Arthrobotrys nematophila NPS044 strain, biocontrol agent and application of Arthrobotrys nematophila NPS044 strain

Abstract

The invention provides an arthrobotrys nematophila NPS044 strain, a biocontrol agent and application of the arthrobotrys nematophila NPS044 strain and the biocontrol agent, the arthrobotrys nematophila NPS044 strain is preserved in the China Center for Type Culture Collection on June 29, 2023, the preservation number is CCTCC M 20231144, the classification name is Arthrobotrys flagra NPS044, and the preservation address is Wuhan University, Wuhan, China. The strain is induced by nematode larvae to generate a three-dimensional viscous net to capture nematodes as nutrition of fungi so as to kill the plant nematode larvae, and also can generate some secondary metabolites in the growth process to partially inhibit egg incubation and kill nematodes, so that a certain stage of the nematode life history is blocked, and the nematode disease prevention and treatment effect is achieved. The chlamydospores of the arthrobotrys nematophila can be used for preparing wettable powder or liquid fermentation preparations and other preparations to prevent and control root-knot nematodes, and the preparation has a good shelf life.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control of plant diseases and insect pests, and particularly relates to a nematophila Arthrospora nematophila NPS044 strain, a biological control preparation and applications thereof. Background Art

[0002] Meloidogyne, the root-knot nematode of crops and vegetables, is an important pathogen that harms many crops and vegetables. It is multi-parasitic and has a wide distribution range. After the planted plants are infected by the root-knot nematode, bead-like nodules appear on their lateral roots, which are called root knots. At the beginning of the disease, the root knots are yellow-white, then turn brown, and several nodules can be seen connected together like beads, and finally form a chicken claw-like tumor. Dissection reveals that there are pear-shaped female worms parasitizing inside. The symptoms of diseased plants are yellowing, stunted development, and even withering and death; which leads to increased production costs and reduced economic benefits. Severe infection can cause a 70% reduction in crop and vegetable production, which has caused huge losses to agriculture around the world. In recent years, the damage to vegetables and fruits produced in various greenhouses, such as melons, cucumbers, ginger, bitter melons, tomatoes, etc., has become increasingly serious, and the entire greenhouse vegetables are destroyed and difficult to cure. The prevention and control of this parasitic nematode has become an urgent problem that needs to be solved. At present, the use of chemical agents is still the main method for controlling root-knot nematodes, but root-knot nematodes have developed resistance to chemical drugs, and chemical drug residues threaten food safety and human and animal health. Some highly toxic and insecticidal chemicals have been restricted for use. The implementation of more sustainable and green environmentally friendly technologies in the management of crops and vegetables has become a worldwide demand. More and more research efforts are aimed at finding and utilizing beneficial microorganisms. Many beneficial microorganisms have been studied for biological control of insects, plant pathogens and weeds, as well as for improving plant nutrition or for bioremediation. Biological control is also an option that needs to continue to explore its application potential in plant pest management.

[0003] The use of fungi and bacteria to control plant parasitic nematodes, currently there are several biological control agents have proven their effectiveness, so the use of natural enemies of nematodes to control plant nematodes is attracting attention. Among fungi, P. chlamydosporum and P. lilacinus are egg-killing nematode-feeding fungi that can parasitize root-knot nematode eggs. Their nematicidal mechanism mainly acts on nematode eggs. Various enzymes secreted by hyphae in contact with the egg surface cause the egg shell to be destroyed and its contents are absorbed and utilized by the fungi. These two fungal preparations have been commercially registered and promoted for use as plant nematode control. However, the existing biological control preparations P. lilacinus and P. chlamydosporum have conidia as the active ingredients of the final products (the latter can produce some chlamydosporium), and conidia generally have a short shelf life. After being used in production, their insecticidal effect is not ideal. In particular, the P. chlamydosporum (Verticillium) preparations currently produced in China have degenerated strains and do not produce chlamydosporium, and the active ingredients and vitality in the preparations are seriously reduced. Therefore, it is necessary to explore more promising strains or combined preparations to solve these problems. Summary of the invention

[0004] In view of all or part of the deficiencies of the above-mentioned prior art, the object of the present invention is to provide a nematophilic Arthrospora spore strain NPS044, a biocontrol agent and its application, so as to provide a new green and sustainable development technology for nematode control, especially plant root-knot nematode control.

[0005] In order to achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0006] The invention provides an Arthrobotrys flagrans NPS044 strain, and the deposit number of the Arthrobotrys flagrans NPS044 strain is CCTCC M20231144.

[0007] The ITS sequence of the Arthrospora nematophila strain NPS044 is shown in SEQ ID No.1, and the RPB2 sequence is shown in SEQ ID No.2.

[0008] The present invention also provides a biocontrol agent, which contains at least one of the above-mentioned Arthrospora nematophila NPS044 strain, its chlamydospores, its secondary metabolites and its culture.

[0009] The formulation of the biocontrol agent includes at least one of a suspension, a wettable powder and a liquid fermentation preparation.

[0010] The preparation method of the suspension comprises: inoculating the Arthrospora nematophila NPS044 strain on a PDA culture medium or corn kernels, washing off the chlamydospores or culture, and obtaining a spore suspension or a bacterial suspension.

[0011] The wettable powder comprises: 70-90% of the mother drug, 5-10% of diatomaceous earth, 3-6% of carboxymethyl cellulose, 3-6% of polyvinyl alcohol, and 2-4% of pull-opening powder; the mother drug is the spore powder of the nematophila arthrospora NPS044 strain, and the chlamydospore content in the wettable powder is 2.4×10 6 -9.6×10 7 Pieces / g.

[0012] The preparation method of the liquid fermentation preparation comprises: inoculating the bacterial suspension into a culture medium to obtain seeds, and inoculating the seeds into a fermentation tank to obtain the liquid fermentation preparation; the liquid fermentation preparation contains secondary metabolites of the nematophila arthrospora NPS044 strain, and the content of chlamydospores in the liquid fermentation preparation is 1.04×10 5 -1.42×10 5 Pieces / mL.

[0013] The present invention also provides an application of the above-mentioned Arthrospora nematophila NPS044 strain or the above-mentioned biological control preparation in biological control of nematode diseases.

[0014] The nematodes include Caenorhabditis elegans and plant root-knot nematodes, and the plant root-knot nematodes include at least one of tomato root-knot nematodes, melon root-knot nematodes, bitter melon root-knot nematodes and ginger root-knot nematodes.

