidase gene according to claim 1 or 2, or the protein according to claim 3 or 4, or the expression vector according to claim 5, or the recombinant host cell according to claim 6 in the synthesis of erythrodiol.

Images