DNA probe, kit and method for distinguishing papaya anthracnose-resistant varieties

Abstract

The present invention relates to a DNA probe, a kit and a method for distinguishing papaya varieties with anthracnose resistance, and the nucleotide sequence of the DNA probe is shown in SEQ.ID.NO.1. Based on the alignment results of the chloroplast genome sequences of various papaya varieties, we found multiple differential sites, among which there is a differential site in the vicinity of 60 kb. Through this one site, we can distinguish papaya varieties with different anthracnose resistance, which is an ideal site for molecular markers. We intercepted a sequence of about 250 bp upstream and downstream of the differential site as a reference sequence, selected homologous sequences to design primers, and used the DNA of samples of various papaya varieties as templates for PCR amplification. A single bright band with the same expected size can be amplified in 7 templates, proving that the differential site fragment obtained by analyzing the chloroplast genome sequence exists and can be amplified and identified, and an oligonucleotide fluorescent probe is designed based on the site.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a DNA probe, a kit and a method for distinguishing papaya anthracnose-resistant varieties. Background Art

[0002] Papaya (Carica papaya L.) is a plant of the genus Carica of the family Caricaceae. It is native to tropical America and was introduced to China during the Ming and Qing Dynasties. It has been planted in many tropical and subtropical areas in southern my country. It is a widely used tropical herbaceous fruit tree. Its fruit has high nutritional value and is rich in protease. It can be eaten fresh as a fruit, and can also be used for industrial extraction and processing. It is widely used in many industries such as food and medicine.

[0003] Anthracnose is a common plant disease. The pathogen of papaya anthracnose is Colletotrichum sp., which can cause plant tissue necrosis after infection. Symptoms include dark brown sunken lesions, and the stems, leaves and fruits can all be affected. Papaya anthracnose is an important post-harvest disease of papaya, causing problems such as reduced papaya yield and fruit lesions, which is extremely harmful to the papaya industry. Therefore, the anthracnose resistance of papaya varieties is very important for the introduction, production and layout of papaya. Different varieties of papaya have different anthracnose resistance, which needs to be considered in the introduction and crop layout work. It is difficult to distinguish papaya germplasm based on traditional morphological characteristics, so molecular biological identification methods for different anthracnose-resistant varieties are very important.

[0004] Molecular identification technology is a technology that identifies molecular-level information based on differences in biological genomes. Compared with the subjectivity and complexity of traditional morphological feature identification, molecular identification technology can visualize and simplify the differences between species in the form of sequence data, so as to obtain more reliable identification results more efficiently.

[0005] Chloroplast genome (cpDNA) molecular markers are of great significance in the field of plant science, especially in phylogeny, evolutionary biology, species identification, population genetics, ecology and conservation biology. The chloroplast genome is usually a single circular molecule with a size ranging from 120-160 kb, containing a series of genes encoding photosynthesis, electron transfer and other biosynthetic pathways, which has high genetic stability, low recombination rate and maternal inheritance. These characteristics make the chloroplast genome an efficient and reliable molecular marker that can provide high-resolution information, especially suitable for analyzing distantly related plants and evaluating population structure, gene flow and historical dynamics. By comparing the chloroplast genomes of different species or populations, researchers can gain a deeper understanding of how plants adapt to various ecological environments and the evolutionary mechanisms behind them, thereby providing a scientific basis for biodiversity conservation and sustainable use.

[0006] This study sequenced, assembled, and analyzed the chloroplast genomes of multiple papaya varieties, and obtained the differential sites in the chloroplast genomes of multiple papaya varieties that differ in anthracnose resistance, in order to develop molecular marker probes to distinguish papaya varieties with different resistance to anthracnose. Summary of the invention

[0007] In order to solve the problems existing in the above-mentioned technology, the present invention provides a DNA probe for distinguishing papaya anthracnose-resistant varieties, and the nucleotide sequence of the DNA probe is shown in SEQ.ID.NO.1.