[0015] The present invention also provides a use of the above-mentioned Arthrospora nematophila NPS044 strain or the above-mentioned biocontrol agent in the preparation of a plant growth promoter, wherein the plant comprises at least one of tomato and ginger.

[0016] Unlike the two nematode-eating fungi, P. chlamydosporum and P. lilacinus, the nematode-killing mechanism of Arthrobotrys flagrans is that it mainly acts on the larval stage of nematodes. It is a nematode-trapping fungus. The fungus can produce a three-dimensional sticky net after being induced by nematode larvae to capture nematodes as nutrition for the fungus and kill the larvae of plant nematodes. At the same time, it can also produce some secondary metabolites during the growth process that can partially inhibit the hatching of eggs and kill nematodes, thereby blocking a certain stage of the nematode life history and playing a role in preventing and controlling nematode diseases.

[0017] Another characteristic of A.flagrans that is different from other nematophagous fungi is that it can produce a large number of double-walled thick-walled spores during its growth. Such spores have strong resistance to adverse external environmental conditions and often exist in an endogenous dormant state. Therefore, the final product made from such spores has a much longer effective shelf life than the spores, and thus has a good shelf life. Therefore, the thick-walled spores of A.flagrans can be used to prepare wettable powders or liquid fermentation preparations to control root-knot nematodes. The currently published literature on biological control of A.flagrans has not yet involved the insecticidal effect of the fungus on plant root-knot nematodes. Therefore, in view of the short shelf life of existing fungal biocontrol preparations in agriculture, the resistance of current chemical drugs, and the problems of residues in agricultural products and the environment, it is particularly necessary to use the excellent biological characteristics and biological control potential of A.flagrans to develop new varieties of microbial pesticides for the biological control of plant root-knot nematodes.

[0018] Collection Instructions

[0019] Classification and nomenclature: A. flagrans NPS044;

[0020] Depository: China Center for Type Culture Collection;

[0021] Abbreviation of depository institution: CCTCC;

[0022] The registration number of the CCTCC is: CCTCC M 20231144;

[0023] Taxonomic nomenclature: Arthrobotrys flagrans NPS044,

[0024] Deposit address: Wuhan University, Wuhan, China; Date of preservation: June 29, 2023. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the specific embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The diagram shows the morphology of conidia and chlamydospores of the nematophila Arthrospora NPS044 isolate, where A: single conidia; B: stalk on which conidia are attached; C: conidia and chlamydospores of different shapes.

[0027] Figure 2The diagram shows the colony characteristics of the Arthrospora nematophila NPS044 isolate obtained on 8 culture media; A: front of the plate; B: back of the plate.

[0028] Figure 3 The figure shows the colony photos (colony characteristics) of thick-walled spores in the late growth stage in PDA plates; A: front of the plate; B: back of the plate.

[0029] Figure 4 The figure shows the in vitro test of the nematophila strain NPS044 killing the second-instar larvae of root-knot nematodes.

[0030] Figure 5 The diagram shows the photos of tomato seedling roots under a microscope; A: thick-walled spores in the roots of the fungus-treated group (10×40); B: roots of the blank control group (10×10). DETAILED DESCRIPTION

[0031] The technical solutions in the specific embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] It should be noted that, in order to describe the technical solution more specifically, the steps described in the following embodiments do not strictly correspond to the steps described in the content of the invention.

[0033] Example 1 A strain of Arthrospora nematophila

[0034] Method for obtaining Arthrobotrys flagrans (A. flagrans) NPS044 strain:

[0035] 1. Bacterial strain isolation and morphological identification:

[0036] The A. flagrans NPS044 strain was isolated in August 2014 from the forest soil in Pinghu County, Jiaxing City, Zhejiang Province.

[0037] Soil isolation method: Soil samples were spread in a "V" shape in the center of a water-agar medium (WA medium) plate. After culturing at 25°C for 24 hours, 1,000 Caenorhabditis elegans were added to the plate (Caenorhabditis elegans was cultured on NGM medium in advance and washed off from the NGM medium with sterile distilled water when used), and the culture was continued for 4 days. The cultured WA medium was observed under a 40x inverted microscope, and the captured Caenorhabditis elegans larvae were found and transferred to another WA medium plate together with the hyphae; Caenorhabditis elegans was added and cultured again, and repeated 2-3 times. Then, the hyphae on the WA medium that was transferred and cultured for the last time were cut into pieces and transferred to potato agar medium (PDA medium), and cultured at 28°C for 7 days. After hatching, the purified isolate was obtained.

[0038] The purified isolate was transferred to the center of a cornmeal agar medium (CMA medium) plate and cultured at 28°C. After the mycelium grew to 1 / 2 of the plate area, the mycelium, conidiophores and spores were obtained by the insert method. The morphology of conidia, conidiophores and thick-walled spores was observed under a microscope in combination with lactophenol cotton blue staining, and the spore size and other data were measured. Digital photography was performed to obtain the morphology of the isolate. Figure 1 As shown, it was named as A. flagrans NPS044, abbreviated as NPS044 isolate.

[0039] After observation and measurement:

[0040] Conidiophores of NPS044 isolate: erect, septate, 80.0-440 μm long (average 253 μm, n=60).

[0041] Conidia of NPS044 isolate: oval or oblong, oblong, elliptical, bulb-shaped, club-shaped, etc., with blunt distal end and slightly narrow and truncated proximal end; some conidia have no septa, and some have 1 or more septa. Conidia size: length 20-62.5μm (average 35.7μm, n=100), width 5-12.5μm (average 9.6μm, n=100).

[0042] The thick-walled spores of the NPS044 isolate are yellow-brown, spherical or elliptical; the diameter of the spherical chlamydospores is 22.5-30.0μm (average 25.9μm, n=60), the long diameter of the elliptical chlamydospores is 25-45.5μm (average 32.6μm, n=30), and the wide diameter is 20-27μm (24.4, n=30); there are nodules on the surface of mature chlamydospores.

[0043] After the NPS044 isolate interacted with C. elegans, it produced a three-dimensional sticky web and used it to capture and kill C. elegans. The above morphological data are consistent with the characteristics of A. flagrans.

[0044] 2. Colony characteristics:

[0045] Inoculate the NPS044 isolate on a PDA medium plate, culture at 28°C, and grow for 6 days; take the culture after 6 days of growth, and use a 5mm diameter puncher to remove the round agar block. Inoculate the agar block with the surface (strain growth surface) facing down in the center of the following 8 medium plates.

