A method for fermenting multiple short and medium chain fatty acids and preparing bacterial agents

Abstract

The present invention discloses a method for fermenting and preparing a multi-component short- and medium-chain fatty acids and a bacterial agent, and belongs to the technical field of brewing microorganisms. The present invention utilizes Bacillus lactis and Lithomonas sulfophilus to co-ferment and prepare a functional bacterial liquid, which can improve the production of caproic acid while also improving the biomass of the two microorganisms, and can also produce valeric acid. When the "simplified bacterial community" obtained by screening the caproic acid-producing functional simplified bacterial community screening method of the present invention is used to prepare a functional bacterial liquid, the caproic acid production is high and the butyric acid production is low, and at the same time, large-scale continuous production operation can be achieved through semi-continuous feeding operation, and the production efficiency is significantly better than the batch fermentation method. After the composite short- and medium-chain fatty acids produced by the technology of the present invention are enzymatically esterified, composite esters containing multiple esters can be obtained through conventional distillation extraction, which can be used for flavoring food and beverage wine. In addition, the bacterial agent obtained in the fermentation process of short- and medium-chain fatty acids can be used for cellar mud production and cellar maintenance.

Description

Technical Field

[0001] The invention discloses a method for fermenting multiple short-chain and medium-chain fatty acids and preparing a bacterial agent, and belongs to the technical field of brewing microorganisms. Background Art

[0002] The food industry represented by brewing produces a large amount of low pH (pH = 3.0 ~ 4.0) and high COD wastewater (COD up to 150g / L) with organic acids represented by lactic acid and mixed with ethanol as the main biochemical components. It is difficult to treat such high-concentration food industry wastewater by traditional anaerobic digestion and methane production, and it has the defects of high equipment investment and high operating costs. In recent years, the carbon chain extension process of medium-chain fatty acids using lactic acid as an electron donor has gradually received attention, but there are still challenges such as slow growth of naturally enriched bacteria and difficulty in applying pure culture strains to raw fermentation of unsterilized wastewater. In the prior art, although the continuous fermentation treatment of yellow water (final production of caproic acid> 8g / L) is achieved by the "feed-discharge" method of the fermentation system, the ability to convert yellow water into high value is still relatively low (recorded in the patent with publication number CN113322205B).

[0003] Caproicibacterium lactatifermentans and Petrimonas sulfuriphila are the dominant species of Clostridia and Bacteroidetes in the pit mud, respectively (relative abundance ranges are 1.4% to 35.5% and 5.99% to 16.69%, respectively). The enrichment time of the two microorganisms is long and the culture is difficult. In addition, Caproicibacterium lactatifermentans is a small genome microorganism (genome size ≤ 2Mb). According to the genome annotation results, it is speculated that it is a multi-amino acid nutrient-deficient microorganism. Its pure strain has too high a nutritional demand during the culture process, and the strain purification is difficult. According to the survival characteristics of Caproicibacterium lactatifermentans in the screening process, such as the association with other microorganisms (such as Clostridium butyricum and Clostridium tyrobutyricum) and the long-term coexistence with Petrimonas sulfuriphila and old cellar mud, the use of simplified bacterial flora in actual fermentation is an important strategy to expand the application range of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila and establish a new type of high-value yellow water conversion. In addition, the bacterial mud obtained by fermentation can also be used in the cellar mud production and cellar maintenance of liquor brewing. Therefore, the fermentation efficiency of short- and medium-chain fatty acids and the preparation efficiency of bacterial agents are improved through the interaction between microorganisms, which has important application value for the fermentation preparation of short- and medium-chain fatty acids and the downstream application of bacterial agents (such as liquor production). Summary of the invention

[0004] The present invention provides a fermentation technology for preparing multiple short- and medium-chain fatty acids, which provides an important theoretical basis and fermentation process reference for refining short- and medium-chain fatty acids from organic waste rich in high-concentration substrates (such as lactic acid), realizing high-value carbon recovery from food industry wastewater and recycling of fermentation by-products.

[0005] The present invention provides a strain of Caproicibacterium lactatifermentans, which is deposited in Guangdong Microbiological Culture Collection Center with a deposit number of GDMCC No: 64722 and a deposit date of June 4, 2024.

[0006] The present invention also provides a microbial preparation, which contains Caproicibacterium lactatifermentans LBM23001.

[0007] In one embodiment of the present invention, the microbial preparation is a liquid bacterial preparation or a solid bacterial preparation containing living cells of Caproicibacterium lactatifermentans LBM23001, or a fermentation broth containing Caproicibacterium lactatifermentans LBM23001.

[0008] In one embodiment of the present invention, the living cells of Caproicibacterium lactatifermentans LBM23001 are freeze-dried dried cells of Caproicibacterium lactatifermentans LBM23001 or immobilized cells of Caproicibacterium lactatifermentans LBM23001.

[0009] In one embodiment of the present invention, the microbial preparation further contains Petrimonassulfuriphila LBM11005; the Caproicibacterium lactatifermentans LBM23001 and Petrimonassulfuriphila LBM11001 are prepared according to the OD of the two microbial seed liquids. 600 =1:1 added, two kinds of microbial seed liquid OD 600 At least above 0.5.

[0010] The invention also provides a method for preparing seed liquid of Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005.

[0011] In one embodiment of the present invention, the seed culture medium for preparing Caproicibacterium lactatifermentans LBM23001 is mCGM culture medium, each 1L containing: lactic acid / glucose 20g, sodium acetate 5g, Yeast extract 10g, Tryptone 10g, NH4SO4 2g, K2HPO4 1g, KH2PO4 0.5g, MgSO4·7H2O 0.5g, FeSO4·7H2O 0.015g, MnSO4·H2O 0.01g, CaCl2 0.01g, ZnSO4 0.002g, CoCl2 0.002g. The pH is adjusted to 5.5 and sterilized at 115°C for 30min.

[0012] In one embodiment of the present invention, the seed culture medium for preparing Petrimonas sulfuriphila LBM11005 is PY culture medium, each 1L containing Yeast extract 10g, Tryptone 5g, Peptone 5g, salt solution 40mL, 0.1% resazurin 400μL·L -1 , 20 mL of 2.5% cysteine ​​solution (sterilized by membrane), 10 mL of hemin solution (sterilized separately), and 200 μL of vitamin K1 solution (sterilized by membrane). Before sterilization, mix the culture medium components except cysteine ​​solution, hemin solution, and vitamin K1, adjust the pH to 7.4±0.2, and sterilize at 115℃ for 30 minutes. After sterilization, add the remaining solution to the culture medium in proportion.

[0013] In one embodiment of the present invention, the salt solution components contained in 1L of the PY medium are NaHCO3 10g, NaCl2 5g, K2HPO4 1g, KH2PO4 1g, MgSO4·7H2O 1g, and CaCl2 0.2g.

[0014] In one embodiment of the present invention, 1L of PY culture medium contains 0.05g of hemin, which is dissolved by dissolving 0.05g of hemin in 0.01mol / L of sodium hydroxide and sterilizing by high pressure at 121°C for 20min.

[0015] In one embodiment of the present invention, the PY culture medium 1L contains 100 μL of vitamin K1 solution and 20 mL of 95% ethanol, which is sterilized by passing through an organic membrane.

[0016] In one embodiment of the present invention, the method is to inoculate the two microorganisms in the logarithmic phase in an equal proportion of 10% (v / v) of the fermentation volume into anaerobic MGF culture medium or 50% diluted concentration anaerobic yellow water for fermentation of polyvalent short and medium chain fatty acids.

[0017] In one embodiment of the present invention, the MGF medium contains 20 g of glucose or lactic acid, 2 g of sodium acetate, 10 g of Yeast extract, 10 g of Tryptone, 0.5 g of NH4Cl, 0.5 g of MgCl2·6H2O, 0.2 g of CaCl2, 500 μL of metal element mother solution, 5 mL of phosphate mother solution, 5 mL of GYTS mother solution, 350 μL of trace element mother solution, 400 μL of 0.1% resazurin, 25 mL of 7% NaHCO3 solution (sterilized by membrane), 5 mL of 2.5% cysteine ​​solution (sterilized by membrane), 100 μL of vitamin solution A (sterilized by membrane), and 100 μL of vitamin solution B (sterilized by membrane). Before sterilization, the culture medium components except the NaHCO3 solution, cysteine ​​solution, vitamin solution A and vitamin solution B are mixed, and the pH is adjusted to 7.4±0.2 and then sterilized by high pressure (121°C, 20 min). After sterilization, add the remaining solution to the culture medium in proportion.