[0008] Wherein, the DNA probe is marked with a tracer marker.

[0009] Wherein, the tracer label is an isotope label or a non-isotope label.

[0010] Wherein, the non-isotope label is an enzyme or a colored group.

[0011] Among them, the papaya anthracnose-resistant varieties are Daqing, Hongfei and Tainong, and the papaya anthracnose-non-resistant varieties are Guangmi, Hongling, Guire and Qionghaihuang.

[0012] A method for distinguishing papaya anthracnose-resistant varieties comprises the following steps:

[0013] S1 extracts chloroplast genome DNA of a plant to be tested, wherein the plant to be tested is papaya, and the papaya variety is selected from Daqing, Hongfei, Tainong, Guangmi, Hongling, Guire and Qionghaihuang;

[0014] S2 uses the chloroplast genome of the plant as a template for PCR amplification and uses the aforementioned DNA probe to detect the presence of chloroplast-specific genes;

[0015] S3 If the chloroplast-specific gene does not exist, the plant is judged to be a papaya anthracnose-resistant variety, and the papaya anthracnose-resistant varieties are Daqing, Hongfei and Tainong.

[0016] A kit for distinguishing papaya anthracnose-resistant varieties, the kit comprising the aforementioned DNA probe.

[0017] According to the alignment results of the chloroplast genome sequences of various papaya varieties, the present invention has found multiple differential sites, among which there is a differential site in the vicinity of 60 kb. Through this one site, we can distinguish papaya varieties with different anthracnose resistance, which is an ideal site for molecular markers. We intercepted the sequence of about 250 bp upstream and downstream of the differential site as a reference sequence, selected homologous sequences to design primers, and used the DNA of samples of various papaya varieties as templates for PCR amplification. A single bright band with the expected size can be amplified in all 7 templates, proving that the differential site fragment obtained by the chloroplast genome sequence analysis exists and can be amplified and identified.

[0018] The PCR amplification products were sequenced by Sanger sequencing and the sequencing results were compared. The comparison results confirmed the existence of an 8 bp differential site at this site that can distinguish papaya varieties with different anthracnose resistance. Based on this site, an oligonucleotide fluorescent probe was designed, and molecular biological methods such as RPA (Recombinase Polymerase Amplification) can be used to detect papaya leaf tissue. Molecular identification can be achieved by the presence or absence of fluorescent signals, thereby efficiently distinguishing papaya varieties with different anthracnose resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0020] Figure 1 It is the 60 kb differential site in the chloroplast genome of various papaya varieties, among which the papaya varieties from top to bottom are Daqing, Guangmi, Hongling, Guire, Hongfei, Qionghaihuang, and Tainong;

[0021] Figure 2 These are electrophoresis bands of PCR amplification of chloroplast genome molecular markers of various papaya varieties. From the left, the electrophoresis bands are Marker, Hongfei, Tainong, Daqing, Guangmi, Hongling, Qionghaihuang, Guire, and blank control. The band size is about 250 bp.

[0022] Figure 3 These are the test results of nucleic acid test strips on 7 types of papaya DNA amplification products. DETAILED DESCRIPTION

[0023] The technical scheme in the embodiment of the present invention is described clearly and completely below in conjunction with the accompanying drawings in the embodiment of the present invention. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below.

[0024] 1. Classification of Anthracnose Resistance of Different Papaya Varieties

[0025] Table 1 Anthracnose resistance information of different papaya varieties

[0026]

[0027] 2. Materials and methods:

[0028] 2.1 Experimental instruments

[0029] High-speed refrigerated centrifuge: ThermoFisher, Micro 21R;

[0030] Constant temperature water bath: Jinghong, DK-S24;

[0031] Ultra-micro-spectrophotometer: ThermoFisher, NanoDrop2000;

[0032] PCR instrument: ThermoFisher, Applied Biosystems VeritiPro;

[0033] Gel electrophoresis instrument: Liuyi, DYY-8C;

[0034] Gel imaging system: VILBER, FUSION FX7.