[0046] The eight culture media were malt extract agar medium (MEA medium), Sabouraud agar medium (SDA medium), potato agar medium (PDA medium), Gaucher agar medium (GSA medium), eosin-methylene blue agar medium (EMB medium), red tiger agar medium (RBA medium), Czaper yeast medium (CYA medium), and cornmeal agar medium (CMA medium). The growth performance of the strains was shown in Table 1. The strains were cultured at 28°C for 5 days. Figure 2 shown.

[0047] The colony diameters obtained on 8 culture media are shown in Table 1:

[0048] Table 1 Colony diameters obtained on 8 kinds of culture media

[0049]

[0050]

[0051] The NPS044 isolate was inoculated into PDA medium and grown at 28°C for 14 days. Aerial hyphae were abundant and a large number of thick-walled spores were produced, causing the surface to turn yellow. The colony photos are shown in Figure 1. Figure 3 shown.

[0052] 3. Molecular characteristics

[0053] The 7-day PDA agar pure culture of the NPS044 isolate was cut and inoculated in potato dextrose water for shaking culture for 5 days. The mycelium was centrifuged to extract genomic DNA. The universal primers ITS1 and ITS4 were used to amplify the ribosomal 5.8S, internal transcribed spacer ITS1 and ITS2, and part of the 28S RNA. The target fragment was amplified using the TaKaRa Taq kit with a 25μL amplification system: 2.5μL 10×LAPCR BufferII; 4μL dNTP Mixture; 0.5μL of universal primers each; 0.5μL Taq enzyme, 17μL deionized water. The PCR reaction conditions were 94℃ pre-denaturation for 4min, 94℃ denaturation for 45s for 35 cycles, annealing conditions at 45℃ for 1min, 72℃ extension for 2min, and finally extension for 10min. The product was purified and sequenced. The ITS sequence measured was compared with the sequence analysis in the GenBank database, indicating that the NPS044 isolate was quite different from other foreign isolates and was a new isolate isolated in my country. The ITS sequence shown in SEQ ID No.1 was measured:

[0054] TTTTCCTCCGGCTTATTGATATGCTTAAGTTCAGCGGGTATCCTTGTCTGATCTGAGGTCAAACCTTGAGAAAAAGGGTAGGTTTTGTTCAGGCCATACCGTTCGGCTTCACCCTAACAAAAGTAGTGCTTACTATGTTCTGGTTGGGGCGGAGCGGCC AGCAGAGCTTACAACTTTAAAACCGGCACGGCGTCAACCGTTCGGGTTCAAAACCAGCGTTAGCTGAGGGGTTGTAATGACGCTCAAACAGACATGCCCAAAGGAATACCAATGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAA TTCACATTAACTATCGCGTTTCCGCTGCGTTCTTCATCGATGCGGGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTTCATTCGAAAATTTTGGTTATCAGACAATGTTTTTGACAACAAGTTTTTTTTTTGAAGGTGCTAGCGGCAGGCTGACAGGC CACCCGGTCAAGACCGGATGAAGACCCAGCTGCCGAAGCGAAATGGTTTTTTTGGTTCACAAAAGGTCAACCTCAGACTCTCCTTTTCCCATCCGTGGGTATGGAAGGTTACGGACCCCTGCTGTGGTTGGCTTACGTTTTGGTAATGATCCTTCCGCAG

[0055] In addition, Primer 5.0 was used to design RPB2 primers, and a 25 μL amplification system was used: 2 μL template DNA; 8.5 μL sterilized water; 1 μL of each primer; 12.5 μL Taq enzyme. The PCR reaction conditions were 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s for 35 cycles, annealing conditions at 48°C for 30 s, 72°C extension for 1 min for 35 cycles, and finally 72°C extension for 10 min. Sequencing was performed after purification. The RPB2 sequence shown in SEQ ID No. 2 was measured:

[0056]

[0057] The RPB2 sequence of the NPS044 isolate of the present invention is the first sequence of this species, representing its important genetic characteristics; in the application of the NPS044 isolate, it can be distinguished from other different isolates.

[0058] 4. Other characteristics of NPS044 strain

[0059] The thick-walled spores produced by the NPS044 strain are placed in structural dormancy by low-temperature freeze drying, room temperature drying, 35-40℃ air blowing or vacuum drying, etc., and the spore germination rate is seriously reduced or close to 0%. The spore dormancy can be gradually released and the germination rate can be restored by low-temperature treatment of 4℃ to -80℃ for more than 7 days, or treatment in a room temperature environment with a relative humidity of more than 90% for more than 14 days, or treatment at a constant temperature and humidity of 28℃ (RH90% or more) for more than 7 days. Therefore, the live spore count in the final product made of thick-walled spores is used for quality inspection by MTT staining, which dyes the cytoplasm of dormant spores or germinating spores red or blue, and dead spores are not colored. The thick-walled spores of the NPS044 strain are the main structural form of the strain to survive in nature, and are also the effective component of the biological control agent after drying. The thick-walled spores are also the main structure for the preservation of laboratory strains. Long-term preservation and reproduction of strains rely on thick-walled spores, and short-term preservation or reproduction of strains can use mycelium, conidia and thick-walled spores. The growth temperature range of vegetative mycelium of strain NPS044 is 11-35℃, the optimal growth temperature is 30℃, the growth pH range is 4-11, and the optimal pH is 7.0.

[0060] Example 2 In vitro predation test and simulated micro-plot test of a nematophilic Arthrospora nematophila strain (NPS044 strain) on root-knot nematodes

[0061] 1. Prepare root-knot nematodes

[0062] The diseased roots of melons with root-knot nematodes were taken from the greenhouse where the root-knot nematodes were infested and brought back to the laboratory. After being cleaned with water, they were soaked and disinfected with sodium hypochlorite, and then rinsed with sterile water. Then they were cut into small pieces and placed in a culture dish. The larvae were hatched with sterile water, filtered with gauze, and the filtrate was centrifuged to separate the insect bodies. The insect bodies were made into a 1000 / mL insect body suspension with sterile PBS (phosphate buffered saline), stored at 8°C for later use.

[0063] 2. In vitro predation test

[0064] The chlamydospores and mycelia of the NPS044 isolate obtained in Example 1 were inoculated on a PDA agar plate (spread in the center of the plate) and cultured at 28° C. for 6 days.