[0018] In one embodiment of the present invention, the MGF culture medium contains metal element mother solution of ZnSO4·7H2O 0.1g, MnCl2·4H2O 0.03g, H3BO3 0.3g, CoCl2·6H2O 0.2g, CaCl2·2H2O 0.01g, NiCl2·6H2O 0.02g, Na2MoO4·2H2O 0.03g, and FeCl2·4H2O 1.5g per 1L.

[0019] In one embodiment of the present invention, the MGF culture medium contains 6 g of K2HPO4 and 5 g of NaH2PO4·H2O as phosphate mother solution per 1 L.

[0020] In one embodiment of the present invention, the yellow water is a production by-product of the fermentation process of Luzhou-flavor liquor, and its biochemical components mainly include organic acids represented by lactic acid, ethanol and other trace flavor substances. The specific physical and chemical properties of the yellow water are: pH = 3.35, lactic acid 64.21~79.34g / L, acetic acid 2.55~8.13g / L, ethanol 36.56~53.99g / L.

[0021] In one embodiment of the present invention, the yellow water is treated as follows: in an anaerobic chamber, oxygen-free water is added at a ratio of 50% (v / v) for dilution, and the pH of the diluted yellow water is adjusted to about 7.0 using 8M sodium hydroxide.

[0022] In one embodiment of the present invention, the Petrimonas sulfuriphila LBM11005 has a deposit number of GDMCC NO: 61648, which has been disclosed in a patent application document with a publication number of CN114350568A.

[0023] In one embodiment of the present invention, the co-cultivation system is a raw material oxygen-free yellow water system with a working concentration of glucose, lactic acid carbon source or 50%.

[0024] In one embodiment of the present invention, the concentrations of glucose and lactic acid are both 20 g / L.

[0025] In one embodiment of the present invention, the fermentation conditions are: temperature 37° C., anaerobic fermentation 5 days, and initial fermentation pH of about 7.0.

[0026] In one embodiment of the present invention, the polyvalent short and medium chain fatty acids are acetic acid, propionic acid, butyric acid, valeric acid and caproic acid.

[0027] The present invention also provides a method for preparing polybasic short and medium-chain fatty acids by taking lactic acid or glucose as a carbon source and promoting the caproic acid yield and the biomass of microorganisms in a fermentation system. The method comprises the following steps: co-fermenting and culturing Caproicibacterium lactatifermentans LBM23001, or Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005 under the condition that lactic acid or glucose is used as a carbon source.

[0028] In one embodiment of the present invention, the Caproicibacterium lactatifermentansLBM23001 and Petrimonas sulfuriphila LBM11005 are prepared according to the OD of the two microbial seed liquids. 600 =1:1 added, two kinds of microbial seed liquid OD 600 At least above 0.5.

[0029] In one embodiment of the present invention, the polyvalent short and medium chain fatty acids are acetic acid, propionic acid, butyric acid, valeric acid and caproic acid.

[0030] In one embodiment of the present invention, the concentrations of glucose and lactic acid are both 20 g / L.

[0031] In one embodiment of the present invention, the fermentation conditions are: temperature 37° C., anaerobic fermentation 5 days, and initial fermentation pH of about 7.0.

[0032] The present invention also provides a method for preparing multiple short-chain and medium-chain fatty acids by taking yellow water as a substrate, promoting the growth of Caproicibacterium lactatifermentans LBM23001 and the production of short-chain fatty acids and increasing the biomass of microorganisms in the yellow water matrix. The method is characterized in that Petrimonas sulfuriphila LBM11005, or Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005, are co-fermented and cultured in the yellow water matrix.

[0033] In one embodiment of the present invention, the Caproicibacterium lactatifermentansLBM23001 and Petrimonas sulfuriphilaLBM11005 are prepared according to the OD of the two microbial seed liquids. 600 =1:1 added, two kinds of microbial seed liquid OD 600 At least above 0.5.

[0034] In one embodiment of the present invention, the polyvalent short and medium chain fatty acids are acetic acid, propionic acid, butyric acid, valeric acid and caproic acid.

[0035] The present invention also provides the use of Petrimonas sulfuriphila LBM11005 in the co-culture system to promote the production of caproicibacteriumlactatifermentans LBM23001 hexanoic acid or valeric acid in a fermentation system under the conditions of lactic acid carbon source and / or raw yellow water matrix.

[0036] In one embodiment of the present invention, the lactic acid concentration is 20 g / L, and the working concentration of raw yellow water is 50%.

[0037] In one embodiment of the present invention, the fermentation conditions are: temperature 37° C., anaerobic fermentation 5 days, and initial fermentation pH of about 7.0.

[0038] In one embodiment of the present invention, the main performance is that Petrimonas sulfuriphila LBM11005 can promote the increase of hexanoic acid or valeric acid production of Caproicibacterium lactatifermentans LBM23001.

[0039] The present invention also provides a method for preparing a microbial agent containing the two microorganisms by co-culturing the Petrimonas sulfuriphila LBM11005 and the Caproicibacterium lactatifermentans LBM23001.

[0040] In one embodiment of the present invention, the Caproicibacterium lactatifermentansLBM23001 and Petrimonas sulfuriphila LBM11005 are prepared according to the OD of the two microbial seed liquids. 600 =1:1 added, two kinds of microbial seed liquid OD 600 At least above 0.5.

[0041] In one embodiment of the present invention, the bacterial agent is prepared by co-fermenting the above two microorganisms in the presence of lactic acid carbon source or 50% dilution concentration of yellow water.

[0042] In one embodiment of the present invention, the preparation method of the bacterial agent is:

[0043] (1) Preparation of seed solution of Petrimonas sulfuriphila LBM11005: Petrimonas sulfuriphila LBM11005 was inoculated into PY medium at a ratio of 10% (v / v), and anaerobically fermented at 37°C for 48-60h to obtain an OD 600 The seed solution is 0.3-0.5;

[0044] (2) Preparation of Caproicibacterium lactatifermentans LBM23001 seed solution: Caproicibacterium lactatifermentans LBM23001 was inoculated into mCGM medium at a ratio of 10% (v / v), and anaerobically fermented at 37°C for 48-60 h to obtain an OD 600 The seed solution is 0.5-0.6;

[0045] (3) Co-fermentation to prepare bacterial agent: The seed liquid of the two microorganisms was inoculated at an inoculation ratio of 10% (v / v) into anaerobic MGF medium (lactic acid carbon source) with an initial pH of about 7.0 or anaerobic yellow water with a dilution of 50% and fermented at 37°C for 5 days.

[0046] The present invention also provides a fermentation method for producing odd-numbered carbon fatty acids by co-culturing the two microorganisms under the conditions of glucose and lactic acid carbon sources or 50% dilution yellow water.

[0047] In one embodiment of the present invention, the concentrations of glucose and lactic acid are both 20 g / L, and the yellow water dilution is 50%.

[0048] In one embodiment of the present invention, the fermentation conditions are: temperature 37° C., anaerobic fermentation 5 days, and initial fermentation pH of about 7.0.

[0049] In one embodiment of the present invention, the main performance is that co-culture of Petrimonassulfuriphila LBM11005 and Caproicibacterium lactatifermentans LBM23001 can produce odd-numbered carbon fatty acids.

[0050] In one embodiment of the present invention, the odd-numbered fatty acid is valeric acid.

[0051] The present invention also provides a method for obtaining a caproic acid-producing bacterial group SimpCom1 containing Caproicibacterium lactatifermentans.

[0052] In one embodiment of the present invention, the caproic acid-producing simplified bacterial population is screened using the "enrichment-plating" method. The specific implementation is as follows:

[0053] The old pit mud was used as the source of bacterial flora screening. The old pit mud was inoculated into MM medium with an initial pH of 5.5 and 20% yellow water added by volume, with a mass volume fraction (pit mud mass: fermentation system volume) of 5%. The microorganisms in the pit mud were enriched and cultured at 37°C for 7 days. Then, the enriched bacterial liquid was cultured with lactic acid mCGM medium at 10 -3 , 10 -4 and 10 -5 The dilution was diluted, 100 μl of bacterial solution was spread on the mCGM agar plate, and cultured in a 37°C anaerobic workstation for 3 days. Then a single colony was picked and inoculated into the mCGM liquid medium containing lactic acid carbon source for 7 days. The production of caproic acid and butyric acid in the culture supernatant was determined by gas chromatography, and the bacterial solution with caproic acid concentration>1g / L was retained, and the bacterial solution was expanded and maintained.

[0054] The present invention also provides a method for optimizing the conditions for producing caproic acid by co-fermentation of a caproic acid-producing bacterial group SimpCom1 containing Caproicibacterium lactatifermentans.

[0055] In one embodiment, the yellow water does not need to be sterilized and can be used directly after the pH is adjusted to 5 to 6 after deoxygenation.