[0035] 2.2 Experimental reagents

[0036] Plant genomic DNA extraction kit: Tiangen, DP305;

[0037] 2 × Phanta Max Master Mix (Dye Plus): Norvegicus, P525;

[0038] DNA Marker II molecular weight standard: Tiangen, MD102.

[0039] 2.3 Experimental methods

[0040] Acquisition of chloroplast genome: Sequence the whole chloroplast genome of the sample, clean the low-quality data, and assemble the clean reads to obtain relatively complete chloroplast genome data.

[0041] Sequence alignment: The papaya chloroplast genome sequences were aligned using the software MAFFT to obtain the differential sites between varieties.

[0042] PCR primer design: According to the alignment results of the chloroplast genomes of various papaya varieties, the chloroplast gene sequence difference sites that can distinguish different anthracnose-resistant papaya varieties were selected, and the difference sites and the sequences of about 250 bp upstream and downstream were extracted. Primers were designed using Primer-BLAST, and PCR primers were screened and obtained:

[0043] CPP4F= SEQ.ID.NO.2=CCTGTATGTTTGTCCTTTTC;

[0044] CPP4R= SEQ.ID.NO.3=GAAATGATTCTCTTTGTGAGAAC;

[0045] And synthesized by BGI (Beijing) Co., Ltd.

[0046] Sample grinding: Use liquid nitrogen to grind the sample tissue into a uniform powder.

[0047] DNA extraction: refer to the instruction manual to extract DNA from leaf tissues of various papaya varieties and test their concentrations.

[0048] PCR amplification verification: Configure the PCR reaction system according to Table 2, and set the PCR program according to Table 3 for PCR amplification.

[0049] Table 2 PCR system

[0050]

[0051] Table 3 PCR program

[0052]

[0053] Gel electrophoresis: Use 1.5% agarose gel electrophoresis to detect the band size of PCR products.

[0054] Amplification product sequencing: PCR products whose electrophoresis results are consistent with expectations will be sent to BGI (Beijing) Co., Ltd. for sequencing.

[0055] Probe design: Following the probe design principles, an oligonucleotide probe of 45-50 nt in length was designed at the papaya chloroplast gene-specific site, labeled with a FAM fluorescent group at the 5' end, modified with a C3-spacer at the 3' end, and a d-Spacer (THF tetrahydrofuran) was inserted in the middle of the probe 27-30 nt away from the 5' end.

[0056] 3. Experimental Results

[0057] 3.1 Screening of differential sites

[0058] After assembling the chloroplast genome sequences of various papaya varieties, the differential sites can be screened, such as Figure 1 shown.

[0059] 3.2 Differential site amplification verification

[0060] like Figure 2 As shown, the fragments near the differential sites were amplified and verified, and the results of agarose nucleic acid electrophoresis detection were consistent with expectations. The target fragments were amplified in each variety. The amplified products were then sent for sequencing, and the sequencing results were basically consistent with the chloroplast genome assembly results. The results showed that the chloroplast genome sequence assembly was consistent with expectations and the differential site fragments really existed.

[0061] 3.3 Molecular marker probes

[0062] Based on the sequence at the 60 kb differential site, fluorescent molecular marker oligonucleotide probes were designed, and the results are shown in Table 4.

[0063] Table 4 Fluorescent probe sequences based on specific sites

[0064]

[0065] That is, SEQ.ID.NO.1=5'- GAGGAGAACAAATATTTCTTTTTTGAATTTTTGAATGAGAATTTTACA-3';

[0066] The sequence after insertion of (THF tetrahydrofuran) is: 5'-GAGGAGAACAAATATTTCTTTTTTGA(THF)TTTTTGAATGAGAATTTTACA-3'.