[0065] From the edge of the mycelium growth, a 5×5mm cube containing mycelium was cut with a scalpel and inoculated on a water agar medium (WA medium) plate. It was divided into two groups: one agar cube was inoculated on one plate, with the surface facing down in the center of the plate, and a total of 3 were inoculated as the test group; at the same time, another 3 water agar plates were not inoculated as the control group. The inoculated plates and the control plates were cultured at 28℃ for 3 days; 100 second-instar larvae (J2) of root-knot nematodes were added to each plate, and the plates were sealed with sealing film and continued to be cultured until the 7th day, and the agar cube on the plate was cut off. The nematode predation was observed under an optical microscope and photographed. The Baermann funnel method was used to separate the nematodes, collect and count them. Specifically: cut the agar from each plate into the sieve of the Baermann funnel, rinse with warm water, wash off the contents and let stand for 12 hours, then pipette 10 μL of the sediment in the tube onto a glass slide, count the number of live larvae, count 10 times in a row, and take the average value.

[0066] The in vitro insecticidal effect was calculated according to the following formula: Insecticidal rate (%) = ((average number of J2 in the control group - average number of J2 in the test group) / average number of J2 in the control group) × 100%

[0067] Note: Data were analyzed using a completely random model, analysis of variance (ANOVA) and Tukey test, with p < 0.05 being significant.

[0068] Test results: Figure 4 As shown, under the microscope, the NPS044 isolate produced a three-dimensional sticky web that could prey on the second-instar larvae of the root-knot nematode J2. The effect of the NPS044 isolate on preying on nematodes in vitro after 4 days of interaction on the WA plate is shown in Table 2.

[0069] Table 2 In vitro nematode trapping test

[0070]

[0071]

[0072] As can be seen from Table 2, there is a significant difference in the larvae obtained from the control group and the test group (p<0.05), and the in vitro insecticide rate is 85.6%.

[0073] 3. Simulated micro-plot test

[0074] First, prepare the thick-walled spores of the NPS044 isolate as follows: use a scalpel to cut 5×5 mm mycelium-containing squares from a 6-day-old chloramphenicol-containing PDA agar culture and inoculate them on a 15-cm-diameter PDA plate for expansion culture. The plate is cultured at 28°C for 14 days. The culture is stopped when the surface of the culture medium gradually turns gray-yellow (yellow on the back) and a large amount of powdery matter appears.

[0075] At this point, the culture contains a large number of chlamydospores and a very small number of conidia. Add 20-30 mL of 0.05% sterilized Tween-80 to each plate, gently scrape off the chlamydospores and a very small number of conidia with a sterilized spreader stick, filter with double gauze to remove some residual hyphae, and count with a hemocytometer to prepare a spore content of 1×10 5 / mL bacterial suspension.

[0076] Drinking paper cups were used as micro-plot models to simulate plot conditions. The specific model was as follows: 10 g of sterile crushed sheep feces was added to each of 30 paper cups, and then 30 g of soil containing approximately 200 second-instar larvae (J2) of root-knot nematodes was added and mixed.

[0077] Set up 3 groups, each with 10 paper cups (n=10):

[0078] 1) Fungus treatment group: 1.5×10 chlamydospores of NPS044 isolate were added to each cup. 5 indivual;

[0079] 2) Positive control group (pesticide group): add 0.3 g of 10% thiathiazolyl granules per cup;

[0080] 3) Negative control group: only root-knot nematode J2, without fungi and pesticides.

[0081] The above treatments were fully mixed with the soil, and appropriate amount of water was added to keep the soil moist (water content of about 30%). All paper cups were incubated at room temperature (18-25°C) for 12 days. After incubation, the contents of each paper cup were transferred to the sieve of the Baermann funnel, and 40°C water was added to settle for 24 hours. The liquid was taken out from the bottom tube, 10 μL was dropped on the slide, and the larvae were observed and counted under a microscope for 10 consecutive times. The reduction of the root-knot nematode population was evaluated using the following formula: A = (yx) / y×100. In the formula, A = the percentage of nematode population reduction, x = the average value of larvae obtained in the experimental group (fungus treatment group and positive control group), and y = the average value of larvae obtained in the negative control group. The data were analyzed using a completely random model, analysis of variance (ANOVA) and Tukey test, and p < 0.05 was significant. The root-knot nematode J2 obtained in each group and the percentage of reduction are shown in Table 3 below.

[0082] Table 3 Mean number, standard deviation and reduction percentage of root-knot nematodes obtained under three different treatments

[0083] Group J2 (mean ± SD) Reduction percentage (%) Negative control group <![CDATA[149.2(±67.14) a ]]> 0c Positive control group <![CDATA[8.5(±6.88) b ]]> <![CDATA[94.31 a ]]> Fungus treatment group <![CDATA[7.2(±5.16) b ]]> <![CDATA[95.17 a ]]>

[0084] Note: Different letters in the upper right corner of the table indicate statistically significant differences (P≤0.05), coefficient of variation = 14.41; R 2 =0.

[0085] As can be seen from the above table, adding thick-walled spores of NPS044 isolate to the soil and interacting with root-knot nematode larvae for 12 days can reduce the nematode rate by up to 95% compared with not adding spores, which is similar to that of thiazophos, indicating that the thick-walled spore suspension of NPS044 isolate has a significant killing effect on root-knot nematodes.

[0086] Example 3 Control effect of chlamydospores of Arthrospora nematophila on root-knot nematodes of potted tomatoes

[0087] 1. Prepare root-knot nematodes: Collect a large number of bean roots with severe nodules from the greenhouse bean plots infested with root-knot nematodes when turning the soil. Wash the diseased roots with tap water, soak and disinfect them with sodium hypochlorite, and then rinse with sterile water. Then cut the diseased roots into small pieces of 0.5-1 cm, place them in a white porcelain box, submerge the root pieces with sterile water, and incubate for 48 hours, stirring several times. Then filter with double-layer gauze, centrifuge, and make a suspension containing 1000 root-knot nematodes per mL for later use.

[0088] 2. Prepare chlamydospore suspension: inoculate NPS044 strain into corn kernels and culture at 28°C for 25 days to obtain corn kernel culture. Wash the corn kernel culture with clean water to wash off the chlamydospores on the corn kernels. Prepare chlamydospore suspension to contain 1.5×10 4 Prepare a suspension of chlamydospores for later use.

[0089] 3. Experimental design and procedures: Take 24 flower pots with a volume of 0.5 liters and divide them into 4 groups, with 6 flower pots in each group. Each flower pot contains 100 grams of sterile soil.

[0090] The experiment was divided into 4 groups:

[0091] The first group was the fungus treatment group, where 5,000 chlamydospores were added to each gram of soil, the soil was stirred repeatedly and then placed in flower pots;

[0092] The second group was treated with avermectin. A commercially available avermectin oil with a mass percentage of 5% was diluted 2000 times with distilled water and added to the soil in the same amount as the spore suspension of the first group. After stirring evenly, the mixture was placed in a flower pot.