[0056] In one embodiment, the bacterial flora seed solution is prepared by:

[0057] The bacterial community was inoculated at an inoculation ratio of 10% into an anaerobic mCGM medium with a pH of 5.5 (the carbon sources were glucose and lactic acid, with concentrations of 4 g / L and 20 g / L, respectively) and fermented for about 48 hours.

[0058] In one embodiment, the caproic acid producing bacteria are subjected to raw fermentation with yellow water having an initial pH of 5.5 and a dilution of 50% (V / V).

[0059] In one embodiment, when investigating the effect of pH after feeding on the caproic acid production of the bacterial community, HCl was used to adjust the pH to different concentrations (pH 5.5, 6.0, 6.5, 7.5) and the substrate concentration was uniformly adjusted to 40 g / L before fermentation.

[0060] In one embodiment, the fermentation conditions of the caproic acid-producing fermentation bacteria containing Caproicibacterium lactatifermentans are further optimized by fermentation in a 3L fermenter, and the control conditions are as follows:

[0061] After the bacterial flora was cultured to the logarithmic phase in an anaerobic workstation, it was transferred to a 3L fermenter at an inoculation ratio of 10%. The fermentation temperature was controlled at 37°C, and the pH value was controlled and adjusted using 8M HCl. The lactic acid utilization and the production of volatile fatty acids (acetic acid, butyric acid, caproic acid) in the fermentation process were monitored after each sampling. When the lactic acid consumption was close to complete, the fermentation broth with a volume fraction of about 50% of the fermentation system was released, and an equal volume of 50% diluted yellow water was added at the same time. The speed was set at 200r / min, and the positive pressure in the tank was maintained with N2 during the fermentation process.

[0062] The present invention also provides an optimized method for preparing a bacterial agent of hexanoic acid-producing bacteria.

[0063] In one embodiment, the fermentation is performed after adjusting the pH to different concentrations (pH 5.5, 6.0, 6.5, 7.5) using HCl and uniformly adjusting the substrate concentration to 40 g / L.

[0064] In one embodiment, the optimization result of the bacterial agent preparation is mainly manifested in that the biomass reaches a maximum at pH 7.5.

[0065] The present invention also provides a method for preparing a composite esterification product by esterifying short-chain and medium-chain fatty acids produced by fermentation of caproic acid-producing bacteria.

[0066] In one embodiment of the present invention, the sources of the lipase include Rhizopus chinensis, Candida antarctic, Candida rugosa, Rhizomucor miehei, Thermomyces lanuginosus, Penicillium sp., and Kluyveromyces marxianus.

[0067] In one embodiment of the present invention, the fermentation broth is esterified by adding ethanol to the fermentation broth to a final concentration of 30%, adjusting the pH to 4.5 using HCl solution, adding 0.5 g / 100 mL of Rhizopus chinensis lipase, and shaking the reaction at 30° C. for 4 hours.

[0068] The co-fermentation of Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005 under the conditions of lactic acid carbon source and / or yellow water substrate is used to increase the caproic acid content in the fermentation system and the biomass of the two microorganisms.

[0069] The invention discloses an application of co-fermentation of Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005 in glucose, lactic acid carbon source and / or yellow water substrate to produce odd-numbered carbon fatty acids in a fermentation system.

[0070] The optimum pH value for efficient fermentation of yellow water to produce caproic acid by Caproicibacterium lactatifermentans LBM23001 is 6.0-6.5, and the caproic acid yield is >20 g / L.

[0071] The optimum pH value of the microbial agent contained in the yellow water efficiently fermented by the SimpCom1 bacterial community is 6.5-7.0. When the bacterial community is co-fermented with the Petrimonas sulfuriphila LBM11005, the system's hexanoic acid production is promoted.

[0072] The yellow water functional bacterial liquid fermented by Caproicibacterium lactatifermentans LBM23001 and the composite bacterial liquid produced by co-fermentation of Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005 can efficiently prepare a composite acid bacterial liquid rich in butyric acid, hexanoic acid, propionic acid, valeric acid, heptanoic acid, etc., and can also prepare a multi-component composite esterification product through an "esterification-distillation" method. The esterification reaction temperature is 20-35° C., the reaction time is 0.5h-10h, and the amount of lipase used is 0.05%-1%.

[0073] In one embodiment, the method for obtaining ester substances after the esterification reaction is as follows: after the esterification reaction is completed, ethanol is added to a final concentration of 50% (assuming that no ethanol is consumed in the esterification reaction), boiled at 120V, adjusted the voltage to 90V for distillation, and collected the distillate at regular intervals, and distilled until the alcohol content is detected to be <65% (about 90min). It is expected that 300mL of distillate will be produced, and 180mL of fermentation liquid will remain, and the concentrations of fatty acids and esters in the fermentation liquid will be detected.

[0074] Beneficial Effects

[0075] (1) The method of the present invention can realize the refining of short and medium chain fatty acids under high concentration lactic acid conditions (such as yellow water). Compared with the single culture system of the above two microorganisms, the co-fermentation system of Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005 produces enhanced types of beneficial flavor substances (such as valeric acid). Compared with the single culture system of Caproicibacterium lactatifermentans LBM23001, the co-fermentation system increases the caproic acid production by about 18% to 30% under lactic acid conditions, and the biomass of the two microorganisms increases by about 36.07% to 92% and 52% to 90.75%, respectively.

[0076] (2) When the bacterial community containing Caproicibacterium lactatifermentans is fermented under yellow water conditions, it can be carried out in a semi-open operating environment, with low fermentation cost, convenient operation, good continuity, and the yellow water used does not need to be sterilized, and can be used only by deoxygenation and pH adjustment, which reduces the difficulty of operation and can obtain a higher concentration of fermentation products (caproic acid concentration>20g / L). By adjusting the pH after feeding, the abundance of Caproicibacterium lactatifermentans in the fermentation system can be increased, providing a theoretical basis for preparing functional bacterial mud rich in Caproicibacterium lactatifermentans. The cellar mud functional bacterial community obtained by this method can be used in the cultivation process of artificial cellar mud, and can also be used in the daily maintenance process of cellar mud to increase the main functional bacterial community producing caproic acid in the cellar, promote the aging of cellar mud, and prevent the cellar mud from hardening and aging.

[0077] (3) The fermentation products of high-concentration polyshort- and medium-chain fatty acids can be prepared and obtained into composite esterification products after reasonable esterification and distillation, which further improves the degree of high-value conversion of high-concentration wastewater rich in lactic acid.

[0078] (4) The co-fermentation method of the present invention can increase the types of odd-carbon short and medium-chain fatty acids including valeric acid in the fermentation system in the glucose, lactic acid and yellow water matrix, provide precursor substances for the synthesis of ester flavor compounds such as ethyl valerate, and has the application prospect of synergistically producing flavor substances with caproic acid bacteria, thereby improving the flavor quality of liquor.

[0079] (5) When Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005 provided by the present invention are co-cultured in a matrix rich in lactic acid, the utilization efficiency of lactic acid in the co-fermentation system can be improved, and the production of caproic acid can be increased, providing an important theoretical basis for low-cost and high-value carbon recovery of wastewater rich in lactic acid matrix.

[0080] (6) The acid-producing bacterial community containing Caproicibacterium lactatifermentans provided by the present invention has the ability to efficiently produce caproic acid at pH 6.0-6.5, with a yield of >20 g / L.

[0081] (7) The present invention also provides two methods for preparing a bacterial agent rich in Caproicibacterium lactatifermentans LBM23001: first, when Caproicibacterium lactatifermentans LBM23001 and Petrimonas sulfuriphila LBM11005 are co-cultured in a matrix rich in lactic acid, the absolute biomass of the two microorganisms is increased; second, the acid-producing bacterial community containing Caproicibacterium lactatifermentans has a maximum biomass at pH 6.5-7.0. The above two methods have important application values ​​in improving the quality of cellar mud and making artificial cellar mud.

[0082] Biomaterial Deposit

[0083] A strain of Caproicibacterium lactatifermentans LBM23001, with a taxonomic name of Caproicibacterium lactatifermentans, was deposited in Guangdong Provincial Microbiological Culture Collection on June 4, 2024, with a deposit number of GDMCC No: 64722, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] Figure 1 :Changes in absolute cell numbers of pure culture and co-culture of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila under lactic acid carbon source.

[0085] Figure 2 :Changes in absolute cell numbers of pure culture and co-culture of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila under yellow water conditions.

[0086] Figure 3 :The influence of pH control method on bacterial community structure during fermentation process; A, relative quantification; B, absolute quantification. DETAILED DESCRIPTION

[0087] The Petrimonas sulfuriphila LBM11005 involved in the following examples is deposited with GDMCC NO.61648, which is recorded in the Chinese invention patent with publication number CN114350568B.