[0067] 3.4 Verification Sites

[0068] Constant temperature water bath: Jinghong, DK-S24;

[0069] Nucleic acid test strips: PS-FMBO-48 (without shell);

[0070] Sample: Papaya leaves;

[0071] Plant genomic DNA extraction kit: Tiangen, DP305;

[0072] Amplification kit: EasyBio NF-LQ-48.

[0073] DNA amplification: Use primers CPP4F / CPP4R, fluorescent probes and amplification kits to prepare the amplification system according to the system in Table 5, that is, use sterile water instead of DNA template as a negative control. After preparing the amplification system, add 2 μL of Starter and place it in a 40℃ water bath for reaction for 30 min before use.

[0074] Table 5. Sample DNA isothermal amplification system

[0075]

[0076] Nucleic acid test strip detection: Take 10 μl of the amplified product, dilute it 10 times with Diluent buffer, and then add it dropwise to the test strip. After the chromatography reaction for 5 minutes, check the test line (T) and quality control line (C).

[0077] 3.5 Experimental Results

[0078] like Figure 3 As shown, the nucleic acid test strip test results show that the CK sterile water test strip quality control line is colored, proving that the test strip can be used for detection experiments. In this experiment, the oligonucleotide fluorescent probe successfully combined with the papaya Guangmi, Hongling, Guire and Qionghaihuang (susceptible to anthracnose) leaf DNA, causing the fluorescent modifier to be colored, while the papaya Daqing, Hongfei and Tainong (resistant to anthracnose) leaf DNA did not bind to the probe, and the result was that the test line did not develop color. According to the test results, the molecular marker probe can be used to distinguish papaya varieties with different resistance to anthracnose.

[0079] 4. Description of experimental results

[0080] Based on the alignment results of the chloroplast genome sequences of various papaya varieties, we found multiple differential sites, among which there was a differential site in the region around 60 kb. Through this site, we can distinguish papaya varieties with different anthracnose resistance, which is an ideal site for molecular markers. We intercepted the sequence of about 250 bp upstream and downstream of the differential site as a reference sequence, selected homologous sequences to design primers, and used the DNA of samples of various papaya varieties as templates for PCR amplification. A single bright band with the expected size was amplified in all 7 templates, proving that the differential site fragment obtained by chloroplast genome sequence analysis exists and can be amplified and identified.

[0081] The PCR amplification products were sequenced by Sanger sequencing and the sequencing results were compared. The comparison results confirmed the existence of an 8 bp differential site at this site that can distinguish papaya varieties with different anthracnose resistance. Based on this site, an oligonucleotide fluorescent probe was designed, and molecular biological methods such as RPA (Recombinase Polymerase Amplification) can be used to detect papaya leaf tissue. Molecular identification can be achieved by the presence or absence of fluorescent signals, thereby efficiently distinguishing papaya varieties with different anthracnose resistance.

[0082] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

Claims

1. A DNA probe for distinguishing papaya varieties resistant to anthracnose, characterized in that: The nucleotide sequence of the DNA probe is: 5'-GAGGAGAACAAATATTTCTTTTTTGA(THF)TTTTTGAATGAGAATTTTACA-3'.

2. A DNA probe for distinguishing papaya anthracnose-resistant varieties according to claim 1, characterized in that: The DNA probe is marked with a tracer marker.

3. A DNA probe for distinguishing papaya anthracnose-resistant varieties according to claim 2, characterized in that: The tracer label is an isotope label or a non-isotope label.

4. A DNA probe for distinguishing papaya anthracnose-resistant varieties according to claim 3, characterized in that: The non-isotopic label is an enzyme or a colored group.

5. A DNA probe for distinguishing papaya anthracnose-resistant varieties according to any one of claims 1 to 4, characterized in that: The papaya anthracnose-resistant varieties are Daqing, Hongfei and Tainong, and the papaya anthracnose-non-resistant varieties are Guangmi, Hongling, Guire and Qionghaihuang.

6. A kit for distinguishing papaya varieties resistant to anthracnose, characterized in that: The kit comprises the DNA probe according to any one of claims 1 to 5.

Images