[0093] The third group was the nematode control group, which was treated with an equal amount of water to the spore suspension of the first group, mixed with soil, and placed in flower pots;

[0094] The fourth group was a blank control group, in which an equal amount of water as the spore suspension of the first group was added, mixed well with the soil, and placed in a flower pot.

[0095] The flower pots in the above groups were filled with sterile soil, and one tomato seedling was planted in each flower pot, and watered after planting. Two days after planting, except for the fourth group as a blank control, 1.5 mL of root-knot nematode suspension (containing 1000 root-knot nematodes per mL) was injected at 4 points around the roots of the tomato seedlings in the remaining groups using a pipette tip.

[0096] Place each group of flower pots in the same environment and water them in time according to the soil moisture to ensure the normal growth of tomato seedlings. After 100 days of planting, check the root condition of each group of plants. Calculate the number of lateral roots infected with root knots and the total number of lateral roots of the diseased plants, and divide the disease level. Calculate the root knot index according to the following formula:

[0097] Root knot index = Σ(disease grade × number of plants of corresponding grade) / 4 × total number of plants) × 100%;

[0098] Relative control effect = (root knot index of control group - root knot index of treatment group) / root knot index of control group × 100%. The root knot index of control group is the root knot index of nematode control group, and the root knot index of treatment group is the root knot index of fungus treatment group or avermectin treatment group.

[0099] At the same time, plant height, area of ​​the largest leaf in the same layer, root length, fresh weight of aboveground part and fresh weight of root were measured.

[0100] Then, the roots of the fungus-treated group and the blank control group were repeatedly rinsed with tap water to remove the remaining soil particles, transparentized with 10% KOH, neutralized with 2% HCl, and stained in lactic acid glycerol containing trypan blue after rinsing. The presence of spores was examined under an optical microscope and photographed.

[0101] Pot test results: After 100 days of growth, 3 plants in the third group (nematode control group) were found to have nodules on their roots, and their disease was grade 1. The root knot index of the control group was 12.5%. No diseased plants were found in the fungus treatment group and the avermectin treatment group, and the root knot index of the two groups was 0%. Therefore, the relative control effect calculated according to the formula is: (12.5%-0%) / 12.5%=100%. It shows that the thick-walled spores of the NPS044 strain germinate in the soil to kill the second-instar larvae of the nematode and inhibit the hatching of the eggs, which is close to the insecticidal effect of avermectin. The fungus is effective in biological control of tomato root-knot nematodes, but has many advantages over drug control.

[0102] The plant height, maximum leaf area, root length, aboveground fresh mass (fresh mass of the aboveground part), and fresh root mass (fresh mass of the root part) of each group measured at 100 days of growth are shown in Table 4, where Group 1 is the fungus treatment group, Group 2 is the avermectin treatment group, Group 3 is the nematode control group, and Group 4 is the blank control group. It can be seen from the table that the nematode control group (Group 3) has significant differences in maximum leaf area, root length, aboveground fresh mass, and fresh root mass compared with the fungus treatment group and the other three groups, proving that the fungus can prevent and control nematodes in the roots of tomato seedlings and maintain good growth. The root staining results of the fungus treatment group showed that the thick-walled spores of the NPS044 strain can germinate and grow and reproduce in the roots of the plants, and produce thick-walled spores (see Figure 5 ). This indicates that the NPS044 strain can colonize in the rhizosphere of plants and has the potential to be a biological control of nematode diseases.

[0103] Table 4 Growth data of each group

[0104] Group Plant height Maximum leaf area Root length Fresh quality Fresh root quality 1 <![CDATA[33.1±2.44 a ]]> <![CDATA[3.4±1.57 a ]]> <![CDATA[13.8±2.26 a ]]> <![CDATA[2.7±0.71 a ]]> <![CDATA[0.78±0.17 a ]]> 2 <![CDATA[32.13±3.11 a ]]> <![CDATA[1.94±1.06 a ]]> <![CDATA[11.97±2.82 a ]]> <![CDATA[3.48±0.48 a ]]> <![CDATA[0.96±0.28 a ]]> 3 <![CDATA[27.42±3.41 a ]]> <![CDATA[1.134±0.38 b ]]> <![CDATA[5.78±3.78 b ]]> <![CDATA[1.27±0.5 b ]]> <![CDATA[0.35±0.14 b ]]> 4 <![CDATA[25.25±3.60 a ]]> <![CDATA[1±1.09 b ]]> <![CDATA[9.55±2.08 a ]]> <![CDATA[2.75±0.56 a ]]> <![CDATA[0.9±0.15 a ]]>

[0105] Example 4: Wettable powder prepared from Arthrospora nematophila and its application

[0106] The preparation of wettable powder comprises the following steps 1 and 2:

[0107] Step 1. Preparation of chlamydospores

[0108] The A. flagrans strain NPS044 was inoculated on a chloramphenicol-containing potato agar (PDA) plate and cultured at 28°C for 5 days. After checking for purity, a 5×5 mm square was cut from the edge of the colony with a scalpel and then transferred to PDA for expansion culture and cultured at 28°C for 7 days. Then, sterile distilled water was added to wash the culture from the plate according to strict aseptic operation to prepare a bacterial suspension, and the count was adjusted to about 3×10 5 spores (mainly conidia). The above-mentioned bacterial suspension containing spores is inoculated into a conical flask containing 100mL of modified Sabouraud broth (10g of peptone, 20g of glucose, 1000mL of distilled water, adjusted to pH 7.0-7.4) at a seed inoculation rate of 5%, and cultured at 200r / min shaking for 3 days. This seed liquid is inoculated into a 1000mL conical flask containing 200mL of Sabouraud broth at a seed inoculation rate of 5-10% for expansion culture, and cultured at 200r / min shaking for 48-72h.

[0109] 1-2kg of hulled rice is placed in a special high temperature resistant plastic bag (with two filter membranes), the amount of tap water added to the rice is 0.55% (v / w), sterilized at 121°C for 25min, and after cooling to room temperature, the seed liquid is inoculated in the plastic bag at 10% (v / w). The plastic bag is squeezed within 2d after inoculation so that the fungus can spread and grow evenly. After the bag is inoculated, it is placed at 28°C or room temperature for 21d. The culture in the bag turns yellow, indicating that a large number of thick-walled spores are produced. At this time, the culture is stopped and poured into a plate, placed in a drying oven at 37°C for 48h, and the moisture content is less than 10% by a rapid moisture meter. The dried A. flagrans rice culture is crushed by a jet mill, and the 100-mesh sieve (mother drug) is collected. 5g of the mother drug is sampled and diluted with 10-20 times water. The spore suspension is taken to count the thick-walled spores in a blood cell counting plate. Each gram of mother drug contained 5×10 6 —1.2×10 7 indivual.