[0088] The physical and chemical properties of the yellow water involved in the following examples are pH 3.35-3.5, lactic acid 64.21-79.34 g·L -1 , acetic acid 2.55~8.13g·L -1 , ethanol 36.56~53.99g·L -1 .

[0089] The culture medium involved in the following examples is as follows:

[0090] 1L mCGM medium contains: lactic acid / glucose 20g, sodium acetate 5g, yeast extract 10g, tryptone 10g, NH4SO4 2g, K2HPO4 1g, KH2PO4 0.5g, MgSO4·7H2O 0.5g, FeSO4·7H2O 0.015g, Mn SO4·H2O 0.01g, CaCl2 0.01g, ZnSO4 0.002g, CoCl2 0.002g. Adjust pH to 5.5 and sterilize at 115℃ for 30min.

[0091] 1L PY medium contains: 10g yeast extract, 5g tryptone, 5g peptone, 40mL salt solution, 400μL 0.1% resazurin -1 , 20 mL of 2.5% cysteine ​​solution (sterilized by membrane), 10 mL of hemin solution (sterilized separately), and 200 μL of vitamin K1 solution (sterilized by membrane). Before sterilization, mix the culture medium components except cysteine ​​solution, hemin solution, and vitamin K1, adjust the pH to 7.4±0.2, and sterilize at 115℃ for 30 minutes. After sterilization, add the remaining solution to the culture medium in proportion.

[0092] The salt solution components contained in 1L of culture medium are: NaHCO3 10g, NaCl2 5g, K2HPO4 1g, KH2PO4 1g, MgSO4·7H2O 1g, CaCl2 0.2g.

[0093] Hemin solution: Dissolve 0.05 g of hemin in 0.01 mol / L sodium hydroxide and sterilize at 121°C for 20 min.

[0094] Vitamin K1 solution: Add 20 mL of 95% ethanol to 100 μL of vitamin K1 and sterilize by passing through an organic membrane.

[0095] 1L MGF medium: 20g glucose or lactic acid, 2g sodium acetate, 10g Yeast extract, 10g Tryptone, 0.5g NH4Cl, 0.5g MgCl2·6H2O, 0.2g CaCl2, 500μL metal element stock solution, 5mL phosphate stock solution, 5mL GYTS stock solution, 350μL trace element stock solution, 400μL 0.1% resazurin, 25mL 7% NaHCO3 solution (sterilized by filter), 5mL 2.5% cysteine ​​solution (sterilized by filter), 100μL vitamin solution A (sterilized by filter), 100μL vitamin solution B (sterilized by filter). Before sterilization, mix the medium components except NaHCO3 solution, cysteine ​​solution, vitamin solution A and vitamin solution B, adjust the pH to 7.4±0.2 and sterilize by high pressure (121℃, 20min). The remaining solutions were added after the medium was sterilized.

[0096] Metal element mother solution (1L): ZnSO4·7H2O 0.1g, MnCl2·4H2O 0.03g, H3BO3 0.3g, CoCl2·6H2O 0.2g, CaCl2·2H2O 0.01g, NiCl2·6H2O 0.02g, Na2MoO4·2H2O 0.03g, FeCl2·4H2O1.5g.

[0097] Phosphate mother solution (1L): K2HPO4 6g, NaH2PO4·H2O 5g.

[0098] GYTS mother liquor (1L): NaCl 5g, MgCl2·6H2O 4g, CaCl2 0.75g, NH4Cl 2.5g, KH2PO4 2g, KCl 5g.

[0099] 1L MM medium: lactic acid 10g, yeast powder 1g, sodium acetate 5g, (NH4)2SO4 2g, MgSO4·7H2O 0.2g, NaH2PO4·2H2O 0.5g, CaCl2·2H2O 0.1g, K2HPO4 0.5g, trace elements 300μL. Trace element composition (mg / L): FeSO4·7H2O 2000, ZnCl2 50, MnCl2·4H2O 500, CuCl2·H2O 30, (NH4)6Mo7O 24 ·4H2O50, CoCl2·6H2O 2000, NiCl2·6H2O 50, Na2SeO3·5H2O 100, H3BO3 50, EDTA 1000, HCl (ω=36%) 1ml.

[0100] The detection methods involved in the following embodiments are as follows:

[0101] Detection method of volatile organic acids:

[0102] Sample processing method: add 50 μL of t-valeric acid internal standard [final concentration 12.5 g·L -1 , containing a final concentration of 5% (m / V) concentrated hydrochloric acid] in 200 μL of fermentation supernatant (pre-filtered with a 0.22 μm aqueous filter membrane), vortexed and 200 μL of supernatant was analyzed using a gas chromatograph (Agilent 7890B). The chromatographic column model was CP-WAX 57CB (Agilent), and the heating program was: initial temperature 60°C, maintained for 0.5 min, and then at 20°C·min -1 The temperature was raised to 180°C and maintained for 5.5 min. The injection volume was 1 μL, the split ratio was 5:1, the injection port temperature was 220°C, and the hydrogen ion flame detector temperature was 220°C.

[0103] The detection methods of lactate and glucose are as follows:

[0104] The lactic acid and glucose in the fermentation system were analyzed by high performance liquid chromatography (Agilent 1260 InfinityⅡ, USA), and the chromatographic column was Aminex HPX-87H (Bio-Rad). 500 μL of fermentation supernatant was filtered through a 0.22 μm aqueous filter membrane and loaded with the mobile phase of 5 mmol / L -1 Dilute sulfuric acid solution, flow rate 0.5 mL min -1 , column temperature 60°C, and a differential detector was used to detect the concentrations of lactic acid and glucose.

[0105] Detection method of volatile esters

[0106] The gas chromatograph Agilent GC-7890B was used for determination. Wine sample processing method: take 5mL of wine sample, add 50μL of three internal standard mixed solution (tert-amyl alcohol, n-amyl acetate, 2-ethylbutyric acid), vortex mix and then inject for analysis; fermentation broth pretreatment method: fermentation broth is centrifuged at 12000r / min for 5min, take 5ml of supernatant, add 5ml of anhydrous ethanol, vortex mix and observe precipitation, centrifuge at 12000r / min for 5min, pass the supernatant through a membrane (0.22um), take 5mL of the supernatant after passing through the membrane, add 50μL of three internal standard mixed solution (tert-amyl alcohol, n-amyl acetate, 2-ethylbutyric acid), vortex mix and then inject for analysis. Gas chromatography conditions: the chromatographic column is a CP-wax chromatographic column (50m×0.25μm×0.2μm). Injection volume 1 μL, split ratio, 30:1; injector temperature 230°C, detector temperature 230°C; air flow 300 mL / min, carrier gas flow 1 mL / min, hydrogen flow 30 mL / min.

[0107] Detection methods for microbial changes during fermentation:

[0108] Before DNA extraction, internal standard bacteria were added to the samples to absolutely quantify the microbial community structure. The preparation, addition amount and absolute abundance calculation method of the internal standard bacteria (Clostridium acetobutylicum) were referred to the internal standard bacteria quantification method of Gu Yang et al. (Acta Microbiologica Sinica, 2021, 61: 3444-3457). Before DNA extraction, the concentration of 5.2×10 7 cells / mL was added with internal standard bacteria. The DNA extraction process was carried out according to the instructions of the Qiagen PowerSoil DNA extraction kit. After the extraction, the sample concentration was measured by NanoDrop8000 spectrophotometer and then stored at -80°C for use. The PCR amplification primers were 338F (5′-ACTCCTACGGGAGGCAGCAG-3′ (SEQ ID NO.3)) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′ (SEQ ID NO.4)), and the variable region of the bacterial 16S rRNA gene V3-V4 was amplified. The library construction and sequencing of the amplicon were completed on the Illumina Miseq PE250 sequencing platform.

[0109] The parameters of the old pit mud involved in the following embodiments are shown in Table 1:

[0110] Table 1: Parameters of old pit mud

[0111]

[0112] Example 1: Isolation and screening of Caproicibacterium lactatifermentans LBM23001. The specific steps are as follows:

[0113] 1. Isolation and identification of Caproicibacterium lactatifermentans LBM23001

[0114] (1) Enrichment culture: The "enrichment-plating" method was used for screening. Specifically, old cellar mud was used as the source of bacterial screening, and the old cellar mud was inoculated at an inoculation ratio of 5% (W / V) into MM medium with an initial pH of 5.5 and 20% (V / V) yellow water added. The microorganisms in the cellar mud were enriched and cultured at 37°C for 7 days. The supernatant of the enriched culture solution was measured by gas chromatography to determine the production of caproic acid and butyric acid, and the bacterial solution with a caproic acid concentration of >1g / L was retained.