[0110] Step 2: Prepare wettable powder

[0111] 80% of the mother drug, 9% of diatomaceous earth, 4% of carboxymethyl cellulose, 4% of polyvinyl alcohol, and 3% of lakai powder were mixed evenly in a three-dimensional mixer to obtain a wettable powder product. The chlamydospore count was 2.4×10 6 -9.6×10 6 The final product is weighed and packed into aluminum-plastic packaging bag, which is sealed for later use.

[0112] The following is the effect experiment of the wettable powder prepared by the strain of Arthrospora nematophila NPS044:

[0113] 1. Experiment on the insecticidal effect of wettable powder on root-knot nematodes of melon

[0114] Preparation of root-knot nematode inoculum: Take fresh diseased roots of melon with many root knots, wash them with water, cut them into 1-2 cm small pieces, put them in a conical flask, add 1% sodium hypochlorite to submerge the root pieces, soak and shake slowly for 30 seconds. Pass the soaked material through a 100 mesh sieve first, then through a 500 mesh sieve. Wash the sieve (i.e., eggs) with tap water, and count the number of eggs with an egg counting plate for the experiment.

[0115] Take 20 plastic flower pots with a capacity of about 2L and fill them with half of sandy soil and half of nutrient soil. Divide the flower pots into 4 groups, 5 in each group (n=5), and perform the following treatments:

[0116] 1) Verticillium chlamydosporium (Vc) test group: commercially available Verticillium chlamydosporium powder was added to the flower pot according to the spore content specified in the instructions and mixed well to make 5,000 spores per gram of soil;

[0117] 2) Arthrobotrys flagrans (Af) test group: A. flagrans wettable powder was added to make the spore content per gram of soil 5000;

[0118] 3) Vc+Af test group: 5000 spores of Verticillium and Arthrosporum nematophilum wettable powder were added to each flower pot per gram of soil;

[0119] 4) Control group: No fungus was added but only an equal amount of excipients in the wettable powder were added as a control.

[0120] After 1 day, the melon seedlings were planted, and then each pot was inoculated with a suspension containing 5,000 root-knot nematode eggs, injected into the rhizosphere of each seedling at 4 points 1 cm from the base of the seedling. The pots were placed in a 25°C greenhouse for 45 days. Then the control index was measured, and the number of root knots and eggs per gram of root in each group was evaluated according to the following formula:

[0121] Number of eggs per gram of root = total number of eggs in the root / mass of dry root (g);

[0122] Number of root knots per gram of root = total number of root knots / fresh root mass (g);

[0123] Relative control effect (%) = ((number of root knots per gram of root in the control group - number of root knots per gram of root in the test group) / number of root knots per gram of root in the control group) × 100%; Spss (23.0) was used to perform statistical analysis on the test data. The control effect is shown in Table 5.

[0124] Table 5 The control effect of A. flagrans wettable powder and Verticillium powder on melon root knot nematode disease

[0125] Group Comparison Vc A Vc+Af Number of knots per gram of root <![CDATA[185.5 c ]]> <![CDATA[155.5 b ]]> <![CDATA[36.3 a ]]> <![CDATA[41.3 a ]]> Rootworm eggs per gram <![CDATA[4910.7 c ]]> <![CDATA[3105.6 b ]]> <![CDATA[1000.5 a ]]> <![CDATA[985.8 a ]]>

[0126] Note: Different letters in the upper right corner of the same row in the table indicate significant differences (p<0.05).

[0127] This experiment proved that A.flagrans wettable powder was effective against root-knot nematodes of melon, with a relative control rate of 80.5%, while the relative control rate of commercial Verticillium powder was 16.2%. The number of root worm eggs per gram in the A.flagrans wettable powder group was significantly different from that in the control group and the commercial Verticillium powder (p<0.05).

[0128] 2. Field control test of wettable powder against melon root-knot nematodes

[0129] Divided into 3 groups:

[0130] 1) The fungus treatment group was divided into three groups, with application rates of 3kg / mu, 6kg / mu, and 10kg / mu. A. flagrans wettable powder was applied to the soil in holes according to the application rates, and melon seedlings were planted 3 days later;

[0131] 2) Avermectin treatment group: commercially available avermectin granules were applied to the soil at a rate of 5 kg / mu, and melon seedlings were planted 3 days later;

[0132] 3) Control group: a blank control group without any treatment.

[0133] After the treatment of the test group (fungus treatment group and avermectin treatment group) and the control group, 20 samples were randomly selected, and the disease rate and disease index were statistically calculated. The relative control effect was calculated according to the method of the above embodiment three. The result was that 6 diseased roots were found in the 20 blank control groups, of which 5 were grade 1 disease and 1 was grade 2 disease, and the root knot index of the control group was 8.75%; in the 3kg / mu test group, 2 grade 1 disease was found in 20 plants, and the root knot index was 2.5%; 1 grade 1 disease was found in the 6kg / mu, 10kg / mu test groups and avermectin treatment groups, and the root knot index was 1.25%. The relative control effect is shown in Table 6.

[0134] Table 6 Control effect of melon root-knot nematodes in the wild

[0135]

[0136] As can be seen from the table, the relative control effect of the wettable powder of the fungus strain NPS044 on field root-knot nematodes is 71.4-85.7%. Except for the 3kg / mu test group which is relatively low, the other two groups are equivalent to avermectin, indicating that the preparation has a better control effect on plant root-knot nematodes and can replace avermectin.

[0137] Example 5. Shelf life of the chlamydospore preparation of Arthrospora nematophila

[0138] The experiment was divided into two batches of spore powder (chlamydospore) mother medicine (grain culture dried and crushed), and the live cell ratio was determined by MTT method before storage after production, which was 85.25% and 84.5%. In April 2016, it was sealed and stored at 4°C for 6 years, and then transferred to room temperature for storage for 17 months and 20 months, and then the live cell percentage was checked by MTT method live cell staining, and the spore germination rate was counted on WA plates.