[0115] (2) Isolation and screening: The enriched bacterial solution was cultured in lactic acid mCGM medium at 10 -3 , 10 -4 and 10 -5 The dilution was diluted, 100 μl of the bacterial solution was spread on the mCGM agar plate, and cultured in a 37°C anaerobic workstation for 3 days. Then a single colony was picked and inoculated into the mCGM liquid medium containing lactic acid carbon source for 7 days, and the bacterial solution was amplified and maintained. The types and concentrations of metabolites were determined by microscopic examination combined with Sanger sequencing and gas chromatography (GC-FID), and finally a strain with high hexanoic acid production was screened and named LBM23001.

[0116] 2. Species identification of Caproicibacterium lactatifermentans LBM23001

[0117] The extracted whole genome DNA was used as a PCR amplification template, and PCR amplification was performed with universal primers (27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1) and 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO.2)). The amplified product was sequenced by Sanger sequencing, and the obtained sequence was searched and compared with similarity in GenBank using BLAST. The results showed that the nucleic acid sequence identity of the LBM23001 strain and Caproicibacterium lactatifermentans was 99.81%, so LBM23001 and Caproicibacterium lactatifermentans were the same species, and LBM23001 was named Caproicibacterium lactatifermentans LBM23001. The strain was stored at -80°C for future use.

[0118] Example 2: Co-cultivation of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila with lactic acid as carbon source produces new odd-numbered fatty acids and promotes the production of caproic acid in the fermentation system and the biomass of the two microorganisms

[0119] Activation and preparation of seed solution: After taking out the glycerol tube from -80℃, quickly transfer it to the anaerobic workstation and inoculate it into 10ml of anaerobic seed medium at a 10% (v / v) inoculum. Caproicibacterium lactatifermentans LBM23001 was activated and passaged using mCGM medium, and Petrimonas sulfururiphila LBM11005 was activated using PY medium. After the two pure strains grew to the logarithmic phase, they were transferred to MGF medium and cultured for one generation as seed solution.

[0120] The specific steps are as follows:

[0121] 1. Preparation of seed solution

[0122] (1) Preparation of Caproicibacterium lactatifermentans seed solution: The Caproicibacterium lactatifermentans LBM23001 strain was inoculated into mCGM medium (the carbon source was lactic acid), and anaerobically cultured at 37°C for 48 hours to prepare an activation solution; the prepared activation solution was inoculated into 10 ml of mCGM medium (the carbon source was lactic acid) at an inoculum amount of 10% (v / v), and anaerobically cultured at 37°C for 24 hours to prepare a seed solution;

[0123] (2) Preparation of Petrimonas sulfuriphila seed solution: The Petrimonas sulfuriphila LBM11005 strain was inoculated into a PY medium, and anaerobically cultured at 37°C for 72 hours to prepare an activation solution; the prepared activation solution was inoculated into 10 ml of a PY medium at an inoculum amount of 10% (v / v), and cultured at 37°C for 48 hours to prepare an LBM11005 seed solution;

[0124] 2. Co-fermentation culture

[0125] The specific settings of the control group and experimental group are as follows:

[0126] Control group 1 (Caproicibacterium lactatifermentans): The seed solution of Caproicibacterium lactatifermentans LBM23001 obtained in step 1 (1) was inoculated at a ratio of 10% (v / v) into 100 ml of MGF medium supplemented with lactic acid for fermentation. The fermentation conditions were: anaerobic culture at 37°C for 5 days;

[0127] Control group 2 (Petrimonas sulfuriphila): The seed solution of the strain Petrimonas sulfuriphila LBM11005 obtained in step 1 (2) was inoculated at a 10% (v / v) inoculation ratio into 100 ml of MGF medium supplemented with lactic acid pre-packed for fermentation. The fermentation conditions were: anaerobic culture at 37°C for 5 days;

[0128] Co-culture group: The Caproicibacterium lactatifermentans seed solution obtained in the above step (1) and the Petrimonas sulfuriphila seed solution obtained in the step (2) were inoculated into 100 ml of MGF medium (carbon source is lactic acid) pre-packed at a bacterial concentration ratio of 1:1 and a total inoculation amount of 10% (v / v) for fermentation. The fermentation conditions were: anaerobic culture at 37°C for 5 days;

[0129] The results are shown in Table 2.

[0130] Table 2: Growth, pH, lactic acid utilization and accumulation of short- and medium-chain fatty acids at the end of fermentation in different groups when lactic acid was used as the carbon source

[0131]

[0132] As shown in Table 2, the two microorganisms were co-fermented using MGF medium supplemented with lactic acid, wherein Petrimonas sulfuriphila was a propionic acid-producing microorganism in the fermentation system, and Caproicibacterium lactatifermentans was a caproic acid-producing microorganism in the fermentation system. When the two microorganisms were co-cultured, a maximum of about 0.18 g / L of valeric acid was detected in the system (the control group did not produce valeric acid), and the caproic acid content of the co-culture group was increased by about 30% compared with the single culture group.

[0133] 3. Detection of microbial biomass

[0134] Method for detecting the absolute biomass of the microorganism: The primers are shown in Table 3.

[0135] Table 3: Primers required for absolute quantification of microorganisms

[0136] Primer name Primer sequence (5'→3') Primer usage LLJEOFCF_02107-F AACACGGGATGGATCGGTTT Forward primer for P.sulfuriphila detection LLJEOFCF_02107-R CTACCCAAAGGATTCGGCGT Reverse primer for P.sulfuriphila detection AGJBGG_00715-F CCGCACAATGTCCTGTACCT Forward primer for C. lactatifermentans detection AGJBGG_00715-R CTGCTGGGCGTCACTAAAGA Reverse primer for C. lactatifermentans detection

[0137] qPCR reaction system: 0.4 μL of upstream and downstream primers, 10 μL of SYBR Green Master Mix (Vazyme), 1 μL of template DNA, 8.2 μL of ddH2O. Amplification program: 95°C pre-denaturation for 30 s; 95°C denaturation for 10 s; 60°C annealing for 10 s; 72°C extension for 30 s (40 cycles). Melting curve program: After the amplification cycle, heat to 95°C for 15 s, cool to 72°C for 2 min, and then heat at 0.5°C·sec -1 Heat to 95℃ for 15s.

[0138] like Figure 1As shown in the results, the biomass of the two microorganisms was detected and it was found that the biomass of Caproicibacterium lactatifermentans LBM23001 and Petrimonassulfuriphila LBM11005 under co-culture conditions increased by 91% (from 1.27×10 7 The copies / mL increased to 2.43×10 7 copies / mL) and 52% (from 1.24×10 7 The copies / mL increased to 1.89×10 7 copies / mL), indicating that the two microorganisms have a mutualistic interaction relationship and co-cultivation of the two can increase the absolute biomass of each other.

[0139] This example shows that co-culturing Caproicibacterium lactatifermentansLBM23001 and Petrimonas sulfuriphila LBM11005 under the carbon source of lactic acid can produce new odd-carbon fatty acids, and can promote the caproic acid yield of the fermentation system and the increase of the biomass of the two microorganisms.

[0140] Example 3: Co-culture of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila to produce odd-numbered fatty acids under glucose carbon source

[0141] The seed liquid activation and preparation, deoxygenation and inoculation methods in this embodiment are consistent with those in Example 2, except that, instead of adding lactic acid, glucose is added as an accessible carbon source, that is, when the culture medium is prepared, the lactic acid with a final concentration of 20 g / L is replaced by glucose with a final concentration of 20 g / L, and the remaining components of the culture medium are consistent with those in Example 2.

[0142] After fermentation and cultivation according to the setting of the control group and the experimental group in Example 2, the results are shown in Table 4.

[0143] Table 4: Growth at the fermentation endpoint, pH value at the fermentation endpoint, glucose utilization and accumulation of short and medium chain fatty acids in different groups when glucose was used as the carbon source

[0144]

[0145] As shown in Table 4, by using the method of this embodiment, Caproicibacterium lactatifermentans and Petrimonassulfuriphila were co-fermented using MGF medium with glucose as the carbon source, and 0.34 g / L of valeric acid was produced, while the control group did not produce valeric acid.

[0146] Example 4: Petrimonas sulfuriphila in yellow water matrix can promote the growth and caproic acid production of Caproicibacterium lactatifermentans, and co-culture produces odd-numbered fatty acids

[0147] The specific implementation is as follows:

[0148] 1. Preparation of seed solution

[0149] (1) Preparation of Caproicibacterium lactatifermentans seed solution: The Caproicibacterium lactatifermentans LBM23001 strain was inoculated into the mCGM seed culture medium, and anaerobically cultured at 37°C for 48 hours to prepare the activation. Then, the prepared activation solution was inoculated into 10 ml of mCGM culture medium at an inoculum amount of 10% (v / v), and anaerobically cultured at 37°C for 36 hours to prepare the seed solution;

[0150] (2) Preparation of Petrimonas sulfuriphila seed solution: The Petrimonas sulfuriphila LBM11005 strain was inoculated into a PY medium, and cultured at 37°C for 48 hours to prepare an activation solution; the prepared activation solution was inoculated into 10 ml of a PY medium base at an inoculum amount of 10% (v / v), and cultured at 37°C for 48 hours to prepare a seed solution;

[0151] (3) Preparation of raw yellow water culture medium: In an anaerobic chamber, add oxygen-free water at a ratio of 50% (v / v) to dilute the yellow water, and adjust the pH of the diluted yellow water to 7.0 using 8M sodium hydroxide.

[0152] The physical and chemical properties of the yellow water involved are pH 3.35-3.5, lactic acid 64.21-79.34 g·L -1 , acetic acid 2.55~8.13g·L -1 , ethanol 36.56~53.99g·L -1.

[0153] 2. The grouping and fermentation method were the same as in Example 2, except that the lactic acid MGF medium was adjusted to a raw yellow water medium. After the fermentation was completed, the pH value, lactic acid utilization, short- and medium-chain fatty acid accumulation, and microbial biomass of each group at the end of the fermentation were detected according to the method of Example 2.

[0154] (1) The pH value and lactic acid utilization of each group at the end of fermentation are shown in Table 5.

[0155] Table 5: Growth, lactic acid utilization and accumulation of short and medium chain fatty acids at the end of fermentation in different groups in yellow water matrix

[0156]

[0157] As shown in Table 5, the fermentation systems inoculated with Caproicibacterium lactatifermentans all showed a "pH-increasing" fermentation mode, while the other groups showed a "pH-decreasing" fermentation mode. Caproicibacterium lactatifermentans had a stronger lactic acid utilization ability in the co-culture system, which was 49% higher than that of the single culture (control group 2). The production of caproic acid was coupled with the consumption of lactic acid, and the maximum production of caproic acid in the co-culture system was 11.68 g·L -1 , compared with the single culture of control group 2, it increased by 31%, and the caproic acid production rate increased by 28.5% (from 1.6 g / L / d to 2.1 g / L / d).

[0158] (2) Confirmation of the growth of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila

[0159] The absolute biomass detection method of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila is shown in Example 1.

[0160] The results are as follows Figure 2 As shown in the figure, the results of fluorescence quantitative PCR showed that the yellow water matrix could promote the increase of the absolute biomass of the two microorganisms in the co-culture mode. Under the co-culture conditions, the biomass of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila were 4.7×107 copies / ml and 2.0×10 7 copies / ml, and the biomass increased by 38% (from 3.4×10 7 The copies / ml was increased to 4.7×10 7 copies / ml) and 81% (from 1.1×10 7 The copies / ml was increased to 2.0×10 7 copies / ml).

[0161] Example 5: Acquisition of a streamlined acid-producing bacterial population containing Caproicibacterium lactatifermentans and efficient fermentation conversion of lactic acid to caproic acid

[0162] 1. The specific steps for obtaining the acid-producing bacteria containing Caproicibacterium lactatifermentans are as follows:

[0163] Low nitrogen source MM medium (g / L): lactic acid 10.0, yeast powder 1.0, sodium acetate 5.0, (NH4)2SO4 2.0, MgSO4·7H2O0.2, NaH2PO4·2H2O 0.5, CaCl2·2H2O 0.1, K2HPO4 0.5, trace elements 300μL. Trace element composition (mg / L): FeSO4·7H2O 2 000.0, ZnCl2 50.0, MnCl2·4H2O 500.0, CuCl2·H2O 30.0, (NH4)6Mo7O 24 ·4H2O 50.0, CoCl2·6H2O 2 000.0, NiCl2·6H2O 50.0, Na2SeO3·5H2O 100.0, H3BO350.0, EDTA 1 000.0, HCl (ω=36%) 1mL.

[0164] The physicochemical properties of the yellow water are consistent with those of Example 4.

[0165] To obtain the acid-producing functional bacterial flora, the caproic acid-producing simplified bacterial flora was screened using the "enrichment-plating" method; the specific steps are as follows:

[0166] (1) Old cellar mud was used as the source of bacterial flora screening. The old cellar mud was inoculated into MM medium with an initial pH of 5.5 and 20% volume fraction of yellow water added. The old cellar mud was inoculated at a mass volume fraction (cellar mud mass: fermentation system volume) of 5%. The microorganisms in the cellar mud were enriched and cultured at 37°C for 7 days to obtain an enriched bacterial solution.

[0167] (2) Then, the enriched bacterial solution obtained in step (1) was treated with mCGM medium with lactic acid as the carbon source at 10 -3 , 10 -4 and 10 -5 After dilution, 100 μl of bacterial solution was spread on mCGM agar plates (carbon source was lactic acid) and cultured in an anaerobic workstation at 37°C for 3 days.

[0168] (3) Then, a single colony was picked and inoculated into mCGM liquid culture medium containing lactic acid as carbon source, and cultured anaerobically at 37°C for 7 days. The production of caproic acid and butyric acid in the culture supernatant was determined by gas chromatography, and the bacterial culture with a caproic acid concentration of >1 g / L was retained, and the bacterial culture was expanded and maintained.

[0169] Microscopic examination and Sanger sequencing showed that the colonies obtained by this method without further purification were bacterial colonies containing Bacillus lactic acid, which we defined as "caproic acid-producing streamlined bacterial colonies".

[0170] As shown in Tables 6 and 7, the "enrichment-plating" method can obtain a bacterial community with a simple structure and high caproic acid production, and Caproicibacterium lactatifermentans is the dominant microorganism in the community, with a relative abundance of 36.7%. We named the sample with the highest caproic acid production SimpCom1 for subsequent fermentation experiments.

[0171] Table 6: Production of short-chain and medium-chain fatty acids using lactic acid by different streamlined bacterial communities obtained by the "enrichment-plating" method

[0172] Sample name Acetic acid (g / L) Butyric acid (g / L) Hexanoic acid(g / L) SimpCom1 1.7 2.8 5.5 SimpCom2 2.3 1.6 2.6 SimpCom3 2.5 2.1 4.6 SimpCom4 2.6 2.3 4.7 SimpCom5 0.7 3.2 5.3 SimpCom6 3.7 2.6 4.0 SimpCom7 1.0 3.3 4.4 SimpCom8 3.1 2.8 3.5 SimpCom9 1.9 1.6 1.8 SimpCom10 0.6 3.5 3.7 SimpCom11 1.3 4.0 3.4 SimpCom12 3.2 6.2 1.5

[0173] Table 7: Microbial community structure of SimpCom1 under lactic acid carbon source

[0174] Microorganism name Relative abundance (%) Ligilactobacillus acidipiscis 52.4 Caproicibacterium lactatifermentans 36.7 Butyriproducens baijiuensis 7.1 Clostridium tyrobutyricum 1.3 other 2.5

[0175] 2. Preparation of seed solution

[0176] (1) Use mCGM culture medium to activate the simplified bacterial community SimpCom1 and prepare seed solution. The specific components of the culture medium are the same as those in Example 1, and the carbon source is a composite carbon source composed of 5g / L glucose and 20g / L lactic acid. The specific steps are: inoculate SimpCom1 into mCGM culture medium (the carbon source is lactic acid), anaerobically culture at 37°C for 48h to prepare an activation solution; inoculate the prepared activation solution into 10ml mCGM culture medium (the carbon source is lactic acid) at an inoculation rate of 10% (v / v), anaerobically culture at 37°C for 24h to prepare SimpCom1 seed solution.

[0177] (2) Take out the SimpCom1 seed solution and inoculate it into the mCGM medium described in step (1) at an inoculation amount of 10% (v / v), culture it under anaerobic conditions at 37°C for 24-48 hours, and then transfer it to fresh seed medium (mCGM medium composed of a composite carbon source of 5 g / L glucose and 20 g / L lactic acid) at an inoculation amount of 5% (v / v), and culture it for 24-48 hours to obtain a primary seed solution;

[0178] (3) The prepared first-level seed solution was inoculated at a 5% (v / v) inoculum into 30 mL of seed culture medium (mCGM culture medium composed of a composite carbon source of 5 g / L glucose and 20 g / L lactic acid), and cultured at 37° C. under anaerobic conditions for 24 h to 48 h to obtain a second-level seed solution;

[0179] (4) The prepared secondary seed liquid was transferred into 100 ml of seed culture medium (mCGM culture medium composed of a composite carbon source of 5 g / L glucose and 20 g / L lactic acid) at a 5% (v / v) inoculation amount for fermentation. The culture was cultured at 37°C under anaerobic conditions for 24 h to 48 h to obtain a tertiary seed liquid.