[0139] In order to verify the ability of spores to kill nematodes after germination, two batches of spore powder were diluted into suspension at 1:10 after being stored at room temperature for 17 months. 300 μL (about 1000-1100 thick-walled spores) were taken from each batch and inoculated on 3 WA plates (as the test group). Three WA plates were not inoculated with spores (as the control group). After culturing at 25°C for 2 days, 300 μL of Caenorhabditis elegans solution (about 2000 Caenorhabditis elegans) was added. After adding worms, the nematode capture was observed. After 12 days, the live worms were separated by the Baermann method and the number of live worms in the test group and the control group was counted. Finally, the capture rate was calculated. The live cell staining counts and spore germination counts of the two batches of samples are shown in Tables 7 and 8.

[0140] Table 7 Viable cell counts and spore germination rates of samples stored at room temperature for 17 months

[0141]

[0142] Table 8 Viable cell counts and spore germination rates of samples stored at room temperature for 20 months

[0143]

[0144] As shown in Table 7 and Table 8, the percentage of live cells in the two groups is basically similar, which proves that the shelf life of chlamydospores stored at room temperature is long. The low germination rate is because most spores are in a dormant state when stored at room temperature.

[0145] The in vitro predation results of the shelf life examination of the two batches of samples are shown in Table 9.

[0146] Table 9 In vitro predation effect of spores stored at room temperature for 17 months

[0147]

[0148]

[0149] As shown in Table 9, when stored at room temperature for 17 months, the insecticidal rate of spores of batch 1 was 84.12%, and the insecticidal rate of spores of batch 2 was up to 81.65%, and the insecticidal rates of the two groups were basically close. It further shows that the activity of the thick-walled spore powder remained unchanged after being sealed and stored at 4°C for 6 years, and it was stored at room temperature for 20 months. Compared with the initial live cell ratio, it only decreased by 4-8%, and still maintained good insecticidal performance. It further shows that the preparation made of the thick-walled spores of the fungus has an advantage of a longer shelf life than the currently listed fungal biological pesticides, and is suitable for promotion and use in production.

[0150] Example 6. Liquid fermentation and application of Arthrospora nematophila

[0151] 1. Experiment on killing the second-instar larvae of root-knot nematodes by secondary metabolites of liquid fermentation of bacterial strains

[0152] 1) Preparation of secondary metabolites: The 7-10 day old culture of the bacteria grown on PDA was washed with sterile water and prepared to a spore content of about 1×10 5 The bacterial suspension of 100 g / mL was inoculated into a 500 mL Erlenmeyer flask containing 100 mL YPD broth (10 g yeast extract, 20 g peptone, 20 g glucose, 1 L distilled water, pH 7) at 5%, and cultured at 28°C in a constant temperature shaker at 200 r / min for 14 days. The fermented bacterial liquid was then filtered to remove the mycelium, and the filtrate was the fermented liquid containing secondary metabolites, which was placed at 4°C for later use.

[0153] 2) Insecticidal test: A 24-well cell culture plate was used, with 8 wells in each test group, and 1 mL of fermentation filtrate was added to each well. 8 wells in the control group, and 1 mL of sterilized YPD (pH7) broth was added to each well. Then, 100 μL of approximately 150 J2 larvae of southern root-knot nematodes were added to each well of the two groups. After mild shaking, the plates were incubated at 25°C for 12 and 24 hours. The number of live and dead larvae, dead insect bodies (rigid, immobile) and live insect bodies (able to move or able to move after stimulation) were counted under an inverted microscope, and the death percentage of the two groups was finally calculated. The average number of live and dead insects and the mortality rate of the control group and the test group are shown in Table 10. As can be seen from Table 10, after 12 hours of fermentation filtrate action, the insect mortality rate was 56.0%, and after 24 hours, the mortality rate was 85.4%, while the mortality rate of the control group was only 3.1-4.4%, indicating that the secondary metabolites in the fermentation filtrate have a good insecticidal effect.

[0154] Table 10 Insecticidal test of secondary metabolites against second-instar larvae of root-knot nematodes

[0155]

[0156] 2. The control effect of liquid fermentation preparation on bitter melon and ginger root knot nematode disease in greenhouse

[0157] Preparation method of liquid fermentation preparation:

[0158] (1) Seed culture and fermentation

[0159] A. flagrans NPS044 strain stored on a 4°C slant was inoculated on a chloramphenicol-containing potato agar (PDA) plate and cultured at 28°C for 7-10 days. The spores and mycelium were washed off the plate with sterile distilled water to prepare 1×10 5The bacterial suspension of 100 mL / mL was inoculated into a 500 mL Erlenmeyer flask of Sabouraud broth medium (pH 7.0) at a 5% inoculation rate, with 100 mL in each bottle, and 2-5 bottles were inoculated, and cultured at 28°C and 200 r / min in a shaking incubator for 3 days as primary seeds. The seeds were inoculated into several 1000 mL Erlenmeyer flasks (200 mL) of the same medium at a 10% inoculation rate, and cultured under the same culture conditions for 48-72 hours as secondary seeds.

[0160] Prepare 20L of the following mycelium fermentation medium (soluble starch 20.00g / L, yeast extract powder 5.00g / L, KH2PO45.00 g / L, FeSO477.64 mg / L, peptone 1g / L, (NH4)2SO42g / L, pH=7.2) and put it in a 30L seed fermentation tank, sterilize at 121°C for 30min. After cooling, inoculate secondary seeds according to 8-10% of the filling amount, adjust the fermentation temperature to 28°C, the rotation speed to 200r / min, the ventilation volume to 9L / min, and add an appropriate amount of defoaming agent for liquid fermentation, and ferment for 48-72h.

[0161] (2) Product fermentation

[0162] Prepare production medium (peptone 0.5 g / L, yeast extract powder 0.5 g / L, brown sugar 50 g / L, peanut cake powder 2 g / L, CaCl2 250 mg / L, no pH adjustment), totaling 210 L, pre-loaded in a 300 L fermenter, sterilized at 121 ° C for 30 min, and inoculated after cooling.

[0163] 20L of seeds from the above seed tank were sent to a 300L fermentation tank through a pipeline. The tank temperature was adjusted to 30°C, the rotation speed was 180r / min, the initial ventilation volume was 40L / min, and the ventilation volume was increased to 80L / min after 24h. The fermentation was continued for 10-14d. After the fermentation was terminated, the purity was checked. The content of chlamydospores in the fermentation liquid was 1.04×10 5 -1.42×10 5 / mL, the spores are connected to the mycelium in the form of beads or exist alone. At the same time, compared with the dry solid fermentation preparation, the fermentation liquid contains some nematicidal secondary metabolites.