[0180] 3. Optimization of fermentation conditions of functional bacterial liquid

[0181] Fed-batch fermentation was adopted to investigate the effect of pH after feeding on the production of caproic acid by SimpCom1.

[0182] Raw yellow water culture medium: Raw fermentation experiments were carried out on simplified bacterial flora using yellow water with an initial pH of 5.5 and a dilution of 50% (v / v).

[0183] When investigating the effect of pH after feeding on the production of caproic acid by bacterial fermentation, HCl was used to adjust the pH to different concentrations (pH 5.5, 6.0, 6.5, 7.5) and the substrate concentration was uniformly adjusted to 40 g / L before conducting fermentation experiments.

[0184] The specific steps are as follows:

[0185] SimpCom1 in the logarithmic phase (the third-level seed solution in step (4) of step 2) was inoculated into 100 mL of the above raw material yellow water medium at an inoculation rate of 10% (v / v) of the total fermentation volume for fermentation. Three parallel groups were set for each condition. The results are shown in Table 8:

[0186] Table 8: Growth, pH, lactic acid utilization and accumulation of short and medium chain fatty acids at the end of fermentation in different pH control groups

[0187] pH <![CDATA[OD 600 ]]> pH Lactic acid (g / L) Acetic acid (g / L) Butyric acid (g / L) Hexanoic acid(g / L) 5.5 0.86±0.03 6.20±0.02 25.06±3.93 5.3±0.3 1.39±0.29 12.73±1.1 6.0 1.25±0.09 7.64±0.05 42.28±1.33 1.67±0.15 0.61±0.11 16.19±0.57 6.5 1.22±0.04 7.76±0.08 38.94±3.06 0.55±0.13 0.61±0.17 16.87±0.28 7.5 1.68±0.07 7.76±0.04 32.25±0.07 3.53±0.33 0.61±0.17 11.32±0.39

[0188] As shown in Table 8, the optimal post-feeding pH is 6.5. At this pH, the maximum utilization of lactic acid in yellow water during the entire batch fermentation cycle is about 21.46 g / (L·d) (fermentation 1-2 days), and the maximum caproic acid production reaches 16.87 g / L.

[0189] like Figure 3 As shown in the figure, during the yellow water fermentation process, Caproicibacterium lactatifermentans was the absolute dominant microorganism, and its relative abundance at the end of the fermentation accounted for 76.5% to 98.52% of the total species abundance. In addition, after collecting the cells of equal volume of fermentation broth and centrifuging it, we found that the amount of cells gathered at the bottom of the test tube was related to the OD value of the cells fed to different pH conditions. 600 The overall change trend of the value and absolute biomass is consistent.

[0190] In summary, when using 50% yellow water as a substrate for fermentation, pH 6.5 after feeding is a more suitable fermentation condition for caproic acid production, while the more suitable pH for the preparation of caproic acid-producing bacterial flora is 7.5.

[0191] 4. Preparation of amplified culture of functional bacterial solution

[0192] The fermentation conditions of SimpCom1 bacterial community are controlled as follows:

[0193] After determining the optimal feeding method, the fermentation was scaled up in a 3L fermenter using batch feeding to evaluate the maximum production of caproic acid. The fermentation experiment was carried out with yellow water at an initial pH of 5.5 and a dilution of 50% (v / v). When the pH reached 6.5 (fermentation for 48 hours), the pH of the fermentation system was controlled between 6.5 and 7.0.

[0194] In an anaerobic workstation, the bacterial community SimpCom1 (the third-level seed solution in step (4) of step 2) was inoculated into mCGM medium (a composite carbon source consisting of 5 g / L glucose and 20 g / L lactic acid), and seed solution was prepared after anaerobic culture at 37°C for 24 hours; the prepared seed solution was transferred to a 3L fermenter at an inoculation ratio of 10% (v / v) of the total fermentation volume. The initial yellow water pH value in the fermenter was 5.5, and the pH value was controlled by 8 mol / L HCl (6.5≤pH≤7.0), and the fermentation temperature was controlled at 37°C.

[0195] During the fermentation process, the lactic acid utilization and the production of volatile fatty acids (acetic acid, butyric acid, caproic acid) in the fermentation process were monitored after each sampling. When the lactic acid consumption was almost complete, about 50% of the fermentation broth was released, and an equal volume of yellow water with a dilution of 50% (v / v) was added at the same time, and the speed was set at 200r / min.

[0196] The yellow water is a by-product produced during the fermentation of Luzhou-flavor liquor, and mainly contains ethanol, lactic acid and some other trace flavor substances. The composition and treatment method of the yellow water are consistent with those in Example 4.

[0197] The feed liquid is: treated yellow water prepared according to the method of step example 4.

[0198] The method can realize the continuous production of functional bacterial liquid, wherein the main monitoring index is: the caproic acid content of the liquid is greater than 20g / L, and the raw material yellow water can be used in a semi-continuous batch feed fermentation method to realize efficient fermentation preparation of caproic acid.

[0199] The functional bacterial solution was prepared by the above method, and the performance of the functional bacterial solution is shown in Table 9:

[0200] Table 9: Fermentation characterization of functional bacterial broth obtained in 3L fermenter

[0201]

[0202]

[0203] As can be seen from Table 9, the method of the present invention can maintain a stable caproic acid yield (caproic acid yield>20 g / L). During the operation of the entire fermenter, the fermentation process is stable. Through continuous feeding operation, large-scale continuous long-term stable production operation is achieved, which saves fermentation time and improves the conversion efficiency of lactic acid to caproic acid.

[0204] Example 6: Co-fermentation of a simplified acid-producing bacterial population containing Caproicibacterium lactatifermentans and Petrimonas sulfuriphila in yellow water to increase caproic acid production

[0205] The physicochemical properties of the yellow water were consistent with those of Example 4. The activation of Petrimonas sulfuriphila LBM11005 and the preparation of the seed solution were consistent with those of Example 2. The inoculation method of the co-fermentation was consistent with that of Example 2.

[0206] The seed solution of Petrimonas sulfuriphila LBM11005 is prepared by inoculating Petrimonas sulfuriphila LBM11005 into a PY medium, anaerobic culture is performed at 37° C. for 72 hours, and an activation solution is prepared; the prepared activation solution is inoculated into 10 ml of a PY medium at an inoculum amount of 10% (v / v), and anaerobically cultured at 37° C. for 48 hours to prepare a LBM11005 seed solution;

[0207] The specific settings of the control group and experimental group are as follows:

[0208] Control group 1 (yellow water): The treated yellow water (deoxygenated, pH 7.0) was divided into 100 ml for fermentation. The fermentation conditions were: anaerobic culture at 37 °C for 5 days;

[0209] Control group 2 (SimpCom1+yellow water): The obtained SimpCom1 seed solution (the third-level seed solution in step (4) of step 2 of Example 5) was inoculated into 100 ml of yellow water pre-packed at an inoculation ratio of 10% (v / v) for fermentation. The fermentation conditions were: anaerobic culture at 37°C for 5 days;

[0210] Control group 3 (Petrimonas sulfuriphila LBM11005+yellow water): the obtained LBM11005 seed solution was inoculated into 100 ml of pre-packed yellow water at an inoculation ratio of 10% (v / v) for fermentation. The fermentation conditions were: anaerobic culture at 37°C for 5 days;

[0211] Co-culture group (SimpCom1 + Petrimonas sulfuriphila LBM11005): The SimpCom1 seed solution and the Petrimonas sulfuriphila LBM11005 seed solution were inoculated into 100 ml of MGF medium (carbon source was lactic acid) pre-packed at a bacterial concentration ratio of 1:1 and a total seed solution inoculation amount of 10% (v / v) for fermentation. The fermentation conditions were: anaerobic culture at 37°C for 5 days.

[0212] By adopting the method, the production of caproic acid in the fermentation system can be increased by about 18% by using only batch fermentation, and the entire fermentation process is simple to operate.

[0213] The performance characteristics of the functional bacterial liquid prepared by the above method are shown in Table 10.