[0164] The fermentation liquid is aseptically packaged in a sterilized 50kg plastic barrel and stored at room temperature for no more than 7 days, at 4°C for no more than 30 days, or directly sent to the field for use. Large-scale fermentation is carried out in a larger fermentation tank according to the above method. This method mainly produces thick-walled spores and mycelium as well as metabolites with insect-resistant effects. Liquid fermentation is easy to control pollution, has a short fermentation time, can be mass-produced, is suitable for use while producing, and does not require drying procedures, thereby reducing costs.

[0165] The effect experiment of liquid fermentation preparation is as follows:

[0166] 1) Experiment on the control effect of liquid fermentation preparation on bitter gourd root knot nematode disease in greenhouse:

[0167] From March to May 2021, a field test was conducted at a grower (arch shed bitter melon) in a concentrated vegetable planting area. The total planting area of ​​bitter melon is 2.4 acres, with 40cm×10cm as one ridge, a total of 18 ridges as the experimental group, and the remaining ridges are all used as blank controls. The experimental group was divided into three groups, with three application rates of 10L / acre, 15L / acre, and 20L / acre, respectively. Each application rate used 6 ridges. According to the above application rate, the fermentation liquid was diluted 1:100 times when the bitter melon was planted for 18 days, and then the roots were irrigated. The blank control group did not receive any treatment. After 60 days, 20 plants were selected from each group in the experimental group and 20 plants were selected from the control group to investigate the disease index, the number of diseased plants, and the number of dead plants. The results showed that 7 diseased roots were found in the 20 blank control groups, of which 5 were at grade 1 disease and 2 were at grade 2 disease, and the root knot index of the control group was 11.25%; 2 grade 1 diseased plants were found in the 10L / mu test group among the 20 plants, and the root knot index was 2.5%; 1 grade 1 diseased plant was found in the 15L / mu test group, and the root knot index was 1.25%; no diseased plants were found in the 20L / mu test group, and the root knot index was 0; the relative prevention effect was calculated according to the method of the aforementioned embodiment 3, and is shown in Table 11.

[0168] Table 11 Bitter melon control effect

[0169] Application rate 10L / mu 15L / mu 20L / mu Relative efficacy (%) 77.8 88.6 100

[0170] The results showed that, at the above application rate, the control effect of NPS044 fungal fermentation liquid on bitter melon root-knot nematodes was 77.8%-100%. At the same time, as the amount per mu increased, the relative control also increased. When it reached 20L / mu, the control effect reached 100%.

[0171] 2) Experiment on the control effect of liquid fermentation preparation on root knot nematode disease of greenhouse ginger:

[0172] The aforementioned liquid fermentation preparation was used to conduct a control test in the ginger arch shed in Shouguang City, Weifang City, Shandong Province. First, the ginger buds were soaked in the liquid fermentation preparation of NPS044 strain for 5 minutes, and then the planting began. About 2 months after planting, the test group was divided into three groups. According to the three application rates of 10L / mu, 15L / mu, and 20L / mu, the liquid fermentation preparation was diluted 1:100 for root irrigation, and the blank control group was not treated with any treatment. The total test area is 5 mu, with one mu of each of the above three application rates in the test group and 2 mu of the blank control group. The control effect was calculated by counting the number of diseased ginger (scaly ginger) at harvest. The test results showed that the ratio of the yield of ginger in the 10L / mu group to the total yield of ginger was 123:6060, accounting for 2.03%; the ratio of the yield of ginger in the 15L / mu group to the total yield of ginger was 33.5:6321.5, accounting for 0.53%; the ratio of the yield of ginger in the 20L / mu group to the total yield of ginger was 1.5:6572.5, accounting for 0.02%; the ratio of the yield of ginger in the blank control group to the total yield of ginger was 382:5931, accounting for 6.44%. The above results show that the liquid fermentation preparation of NPS044 strain can promote growth and development, increase ginger yield and has a significant preventive and therapeutic effect on root-knot nematode disease.

[0173] The above embodiments are only used to help understand the method and core idea of ​​the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principles of the present invention, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. Arthrobotrys flagrans NPS044 strain, characterized in that The deposit number of the Arthrobotrys flagrans NPS044 strain is CCTCC M20231144.

2. The Arthrospora nematophila NPS044 strain according to claim 1, characterized in that The ITS sequence of the Arthrospora nematophila strain NPS044 is shown in SEQ ID No.1, and the RPB2 sequence is shown in SEQ ID No.

2.

3. A biocontrol agent, characterized in that: The biocontrol agent contains at least one of the Arthrospora nematophila NPS044 strain according to claim 1, its chlamydospores, its secondary metabolites and its culture.

4. The biocontrol agent according to claim 3, characterized in that The formulation of the biocontrol agent includes at least one of a suspension, a wettable powder and a liquid fermentation preparation.

5. The biocontrol agent according to claim 4, characterized in that The preparation method of the suspension comprises: inoculating the Arthrospora nematophila NPS044 strain on a PDA culture medium or corn kernels, washing off the chlamydospores or culture, and obtaining a spore suspension or a bacterial suspension.

6. The biocontrol agent according to claim 4, characterized in that: The wettable powder comprises: 70-90% of the mother drug, 5-10% of diatomaceous earth, 3-6% of carboxymethyl cellulose, 3-6% of polyvinyl alcohol, and 2-4% of pull-opening powder; the mother drug is the spore powder of the nematophila arthrospora NPS044 strain, and the chlamydospore content in the wettable powder is 2.4×10 6 -9.6×10 7 Pieces / g.

7. The biocontrol agent according to claim 5, characterized in that: The preparation method of the liquid fermentation preparation comprises: inoculating the bacterial suspension into a culture medium to obtain seeds, and inoculating the seeds into a fermentation tank to obtain the liquid fermentation preparation; the liquid fermentation preparation contains secondary metabolites of the nematophila arthrospora NPS044 strain, and the content of chlamydospores in the liquid fermentation preparation is 1.04×10 5 -1.42×10 5 Pieces / mL.

8. Use of the Arthrospora nematophila NPS044 strain according to claim 1 or 2 or the biological control preparation according to any one of claims 3 to 7 in biological control of nematode diseases.

9. The use according to claim 8, characterized in that: The nematodes include Caenorhabditis elegans and plant root-knot nematodes, and the plant root-knot nematodes include at least one of tomato root-knot nematodes, melon root-knot nematodes, bitter melon root-knot nematodes and ginger root-knot nematodes.

10. Use of the Arthrospora nematophila NPS044 strain according to claim 1 or 2 or the biocontrol agent according to any one of claims 3 to 7 in the preparation of a plant growth promoter, wherein the plant comprises at least one of tomato and ginger.

Images