[0214] Table 10: pH values, lactic acid utilization and short- and medium-chain fatty acid production at the end of the fermentation obtained by batch co-fermentation

[0215]

[0216] As shown in Table 10, after co-fermentation with the SimpCom1 bacterial community and the Petrimonas sulfuriphila LBM11005, polyunsaturated fatty acids such as acetic acid, propionic acid, butyric acid, valeric acid, and caproic acid were produced, providing acid precursors for the esterification process of liquor. At the same time, compared with the control group 2, the caproic acid production in the co-fermentation group (experimental group) was increased by about 18%. The Petrimonas sulfuriphila LBM11005 strain effectively promoted the caproic acid production ability of the streamlined bacterial community SimpCom1 containing Caproicibacterium lactatifermentans.

[0217] The above tests show that Petrimonas sulfuriphila LBM11005 can also be used for the fermentation conversion of lactic acid to caproic acid containing the Caproicibacterium lactatifermentans flora. In view of the fact that raw yellow water has certain nutrient fluctuations, the promotion effect of Petrimonas sulfuriphila LBM11005 on the growth and caproic acid production of Caproicibacterium lactatifermentans is beneficial.

[0218] Example 7: Preparation of composite esterification products by esterification of short- and medium-chain fatty acid fermentation broth

[0219] All are the final bacterial liquid obtained at the end of fermentation:

[0220] The present invention also provides a method for extracting after esterification a functional bacterial liquid with high concentration of caproic acid prepared from a yellow water co-fermentation liquid containing a bacterial community of Caproicibacterium lactatifermentans and Petrimonas sulfuriphila, and the specific implementation methods are as follows:

[0221] (1) Esterification of short- and medium-chain fatty acid fermentation broth: The fermentation broth was supplemented with ethanol to a final concentration of 30% (v / v), the pH was adjusted to 4.5 using HCl solution, 0.5 g / 100 mL of Rhizopus chinensis lipase preparation (specific enzyme activity: 19.58 U / mg) was added to the reaction system, and the reaction was shaken at 30°C for 4 h.

[0222] (2) Distillation of fermentation broth: After the esterification reaction is completed, ethanol is added to a final concentration of 50%, and distillation is performed under normal pressure. The distillate is collected regularly and distilled until the alcohol content is <65% (about 90 minutes). The expected distillate is 300 mL, and 180 mL of fermentation broth remains. The concentrations of fatty acids and esters in the fermentation broth are tested. The results are shown in Table 11.

[0223] Table 11: Characterization of products after esterification and distillation

[0224] Substance concentration Before esterification Before distillation Fraction 1 Fraction 2 Fraction 3 Fraction 4 Fraction 5 Residue after distillation Acetic acid (g / L) 1.85 1.38 0.02 0.02 0.01 0.01 0.05 0.77 Propionic acid(g / L) 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Butyric acid (g / L) 0.64 0.37 0.01 0.00 0.01 0.02 0.06 0.14 Hexanoic acid(g / L) 10.95 6.41 0.07 0.11 0.13 0.37 0.97 1.36 Ethyl acetate (g / L) 0.00 0.32 0.08 0.10 0.06 0.03 0.02 0.00 Ethyl butyrate(g / L) 0.48 0.58 0.03 0.04 0.01 0.00 0.00 0.00 Ethyl hexanoate(g / L) 0.00 4.17 0.67 1.17 0.92 0.63 0.78 0.18

[0225] By using lipase to esterify the fermentation broth in Example 4, the high concentration of caproic acid and other short and medium-chain fatty acids (acetic acid and butyric acid) produced by fermentation in the functional bacterial broth can be successfully converted into corresponding ester substances. The multi-short and medium-chain ester substances obtained by esterification can be further purified by collecting the distillate at regular intervals. The specific characterization of the products after esterification and distillation is shown in Table 11. The obtained ester substances are prepared by pure biological fermentation method and can be used as high-quality food-grade flavors.

[0226] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Bacillus lactis ( Caproicibacterium lactatifermentans ) LBM23001, characterized in that, The Bacillus lactis is deposited in Guangdong Microbial Culture Collection Center with the deposit number GDMCC No: 64722 and the deposit date June 4, 2024.

2. A microbial preparation containing the Bacillus acidophilus LBM23001 according to claim 1.

3. The microbial preparation according to claim 2, characterized in that The microbial preparation is a liquid bacterial preparation or a solid bacterial preparation containing living cells of Bacillus lactis LBM23001.

4. The microbial preparation according to claim 3, characterized in that The living cells of Bacillus acidilyticus LBM23001 are dry bacteria of Bacillus acidilyticus LBM23001 obtained by freeze-drying or fixed cells of Bacillus acidilyticus LBM23001.

5. The microbial preparation according to claim 3 or 4, characterized in that: The microbial preparation also contains sulfadiazole ( Petrimonas sulfuriphila ) LBM11005; the lactobacillus acidophilus LBM23001 and sulfidomonas LBM11005 were obtained according to OD 600 =1:1 ratio, the OD of the two added microorganisms 600 At least above 0.5; the deposit number of the sulfidophilic Lithomonas LBM11005 is GDMCC NO.61648.

6. A method for preparing polyvalent short-chain and medium-chain fatty acids using lactic acid or glucose as a carbon source and promoting the production of caproic acid in a fermentation system and the biomass of microorganisms, characterized in that: The method comprises the following steps: adding the lactobacillus acidisolute LBM23001 described in claim 1, or simultaneously adding sulfolithomonas LBM11005 and the lactobacillus acidisolute LBM23001 described in claim 1, to a system containing lactic acid or glucose, and performing fermentation culture; the polyvalent short-chain and medium-chain fatty acids are acetic acid, propionic acid, butyric acid, valeric acid and caproic acid; the preservation number of the sulfolithomonas LBM11005 is GDMCC NO.61648; and the microorganisms are lactobacillus acidisolute LBM23001 and sulfolithomonas LBM11005.

7. The method according to claim 6, characterized in that The lactobacillus acidophilus LBM23001 and the sulfidomonas LBM11005 were isolated according to OD 600 =1:1 ratio, the OD of the two added microorganisms 600 At least above 0.

5.

8. A method for preparing polyvalent short and medium chain fatty acids using yellow water matrix as a substrate and promoting the growth of Bacillus lactis LBM23001 and increasing the biomass of microorganisms in a system using yellow water matrix as a substrate, characterized in that: The method comprises adding the lactobacillus acidophilus LBM23001 described in claim 1, or simultaneously adding sulfolithomonas LBM11005 and the lactobacillus acidophilus LBM23001 described in claim 1 to a system containing a yellow water matrix, and performing fermentation culture; The polyvalent short and medium chain fatty acids are acetic acid, propionic acid, butyric acid, valeric acid and caproic acid; the preservation number of the sulfolithomonas LBM11005 is GDMCC NO.61648; and the microorganisms are lactobacillus hexanoic acid LBM23001 and sulfolithomonas LBM11005.

9. The method according to claim 8, characterized in that The lactobacillus acidophilus LBM23001 and the sulfidomonas LBM11005 were isolated according to OD 600 =1:1 ratio, the OD of the two added microorganisms 600 At least above 0.

5.

10. The method according to claim 8 or 9, characterized in that: In the yellow water matrix: lactic acid 24.07~26.71g·L -1 , acetic acid 3.21~4.38 g·L -1 .

11. A method for preparing a composite esterification product, characterized in that: The method comprises the following steps: adding ethanol to a final concentration of 30% (v / v) to a fermentation broth, adjusting the pH to 4.5 using an HCl solution, adding a Rhizopus chinensis lipase preparation in an amount of 0.1-0.5 g / 100 mL of the reaction system, and shaking the reaction at 30° C. for 4 h; the specific enzyme activity of the Rhizopus chinensis lipase preparation is 19.58 U / mg; The composite esterification product is ethyl acetate, ethyl butyrate, and ethyl caproate; The fermentation broth is obtained by adding the lactobacillus acidophilus LBM23001 described in claim 1, or adding sulfolithomonas LBM11005 and the lactobacillus acidophilus LBM23001 described in claim 1 simultaneously to a system containing lactic acid, glucose or yellow water matrix, and fermenting and culturing the mixture; the deposit number of the sulfolithomonas LBM11005 is GDMCCNO.61648.

12. The preparation method according to claim 11, characterized in that: The lactobacillus acidophilus LBM23001 and the sulfidomonas LBM11005 were isolated according to OD 600 =1:1 ratio, the OD of the two added microorganisms 600 At least above 0.

5.

13. Use of the lactobacillus acidisolutes LBM23001 described in claim 1, or the microbial preparation described in any one of claims 2 to 5, or the method described in any one of claims 6 to 12 in treating and recovering wastewater rich in lactic acid, or in improving the quality of cellar mud, or in making artificial cellar mud, or in improving the quality of liquor brewing.

Images